Structured Review

Eurofins primer sequences
Primer Sequences, supplied by Eurofins, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/Eurofins
Average 93 stars, based on 8 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
93/100 stars

Images

Related Articles

Sequencing:

Article Title: Little exercise, big effects: Reversing aging and infection-induced memory deficits, and underlying processes
Article Snippet: .. Primer sequences were designed using the Eurofins MWG Operon Oligo Analysis & Plotting Tool ( ) and tested for sequence specificity using the Basic Local Alignment Search Tool at NCBI ( ). ..

Real-time Polymerase Chain Reaction:

Article Title: Changes in the expression of genes involved in the ovarian function of rats caused by daily exposure to 3-methylcholanthrene and their prevention by α-Naphthoflavone
Article Snippet: .. Genomic regions of interest were amplified by qPCR. shows the primer sequences (Eurofins MWG Operon, Huntsville, AL, USA) used to detect the DNA fragment of interest in the immunoprecipitated DNA. .. For semiquantitative detection, PCR reactions were performed using SYBR Green ER (Invitrogen) with each immunoprecipitated DNA or input samples.

Amplification:

Article Title: Changes in the expression of genes involved in the ovarian function of rats caused by daily exposure to 3-methylcholanthrene and their prevention by α-Naphthoflavone
Article Snippet: .. Genomic regions of interest were amplified by qPCR. shows the primer sequences (Eurofins MWG Operon, Huntsville, AL, USA) used to detect the DNA fragment of interest in the immunoprecipitated DNA. .. For semiquantitative detection, PCR reactions were performed using SYBR Green ER (Invitrogen) with each immunoprecipitated DNA or input samples.

Synthesized:

Article Title: Promoter Region Hypermethylation and mRNA Expression of MGMT and p16 Genes in Tissue and Blood Samples of Human Premalignant Oral Lesions and Oral Squamous Cell Carcinoma
Article Snippet: .. The primer sequences for MGMT , p16 , and β -Actin gene were selected from published articles [ – ] and synthesized by Eurofins MWG Operon, India. .. Primer sequences were cross-checked by Primer Express software 3.0 (Applied Biosystems, USA) and Blast sequence analysis (National Centre for Biotechnology Information, USA).

Article Title: IL-36γ is a pivotal inflammatory player in periodontitis-associated bone loss
Article Snippet: .. Primer sequences are indexed in Supplementary Table and were synthesized by Eurofins Scientific® (Luxembourg). .. For the analyses, SDHA , beta-actin , and B2M were used as endogenous control and the relative gene expression levels were calculated with the 2−∆∆Ct method.

Immunoprecipitation:

Article Title: Changes in the expression of genes involved in the ovarian function of rats caused by daily exposure to 3-methylcholanthrene and their prevention by α-Naphthoflavone
Article Snippet: .. Genomic regions of interest were amplified by qPCR. shows the primer sequences (Eurofins MWG Operon, Huntsville, AL, USA) used to detect the DNA fragment of interest in the immunoprecipitated DNA. .. For semiquantitative detection, PCR reactions were performed using SYBR Green ER (Invitrogen) with each immunoprecipitated DNA or input samples.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Eurofins pde8a intron 9 specific primers
    Editing sites in the <t>intron</t> 9 of <t>PDE8A</t> pre-mRNA from human brain. Putative PDE8A intron 9 mRNA secondary structure as predicted by Vienna RNA Websuite. The mRNA positions where significant editing events have been detected are highlighted with arrows. Editing Sites A to G have been previously described in T cells 32 . Newly identified sites in the brain are highlighted in red. Most of the editing sites are in close proximity to each other. All bases are annotated on chromosome 15 according to the last GRCh38 genebuild
    Pde8a Intron 9 Specific Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pde8a intron 9 specific primers/product/Eurofins
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pde8a intron 9 specific primers - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    92
    Eurofins taqman probe
    Activation of foetal gene markers in the hearts of R6/2 and Hdh Q150 mice. (A) Anp (atrial natriuretic peptide), (B) Bnp (brain natriuretic protein) and (C, D) members of the four and half LIM family Fhl1 and Fhl2 were elevated in the heart of R6/2 and Hdh Q150 mice. All <t>Taqman</t> qPCR values were normalized to the geometric mean of three housekeeping genes: Actb , Cyc1 and Gapdh . Error bars are SEM (n = 6). Student's t -test: * p
    Taqman Probe, supplied by Eurofins, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman probe/product/Eurofins
    Average 92 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    taqman probe - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    89
    Eurofins mtdna sequence
    ERβ modulation leads to alterations in mitochondrial functions. ( a ) Spectrophotometric evaluation of MRC complexes enzymatic activities in Mock, ERβ over-expressing (ERβ) or ERβ-silenced (shERβ) REN cells. ( b ) Spectrophotometric determination of mitochondrial ATP synthesis in Mock, ERβ over-expressing or ERβ-silenced REN cells. ( c ) Electron microscopy analysis performed to observe mitochondrial number and morphology in Mock or ERβ over-expressing REN cells. Arrowheads indicate some of the mitochondria, scale bars correspond to 2.5 μm in top left, 3.33 μm in top right, 0.66 μm in bottom left and 1.25 μm in bottom right. N, nucleus. ( d ) Mitochondrial mass per cell measured in Mock and ERβ over-expressing REN cells with the cardiolipin-selective dye, NAO. ( e ) Changes in <t>mtDNA</t> content relative to the nuclear DNA calculated by real-time PCR of the D-loop and <t>ACTB</t> in Mock and ERβ over-expressing REN cells. Each graph is representative of three independent experiments. Each bar represents mean±s.d. * P
    Mtdna Sequence, supplied by Eurofins, used in various techniques. Bioz Stars score: 89/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mtdna sequence/product/Eurofins
    Average 89 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mtdna sequence - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    86
    Eurofins jak3 gene
    a Subfamilies Vβ20-22 of normal donor and patient 1 are shown as representatives of Vβ TCR Spectratyping data. b Sequencing of the <t>JAK3</t> in genomic DNA derived from sorted lymphocyte subsets of both index patients. The mutation site is highlighted with a gray background
    Jak3 Gene, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/jak3 gene/product/Eurofins
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    jak3 gene - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    Editing sites in the intron 9 of PDE8A pre-mRNA from human brain. Putative PDE8A intron 9 mRNA secondary structure as predicted by Vienna RNA Websuite. The mRNA positions where significant editing events have been detected are highlighted with arrows. Editing Sites A to G have been previously described in T cells 32 . Newly identified sites in the brain are highlighted in red. Most of the editing sites are in close proximity to each other. All bases are annotated on chromosome 15 according to the last GRCh38 genebuild

    Journal: Translational Psychiatry

    Article Title: Brain region-specific alterations of RNA editing in PDE8A mRNA in suicide decedents

    doi: 10.1038/s41398-018-0331-3

    Figure Lengend Snippet: Editing sites in the intron 9 of PDE8A pre-mRNA from human brain. Putative PDE8A intron 9 mRNA secondary structure as predicted by Vienna RNA Websuite. The mRNA positions where significant editing events have been detected are highlighted with arrows. Editing Sites A to G have been previously described in T cells 32 . Newly identified sites in the brain are highlighted in red. Most of the editing sites are in close proximity to each other. All bases are annotated on chromosome 15 according to the last GRCh38 genebuild

    Article Snippet: The set of fluorescent, PDE8A intron 9-specific primers was as follows: forward 5′P-FAM-CTAGGGAACCCTGTTTAGTCC-3′OH (Eurofins MWG operons) and reverse 5′P- VIC-CAATGGGCACCAAAAAAGGG-3′OH (Applied Biosystems).

