Structured Review

Bioneer Corporation primer sequences
Primer Sequences, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/Bioneer Corporation
Average 92 stars, based on 10 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: MgCl2 and ZnCl2 promote human umbilical vein endothelial cell migration and invasion and stimulate epithelial-mesenchymal transition via the Wnt/β-catenin pathway
Article Snippet: .. The primer sequences for qPCR were as follows: E-cadherin, forward 5′-AGAACGCATTGCCACATACA-3′ and reverse 5′-TAAGCGATGGCGGCATTGTA-3′; N-cadherin, forward 5′-CAACACACTCGCAGACGCTCA-3′ and reverse 5′-AAGACGGCTCCAGGCAGTTT-3′; and β-actin, forward 5′-CTTAGTTGCGTTACACCCTTTCTTG-3′ and reverse 5′-CTGTCACCTTCACCGTTCCAGTTT-3′. qPCR was performed using an Exicycler™ 96 Real-Time Quantitative PCR system (Bioneer Corporation, Daejeon, Korea). .. The cycling conditions were as follows: 10 min at 95°C; followed by 40 cycles of 10 sec at 95°C, 20 sec at 60°C and 30 sec at 72°C (20 µl reaction volume comprising 1 µl cDNA template, 0.5 µl forward primer, 0.5 µl reverse primer, 10 µl SYBR Green PCR Mastermix and 8 µl ddH2 O).

Article Title: Interleukin-7 Induces Osteoclast Formation via STAT5, Independent of Receptor Activator of NF-kappaB Ligand
Article Snippet: .. PCR was performed using qPCR PreMix (Bioneer, Daejeon, Republic of Korea) (see Table S1 in Supplementary Material for primer sequences). qPCR was performed with an Exicycler 96 Quantitative Real-Time PCR System (Bioneer). .. Differences in expression were normalized to expression of the control gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) or ribosomal protein S18 (RPS18 ).

Polymerase Chain Reaction:

Article Title: Interleukin-7 Induces Osteoclast Formation via STAT5, Independent of Receptor Activator of NF-kappaB Ligand
Article Snippet: .. PCR was performed using qPCR PreMix (Bioneer, Daejeon, Republic of Korea) (see Table S1 in Supplementary Material for primer sequences). qPCR was performed with an Exicycler 96 Quantitative Real-Time PCR System (Bioneer). .. Differences in expression were normalized to expression of the control gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) or ribosomal protein S18 (RPS18 ).

Article Title: MicroRNA-650 in a copy number-variable region regulates the production of interleukin 6 in human osteosarcoma cells
Article Snippet: .. The primer sequences for PCR were as follows: miR-650 forward, 5′-AGAGGAGGCAGCGCTCT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; ING4 (order no. P279919; Bioneer); GAPDH (order no. P267613; Bioneer); and IL6 (order no. P211161; Bioneer). .. Amplification was performed using the Exicycler™ 96 Real-Time Quantitative PCR System (Bioneer) in a 20 µl reaction mixture containing 2 µl cDNA template (80 ng), 2.5 µl of each primer and 13 µl distilled water with AccuPower Greenstar qPCR Premix (Bioneer), including dNTP mixture. qPCR was performed under the following conditions: Initial denaturation at 95°C for 10 min; 40 cycles of 95°C for 10 sec, 60°C for 30 sec. Exicycler 3 analysis software (version 3.55.0; Bioneer) was used to calculate cycle threshold (Ct) values for all genes.

Article Title: Phylogenetic typing and detection of extended-spectrum β-lactamases in Escherichia coli isolates from broiler chickens in Ahvaz, Iran
Article Snippet: .. The primer sequences (Bioneer, Daejeon, South Korea) used in PCR, and expected size of products are presented in . .. Escherichia coli strain ECOR 62 was employed as positive control, and sterile distilled water as negative control.

Article Title: A Candidate Subspecies Discrimination System Involving a Vomeronasal Receptor Gene with Different Alleles Fixed in M. m. domesticus and M. m. musculus
Article Snippet: .. PCR and DNA sequencing primers were obtained from Bioneer; primer sequences and conditions are available from the authors upon request. ..

Synthesized:

Article Title: Ginsenoside Rp1 Exerts Anti-inflammatory Effects via Activation of Dendritic Cells and Regulatory T Cells
Article Snippet: .. The specific primer sequences were synthesized by Bioneer (Daejeon, Korea). β-actin (forward CGTGAAAAGATGACCCAGATCA) (reverse TGGTACGACCAGAGGCATACAG), IL-2 (forward TCTGCGGCATGTTCTGGATTT) (reverse ATGTGTTGTCAGAGCCCTTTAG), TGF-beta (forward CCGCAACAACGCCATCTATG) (reverse CCCGAATGTCTGACGTATTGAAG), CTLA4 (forward AGTGGGCTTCCTAGATTACCC) (reverse ATGGTGAGGTTCACTCTGCTT). .. Effects of ginsenoside Rp1 on lymphocytes To determine the effects of G-Rp1 on lymphocyte number and activation and the optimal concentration of this agent to use to influence cell activation, splenocytes from mouse spleens were cultured with 5, 10, or 20 μM G-Rp1 for 2 d ( A).

Article Title: The effects of the standardized extracts of Ginkgo biloba on steroidogenesis pathways and aromatase activity in H295R human adrenocortical carcinoma cells
Article Snippet: .. The primer sequences were synthesized by Bioneer (Daejeon, Korea) and are shown in . .. Expression levels of mRNA were quantified by use of the threshold cycle (Ct) method.

Article Title: Upregulation of MicroRNA-1246 Is Associated with BRAF Inhibitor Resistance in Melanoma Cells with Mutant BRAF
Article Snippet: .. The primer sequences were then selected using the Primer3Plus software , after which the primers were synthesized by Bioneer (Daejeon, Korea). .. The primers used in the present study had the following oligonucleotide sequences: miR-3617, 5′-CTCAAAGGGCTCATTGGTTG-3′ and 5′-GCCTGCTAAATGGAGTGTGC-3′; miR-92a-1, 5′-GCCCAATCAAACTGTCCTGT-3′ and 5′-CAATCCCCACCAAACTCAAC-3′; miR-1246, 5′-TGAAGTAGGACTGGGCAGAGA-3′ and 5′-TGTTTGCAATAGCCCTTTGAG-3′; miR-193b-3p, 5′-ATCCCGGTTCTCCAAACTCT-3′ and 5′-TGGTAGCTCTCTGCCCTCAC-3′; miR-17-3p, 5′-TTGTAAAACTGAAGATTGTGACCA-3′ and 5′-TGCCAGAAGGAGCACTTAGG-3′. qRT-PCR was conducted on an Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA) using SYBR Premix EX TaqII.

DNA Sequencing:

Article Title: A Candidate Subspecies Discrimination System Involving a Vomeronasal Receptor Gene with Different Alleles Fixed in M. m. domesticus and M. m. musculus
Article Snippet: .. PCR and DNA sequencing primers were obtained from Bioneer; primer sequences and conditions are available from the authors upon request. ..

Software:

Article Title: Upregulation of MicroRNA-1246 Is Associated with BRAF Inhibitor Resistance in Melanoma Cells with Mutant BRAF
Article Snippet: .. The primer sequences were then selected using the Primer3Plus software , after which the primers were synthesized by Bioneer (Daejeon, Korea). .. The primers used in the present study had the following oligonucleotide sequences: miR-3617, 5′-CTCAAAGGGCTCATTGGTTG-3′ and 5′-GCCTGCTAAATGGAGTGTGC-3′; miR-92a-1, 5′-GCCCAATCAAACTGTCCTGT-3′ and 5′-CAATCCCCACCAAACTCAAC-3′; miR-1246, 5′-TGAAGTAGGACTGGGCAGAGA-3′ and 5′-TGTTTGCAATAGCCCTTTGAG-3′; miR-193b-3p, 5′-ATCCCGGTTCTCCAAACTCT-3′ and 5′-TGGTAGCTCTCTGCCCTCAC-3′; miR-17-3p, 5′-TTGTAAAACTGAAGATTGTGACCA-3′ and 5′-TGCCAGAAGGAGCACTTAGG-3′. qRT-PCR was conducted on an Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA) using SYBR Premix EX TaqII.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Bioneer Corporation muguga reference sequence
    Median-Joining network of 9 and 15 haplotypes observed in T . <t>parva</t> population in South Sudan based on the polymorphic sites of (A) Tp1 and (B) Tp2 genes, respectively. The sizes of the circles are proportional to the haplotype frequencies. The origin of each haplotype is colour coded as follows: Bor = Yellow; Juba = Red; Yei = Blue; Kajo keji = Green; Median vector = Brown; T . parva <t>Muguga</t> = Black. The numbers in red in (A) represent the mutations that differentiate the haplotypes.
    Muguga Reference Sequence, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/muguga reference sequence/product/Bioneer Corporation
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    muguga reference sequence - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    85
    Bioneer Corporation glyceraldehyde phosphate dehydrogenase gapdh primers
    The effect of EBN on transcriptional activity and expression of peroxisome proliferator-activated receptor gamma. HEK293 cells were transiently transfected with luciferase construct containing peroxisome proliferator-activated receptor gamma <t>(PPAR-</t> γ ), retinoid X receptor (RXR α ), PPAR-response element (PPRE), and β -galactosidase. Then, the cells were treated with ethanol extract of Boehmeria nivea (EBN) (200, 400, 800, and 1200 μ g/mL) for 24 h. Luciferase assay was performed, and the activity was normalized with that of β -galactosidase activity (a). The differentiated C2C12 cells were exposed to EBN in a dose-dependent manner for 6 h. The mRNA level of PPAR- γ and <t>GAPDH</t> was measured by reverse transcriptase-polymerase chain reaction (RT-PCR) (b). Differentiated C2C12 cells were treated withEBN in a dose- and time-dependent manner. AMP-activated protein kinase (AMPK) and Akt expressions were determined by western blot analysis ((c), (d)). 1 mM AICAR was used as positive control for AMPK activation. Data are expressed as mean ± standard deviation (SD); n = 3. Statistical significance: * P
    Glyceraldehyde Phosphate Dehydrogenase Gapdh Primers, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde phosphate dehydrogenase gapdh primers/product/Bioneer Corporation
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde phosphate dehydrogenase gapdh primers - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    Bioneer Corporation qrt pcr primers
    Level of miR-4779 was low in colon cancer tissue, whereas expression of PAK2 and CCND3 were highly up-reregulated a Comparison of miR-4779 expression in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Small RNA was extracted from each tissue and <t>qRT-PCR</t> was performed. U6 snRNA was used as a normalizer. 10 pairs of frozen tumor and adjacent normal tissues from colon cancer patient were used in this experiment. The expression level of miR-4779 in tumor tissue of patient #1 was set at 1, and the relative amounts of miR-4779 at the other samples were plotted as fold induction. Error bars represent mean ± SEM. b Comparison of protein expression of PAK2 and CCND3 in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Equal amount of tissue lysates were subjected to western blotting using the corresponding antibodies. β-actin and GAPDH were used as a loading control. The levels of PAK2 and CCND3 were quantified by densitometry and normalized to β-actin levels. The ratios of PAK2 or CCND3 to total β-actin in normal tissue of patient #1 were set at 1
    Qrt Pcr Primers, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr primers/product/Bioneer Corporation
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr primers - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    85
    Bioneer Corporation sabin 1 primers
    Genetic instability of recombinant PVs is markedly remedied by increasing the G/C contents at the A/T-rich region of the insert. (A) The genetically unstable insert HIV-1 env-98 was sequence adjusted at the A/T-rich region marked by the solid box in the diagram. Thirteen A/T sites were replaced with G/C by mutagenesis without any change in the amino acid sequence. (B) The G/C contents of the inserts before and after sequence substitution were analyzed by the DNASIS program at a window size of 9 and expressed as a histogram. Sequence substitution increased the local G/C contents of the insert. (C) The genetic stability of the original (HIV-1 env-98) and the sequence-adjusted (HIV-1 env-98/M) recombinant PVs during consecutive passage cycles are represented by RT-PCR. Lanes: M, 100-bp size markers; S, poliovirus Sabin 1; R, RPS-Vax vector-derived virus; C, insert-containing recombinant plasmid. The numbers represent the passage cycle of each recombinant PV. The bar and arrow indicate the original and truncated forms of the insert, respectively.
    Sabin 1 Primers, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sabin 1 primers/product/Bioneer Corporation
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sabin 1 primers - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results