    Techniques:

    Activation of foetal gene markers in the hearts of R6/2 and Hdh Q150 mice. (A) Anp (atrial natriuretic peptide), (B) Bnp (brain natriuretic protein) and (C, D) members of the four and half LIM family Fhl1 and Fhl2 were elevated in the heart of R6/2 and Hdh Q150 mice. All Taqman qPCR values were normalized to the geometric mean of three housekeeping genes: Actb , Cyc1 and Gapdh . Error bars are SEM (n = 6). Student's t -test: * p

    Journal: PLoS Genetics

    Article Title: Dysfunction of the CNS-Heart Axis in Mouse Models of Huntington's Disease

    doi: 10.1371/journal.pgen.1004550

    Figure Lengend Snippet: Activation of foetal gene markers in the hearts of R6/2 and Hdh Q150 mice. (A) Anp (atrial natriuretic peptide), (B) Bnp (brain natriuretic protein) and (C, D) members of the four and half LIM family Fhl1 and Fhl2 were elevated in the heart of R6/2 and Hdh Q150 mice. All Taqman qPCR values were normalized to the geometric mean of three housekeeping genes: Actb , Cyc1 and Gapdh . Error bars are SEM (n = 6). Student's t -test: * p

    Article Snippet: The primers and Taqman probe for Anf were: Fw 5′ > GAGCAAATCCTGTGTACAGTGCGG > 3′, Rv: 5′ > GCATCTTCTCCTCCAGGTGGTCTAG > 3, probe: 5′ > TCCAACACAGATCTGATG GATTTCAAG > 3′ (Eurofins Operon) and the PCR product was verified by sequencing.

    Techniques: Activation Assay, Mouse Assay, Aqueous Normal-phase Chromatography, Real-time Polymerase Chain Reaction

    ERβ modulation leads to alterations in mitochondrial functions. ( a ) Spectrophotometric evaluation of MRC complexes enzymatic activities in Mock, ERβ over-expressing (ERβ) or ERβ-silenced (shERβ) REN cells. ( b ) Spectrophotometric determination of mitochondrial ATP synthesis in Mock, ERβ over-expressing or ERβ-silenced REN cells. ( c ) Electron microscopy analysis performed to observe mitochondrial number and morphology in Mock or ERβ over-expressing REN cells. Arrowheads indicate some of the mitochondria, scale bars correspond to 2.5 μm in top left, 3.33 μm in top right, 0.66 μm in bottom left and 1.25 μm in bottom right. N, nucleus. ( d ) Mitochondrial mass per cell measured in Mock and ERβ over-expressing REN cells with the cardiolipin-selective dye, NAO. ( e ) Changes in mtDNA content relative to the nuclear DNA calculated by real-time PCR of the D-loop and ACTB in Mock and ERβ over-expressing REN cells. Each graph is representative of three independent experiments. Each bar represents mean±s.d. * P

    Journal: Oncogenesis

    Article Title: Estrogen receptor ? activation impairs mitochondrial oxidative metabolism and affects malignant mesothelioma cell growth in vitro and in vivo

    doi: 10.1038/oncsis.2013.32

    Figure Lengend Snippet: ERβ modulation leads to alterations in mitochondrial functions. ( a ) Spectrophotometric evaluation of MRC complexes enzymatic activities in Mock, ERβ over-expressing (ERβ) or ERβ-silenced (shERβ) REN cells. ( b ) Spectrophotometric determination of mitochondrial ATP synthesis in Mock, ERβ over-expressing or ERβ-silenced REN cells. ( c ) Electron microscopy analysis performed to observe mitochondrial number and morphology in Mock or ERβ over-expressing REN cells. Arrowheads indicate some of the mitochondria, scale bars correspond to 2.5 μm in top left, 3.33 μm in top right, 0.66 μm in bottom left and 1.25 μm in bottom right. N, nucleus. ( d ) Mitochondrial mass per cell measured in Mock and ERβ over-expressing REN cells with the cardiolipin-selective dye, NAO. ( e ) Changes in mtDNA content relative to the nuclear DNA calculated by real-time PCR of the D-loop and ACTB in Mock and ERβ over-expressing REN cells. Each graph is representative of three independent experiments. Each bar represents mean±s.d. * P

    Article Snippet: For a quantitative analysis of mtDNA content, total genomic DNA was extracted from previously transfected cells using the NucleoSpin kit (Macherey-Nagel, Düren, Germany); primers for D-loop , mtDNA sequence and ACTB nuclear DNA sequences, obtained from Eurofins MWG Operon (Ebersberg, Germany), were used as described.