    Median-Joining network of 9 and 15 haplotypes observed in T . parva population in South Sudan based on the polymorphic sites of (A) Tp1 and (B) Tp2 genes, respectively. The sizes of the circles are proportional to the haplotype frequencies. The origin of each haplotype is colour coded as follows: Bor = Yellow; Juba = Red; Yei = Blue; Kajo keji = Green; Median vector = Brown; T . parva Muguga = Black. The numbers in red in (A) represent the mutations that differentiate the haplotypes.

    Journal: PLoS ONE

    Article Title: Genes encoding two Theileria parva antigens recognized by CD8+ T-cells exhibit sequence diversity in South Sudanese cattle populations but the majority of alleles are similar to the Muguga component of the live vaccine cocktail

    doi: 10.1371/journal.pone.0171426

    Figure Lengend Snippet: Median-Joining network of 9 and 15 haplotypes observed in T . parva population in South Sudan based on the polymorphic sites of (A) Tp1 and (B) Tp2 genes, respectively. The sizes of the circles are proportional to the haplotype frequencies. The origin of each haplotype is colour coded as follows: Bor = Yellow; Juba = Red; Yei = Blue; Kajo keji = Green; Median vector = Brown; T . parva Muguga = Black. The numbers in red in (A) represent the mutations that differentiate the haplotypes.

    Article Snippet: The internal primers were designed based on the Muguga reference sequence of T . parva (GenBank accession numbers XM_757880.1 (Tp1) and XM_760490.1 (Tp2)) and synthesized by Bioneer, South Korea.

    Techniques: Plasmid Preparation

    The effect of EBN on transcriptional activity and expression of peroxisome proliferator-activated receptor gamma. HEK293 cells were transiently transfected with luciferase construct containing peroxisome proliferator-activated receptor gamma (PPAR- γ ), retinoid X receptor (RXR α ), PPAR-response element (PPRE), and β -galactosidase. Then, the cells were treated with ethanol extract of Boehmeria nivea (EBN) (200, 400, 800, and 1200 μ g/mL) for 24 h. Luciferase assay was performed, and the activity was normalized with that of β -galactosidase activity (a). The differentiated C2C12 cells were exposed to EBN in a dose-dependent manner for 6 h. The mRNA level of PPAR- γ and GAPDH was measured by reverse transcriptase-polymerase chain reaction (RT-PCR) (b). Differentiated C2C12 cells were treated withEBN in a dose- and time-dependent manner. AMP-activated protein kinase (AMPK) and Akt expressions were determined by western blot analysis ((c), (d)). 1 mM AICAR was used as positive control for AMPK activation. Data are expressed as mean ± standard deviation (SD); n = 3. Statistical significance: * P

    Journal: Evidence-based Complementary and Alternative Medicine : eCAM

    Article Title: Boehmeria nivea Stimulates Glucose Uptake by Activating Peroxisome Proliferator-Activated Receptor Gamma in C2C12 Cells and Improves Glucose Intolerance in Mice Fed a High-Fat Diet

    doi: 10.1155/2013/867893

    Figure Lengend Snippet: The effect of EBN on transcriptional activity and expression of peroxisome proliferator-activated receptor gamma. HEK293 cells were transiently transfected with luciferase construct containing peroxisome proliferator-activated receptor gamma (PPAR- γ ), retinoid X receptor (RXR α ), PPAR-response element (PPRE), and β -galactosidase. Then, the cells were treated with ethanol extract of Boehmeria nivea (EBN) (200, 400, 800, and 1200 μ g/mL) for 24 h. Luciferase assay was performed, and the activity was normalized with that of β -galactosidase activity (a). The differentiated C2C12 cells were exposed to EBN in a dose-dependent manner for 6 h. The mRNA level of PPAR- γ and GAPDH was measured by reverse transcriptase-polymerase chain reaction (RT-PCR) (b). Differentiated C2C12 cells were treated withEBN in a dose- and time-dependent manner. AMP-activated protein kinase (AMPK) and Akt expressions were determined by western blot analysis ((c), (d)). 1 mM AICAR was used as positive control for AMPK activation. Data are expressed as mean ± standard deviation (SD); n = 3. Statistical significance: * P

    Article Snippet: PPAR-γ and glyceraldehyde phosphate dehydrogenase (GAPDH) primers were designed based on sequence data from the NCBI database and were purchased from Bioneer (Daejeon, Republic of Korea).

    Techniques: Activity Assay, Expressing, Transfection, Luciferase, Construct, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot, Positive Control, Activation Assay, Standard Deviation

    Level of miR-4779 was low in colon cancer tissue, whereas expression of PAK2 and CCND3 were highly up-reregulated a Comparison of miR-4779 expression in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Small RNA was extracted from each tissue and qRT-PCR was performed. U6 snRNA was used as a normalizer. 10 pairs of frozen tumor and adjacent normal tissues from colon cancer patient were used in this experiment. The expression level of miR-4779 in tumor tissue of patient #1 was set at 1, and the relative amounts of miR-4779 at the other samples were plotted as fold induction. Error bars represent mean ± SEM. b Comparison of protein expression of PAK2 and CCND3 in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Equal amount of tissue lysates were subjected to western blotting using the corresponding antibodies. β-actin and GAPDH were used as a loading control. The levels of PAK2 and CCND3 were quantified by densitometry and normalized to β-actin levels. The ratios of PAK2 or CCND3 to total β-actin in normal tissue of patient #1 were set at 1

    Journal: Cell Death & Disease

    Article Title: MicroRNA miR-4779 suppresses tumor growth by inducing apoptosis and cell cycle arrest through direct targeting of PAK2 and CCND3

    doi: 10.1038/s41419-017-0100-x

    Figure Lengend Snippet: Level of miR-4779 was low in colon cancer tissue, whereas expression of PAK2 and CCND3 were highly up-reregulated a Comparison of miR-4779 expression in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Small RNA was extracted from each tissue and qRT-PCR was performed. U6 snRNA was used as a normalizer. 10 pairs of frozen tumor and adjacent normal tissues from colon cancer patient were used in this experiment. The expression level of miR-4779 in tumor tissue of patient #1 was set at 1, and the relative amounts of miR-4779 at the other samples were plotted as fold induction. Error bars represent mean ± SEM. b Comparison of protein expression of PAK2 and CCND3 in tumor (T) and adjacent normal (N) tissues from colon cancer patients. Equal amount of tissue lysates were subjected to western blotting using the corresponding antibodies. β-actin and GAPDH were used as a loading control. The levels of PAK2 and CCND3 were quantified by densitometry and normalized to β-actin levels. The ratios of PAK2 or CCND3 to total β-actin in normal tissue of patient #1 were set at 1

    Article Snippet: Validated qRT-PCR primers of PAK2 (P287019), Cyclin D3 (P235255), and HPRT1 (P160523) were from Bioneer.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    miR-4779 down-regulates PAK2 and CCND3 by direct targeting a , b HCT116 cells were transfected with miR-NC or miR-4779 for 24 h. The mRNA levels of PAK2 and CCND3 were determined by qRT-PCR a . HPRT1 was used as a normalizer. Data show the relative each gene expression in miR-4779 transfected samples as compared with a miR-NC transfected samples. The expression of mature miR-4779 was determined by qRT-PCR b . U6 snRNA was used as a normalizer. c HCT116, A549, H460, MCF7, and HT-29 cells were transfected with miR-NC or miR-4779 for 48 h, and the protein levels of PAK2 and CCND3 were determined by western blotting using the corresponding antibodies. d-e Structure of reporter constructs containing 3’UTRs of PAK2 d and CCND3 e downstream of the luciferase ORF. The aligned sequences of constructs (red) complementary to the seed sequence of the miR-4779 (bold) and the mutant sequences are shown. The mutated regions are shaded. HCT116 cells were transfected with a combination of the indicated reporters and miRNAs, and luciferase assay was performed 48 h after transfection f . The fold change in relative luciferase activity in transfected cells with miR-NC was set as 1. Data are presented as averages of triplicate measurements with error bars representing standard deviations. ** P