    Techniques: Expressing, Electron Microscopy, Real-time Polymerase Chain Reaction

    SDH B silencing leads to alteration in the activity of MRC complexes, mitochondrial biogenesis but not cell proliferation. ( a ) Spectrophotometric evaluation of MRC complexes enzymatic activities in non-specific control siRNA (c siRNA) and SDHB- (siRNA SDHB) silenced REN cells. ( b ) Electron microscopy analysis performed to observe mitochondrial number and morphology in non-specific control siRNA and SDHB-silenced REN cells. Arrowheads indicate some of the mitochondria, scale bars correspond to 2.5 μm in top left, 3.33 μm in top right, 0.5 μm in bottom left and 0.66 μm in bottom right. N, nucleus. ( c ) Mitochondrial mass per cell determined in c siRNA and SDHB-silenced REN cells using the cardiolipin-selective dye, NAO. ( d ) Changes in mtDNA content relative to the nuclear DNA calculated by real-time PCR of the D-loop and ACTB genes in c siRNA and SDHB-silenced REN cells. ( e ) Growth curves of REN cells transfected with empty vector (Mock), SDHB siRNA, ERβ expression vector (ERβ) or ERβ siRNA at 24 and 48 h. Each bar represents mean±s.d. * P

    Journal: Oncogenesis

    Article Title: Estrogen receptor ? activation impairs mitochondrial oxidative metabolism and affects malignant mesothelioma cell growth in vitro and in vivo

    doi: 10.1038/oncsis.2013.32

    Figure Lengend Snippet: SDH B silencing leads to alteration in the activity of MRC complexes, mitochondrial biogenesis but not cell proliferation. ( a ) Spectrophotometric evaluation of MRC complexes enzymatic activities in non-specific control siRNA (c siRNA) and SDHB- (siRNA SDHB) silenced REN cells. ( b ) Electron microscopy analysis performed to observe mitochondrial number and morphology in non-specific control siRNA and SDHB-silenced REN cells. Arrowheads indicate some of the mitochondria, scale bars correspond to 2.5 μm in top left, 3.33 μm in top right, 0.5 μm in bottom left and 0.66 μm in bottom right. N, nucleus. ( c ) Mitochondrial mass per cell determined in c siRNA and SDHB-silenced REN cells using the cardiolipin-selective dye, NAO. ( d ) Changes in mtDNA content relative to the nuclear DNA calculated by real-time PCR of the D-loop and ACTB genes in c siRNA and SDHB-silenced REN cells. ( e ) Growth curves of REN cells transfected with empty vector (Mock), SDHB siRNA, ERβ expression vector (ERβ) or ERβ siRNA at 24 and 48 h. Each bar represents mean±s.d. * P

    Article Snippet: For a quantitative analysis of mtDNA content, total genomic DNA was extracted from previously transfected cells using the NucleoSpin kit (Macherey-Nagel, Düren, Germany); primers for D-loop , mtDNA sequence and ACTB nuclear DNA sequences, obtained from Eurofins MWG Operon (Ebersberg, Germany), were used as described.

    Techniques: Activity Assay, Electron Microscopy, Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, Expressing

    a Subfamilies Vβ20-22 of normal donor and patient 1 are shown as representatives of Vβ TCR Spectratyping data. b Sequencing of the JAK3 in genomic DNA derived from sorted lymphocyte subsets of both index patients. The mutation site is highlighted with a gray background

    Journal: Journal of Clinical Immunology

    Article Title: Combined Immunodeficiency Evolving into Predominant CD4+ Lymphopenia Caused by Somatic Chimerism in JAK3

    doi: 10.1007/s10875-014-0088-2

    Figure Lengend Snippet: a Subfamilies Vβ20-22 of normal donor and patient 1 are shown as representatives of Vβ TCR Spectratyping data. b Sequencing of the JAK3 in genomic DNA derived from sorted lymphocyte subsets of both index patients. The mutation site is highlighted with a gray background

    Article Snippet: Capillary Sequencing Capillary sequencing of genomic DNA from both patients was performed with primers designed for the variant in the JAK3 gene with PrimerZ ( www.primerz.org ) and purchased from Eurofins/MWG Operon (Ebersberg, Germany).

    Techniques: Sequencing, Derivative Assay, Mutagenesis

    a Analysis of JAK3 protein expression in B-cell lines of a healthy control (1), father of the patients (2), patient 1 (3), patient 2 (4) and a γc-deficient SCID patient (5). Examination of GAPDH protein expression served as a loading control. b Analysis of JAK3 signaling function in B-cell lines of a healthy control, patient 1 (II-1), her father (I-1) and a γc-deficient SCID patient after stimulation with IL-4 and IL-21. Numbers in the top left and right corners of each histogram in panel B indicate the Mean Fluorescence Intensity (MFI) values of unstimulated and cytokine-stimulated cells, respectively. c Analysis of JAK3 signaling function in CD4+ peripheral blood T-cells of a healthy control, patient 1 (II-1) and patient 2 (II-2) after stimulation with IL-2. Histogram overlays represent intracellular levels of phosphorylated STAT5 in CD4+ T-cells without stimulation or after stimulation with IL-2 or IL-6. Numbers in the left top corner and middle part of each histogram indicate percentages of cells with a positive staining for pSTAT5 following stimulation with IL-2 or IL-6, respectively, while numbers in right corner constitute percentages of pSTAT5-positive unstimulated control cells

    Journal: Journal of Clinical Immunology

    Article Title: Combined Immunodeficiency Evolving into Predominant CD4+ Lymphopenia Caused by Somatic Chimerism in JAK3

    doi: 10.1007/s10875-014-0088-2

    Figure Lengend Snippet: a Analysis of JAK3 protein expression in B-cell lines of a healthy control (1), father of the patients (2), patient 1 (3), patient 2 (4) and a γc-deficient SCID patient (5). Examination of GAPDH protein expression served as a loading control. b Analysis of JAK3 signaling function in B-cell lines of a healthy control, patient 1 (II-1), her father (I-1) and a γc-deficient SCID patient after stimulation with IL-4 and IL-21. Numbers in the top left and right corners of each histogram in panel B indicate the Mean Fluorescence Intensity (MFI) values of unstimulated and cytokine-stimulated cells, respectively. c Analysis of JAK3 signaling function in CD4+ peripheral blood T-cells of a healthy control, patient 1 (II-1) and patient 2 (II-2) after stimulation with IL-2. Histogram overlays represent intracellular levels of phosphorylated STAT5 in CD4+ T-cells without stimulation or after stimulation with IL-2 or IL-6. Numbers in the left top corner and middle part of each histogram indicate percentages of cells with a positive staining for pSTAT5 following stimulation with IL-2 or IL-6, respectively, while numbers in right corner constitute percentages of pSTAT5-positive unstimulated control cells

    Article Snippet: Capillary Sequencing Capillary sequencing of genomic DNA from both patients was performed with primers designed for the variant in the JAK3 gene with PrimerZ ( www.primerz.org ) and purchased from Eurofins/MWG Operon (Ebersberg, Germany).

    Techniques: Expressing, Fluorescence, Staining

    a Homozygosity mapping results showing homozygous intervals highlighted in red color b Filtering strategy for exome sequencing data c Pedigree of the index family with sequence of the JAK3 mutation site highlighted in gray background d Multiple sequence alignment with the JAK3 mutation site highlighted in red background e Crystal structure of the JAK3 kinase domain. The described mutation site is marked with a black arrow

    Journal: Journal of Clinical Immunology

    Article Title: Combined Immunodeficiency Evolving into Predominant CD4+ Lymphopenia Caused by Somatic Chimerism in JAK3

    doi: 10.1007/s10875-014-0088-2

    Figure Lengend Snippet: a Homozygosity mapping results showing homozygous intervals highlighted in red color b Filtering strategy for exome sequencing data c Pedigree of the index family with sequence of the JAK3 mutation site highlighted in gray background d Multiple sequence alignment with the JAK3 mutation site highlighted in red background e Crystal structure of the JAK3 kinase domain. The described mutation site is marked with a black arrow

    Article Snippet: Capillary Sequencing Capillary sequencing of genomic DNA from both patients was performed with primers designed for the variant in the JAK3 gene with PrimerZ ( www.primerz.org ) and purchased from Eurofins/MWG Operon (Ebersberg, Germany).

    Techniques: Sequencing, Mutagenesis