    Journal: Cell Death & Disease

    Article Title: MicroRNA miR-4779 suppresses tumor growth by inducing apoptosis and cell cycle arrest through direct targeting of PAK2 and CCND3

    doi: 10.1038/s41419-017-0100-x

    Figure Lengend Snippet: miR-4779 down-regulates PAK2 and CCND3 by direct targeting a , b HCT116 cells were transfected with miR-NC or miR-4779 for 24 h. The mRNA levels of PAK2 and CCND3 were determined by qRT-PCR a . HPRT1 was used as a normalizer. Data show the relative each gene expression in miR-4779 transfected samples as compared with a miR-NC transfected samples. The expression of mature miR-4779 was determined by qRT-PCR b . U6 snRNA was used as a normalizer. c HCT116, A549, H460, MCF7, and HT-29 cells were transfected with miR-NC or miR-4779 for 48 h, and the protein levels of PAK2 and CCND3 were determined by western blotting using the corresponding antibodies. d-e Structure of reporter constructs containing 3’UTRs of PAK2 d and CCND3 e downstream of the luciferase ORF. The aligned sequences of constructs (red) complementary to the seed sequence of the miR-4779 (bold) and the mutant sequences are shown. The mutated regions are shaded. HCT116 cells were transfected with a combination of the indicated reporters and miRNAs, and luciferase assay was performed 48 h after transfection f . The fold change in relative luciferase activity in transfected cells with miR-NC was set as 1. Data are presented as averages of triplicate measurements with error bars representing standard deviations. ** P

    Article Snippet: Validated qRT-PCR primers of PAK2 (P287019), Cyclin D3 (P235255), and HPRT1 (P160523) were from Bioneer.

    Techniques: Transfection, Quantitative RT-PCR, Expressing, Western Blot, Construct, Luciferase, Sequencing, Mutagenesis, Activity Assay

    Knockdown of PAK2 or CCND3 inhibits tumor cell growth a–g HCT116 cells were transfected with si-RNAs for negative control (si-NC), PAK2 (si-PAK2), or CCND3 (si-CCND3). At 24 h after transfection, mRNA levels of PAK2 and CCND3 were determined by qRT-PCR a . At 72 h after transfection, cell viability was determined by MTS assay b . At 48 h after transfection, cell cycle was analyzed c and the percentage of cells in G1 and G2/M phase are annotated in each column. At 48 h after transfection, apoptosis was measured by flow cytometric analysis of cells stained with Annexin V-FITC and PI d . Right, the quantified apoptotic cell population was estimated At 48 h after transfection, equal amounts of cell lysates were subjected to western blotting using the indicated antibodies e . At 24 h after transfection, cells were re-plated and performed colony formation f and soft agar assays g . All data are presented as averages of triplicate measurements with error bars representing standard deviations. *** P

    Journal: Cell Death & Disease

    Article Title: MicroRNA miR-4779 suppresses tumor growth by inducing apoptosis and cell cycle arrest through direct targeting of PAK2 and CCND3

    doi: 10.1038/s41419-017-0100-x

    Figure Lengend Snippet: Knockdown of PAK2 or CCND3 inhibits tumor cell growth a–g HCT116 cells were transfected with si-RNAs for negative control (si-NC), PAK2 (si-PAK2), or CCND3 (si-CCND3). At 24 h after transfection, mRNA levels of PAK2 and CCND3 were determined by qRT-PCR a . At 72 h after transfection, cell viability was determined by MTS assay b . At 48 h after transfection, cell cycle was analyzed c and the percentage of cells in G1 and G2/M phase are annotated in each column. At 48 h after transfection, apoptosis was measured by flow cytometric analysis of cells stained with Annexin V-FITC and PI d . Right, the quantified apoptotic cell population was estimated At 48 h after transfection, equal amounts of cell lysates were subjected to western blotting using the indicated antibodies e . At 24 h after transfection, cells were re-plated and performed colony formation f and soft agar assays g . All data are presented as averages of triplicate measurements with error bars representing standard deviations. *** P

    Article Snippet: Validated qRT-PCR primers of PAK2 (P287019), Cyclin D3 (P235255), and HPRT1 (P160523) were from Bioneer.

    Techniques: Transfection, Negative Control, Quantitative RT-PCR, MTS Assay, Flow Cytometry, Staining, Western Blot

    miR-4779 expression and cell viability by miR-4779 inhibitor are higher in normal cell lines than cancer cell lines a – c HCT116 cells were transfected with mimics or inhibitors of miR-NC and miR-4779. At 24 h after transfection, mRNA expression levels of PAK2 and CCND3 were determined by qRT-PCR a . At 48 h after transfection, protein levels of PAK2 and CCND3 were determined by western blotting using the corresponding antibodies b . At 72 h after transfection, cell viability was determined by MTS assay c . d Comparison of miR-4779 expression in cancer and normal cells. Expression of mature miR-4779 was determined by qRT-PCR. e Normal cell lines CCD-18Co and BEAS-2B were transfected with mimics or inhibitors of miR-NC and miR-4779. At 72 h after transfection, cell viability was determined by MTS assay. f Normal cell lines CCD-18Co and BEAS-2B were transfected with miR-NC or miR-4779 for 24 h. The expression of mature miR-4779 was determined by qRT-PCR. All data are presented as averages of triplicate measurements with error bars representing standard deviations. ** P

    Journal: Cell Death & Disease

    Article Title: MicroRNA miR-4779 suppresses tumor growth by inducing apoptosis and cell cycle arrest through direct targeting of PAK2 and CCND3

    doi: 10.1038/s41419-017-0100-x

    Figure Lengend Snippet: miR-4779 expression and cell viability by miR-4779 inhibitor are higher in normal cell lines than cancer cell lines a – c HCT116 cells were transfected with mimics or inhibitors of miR-NC and miR-4779. At 24 h after transfection, mRNA expression levels of PAK2 and CCND3 were determined by qRT-PCR a . At 48 h after transfection, protein levels of PAK2 and CCND3 were determined by western blotting using the corresponding antibodies b . At 72 h after transfection, cell viability was determined by MTS assay c . d Comparison of miR-4779 expression in cancer and normal cells. Expression of mature miR-4779 was determined by qRT-PCR. e Normal cell lines CCD-18Co and BEAS-2B were transfected with mimics or inhibitors of miR-NC and miR-4779. At 72 h after transfection, cell viability was determined by MTS assay. f Normal cell lines CCD-18Co and BEAS-2B were transfected with miR-NC or miR-4779 for 24 h. The expression of mature miR-4779 was determined by qRT-PCR. All data are presented as averages of triplicate measurements with error bars representing standard deviations. ** P

    Article Snippet: Validated qRT-PCR primers of PAK2 (P287019), Cyclin D3 (P235255), and HPRT1 (P160523) were from Bioneer.

    Techniques: Expressing, Transfection, Quantitative RT-PCR, Western Blot, MTS Assay

    Genetic instability of recombinant PVs is markedly remedied by increasing the G/C contents at the A/T-rich region of the insert. (A) The genetically unstable insert HIV-1 env-98 was sequence adjusted at the A/T-rich region marked by the solid box in the diagram. Thirteen A/T sites were replaced with G/C by mutagenesis without any change in the amino acid sequence. (B) The G/C contents of the inserts before and after sequence substitution were analyzed by the DNASIS program at a window size of 9 and expressed as a histogram. Sequence substitution increased the local G/C contents of the insert. (C) The genetic stability of the original (HIV-1 env-98) and the sequence-adjusted (HIV-1 env-98/M) recombinant PVs during consecutive passage cycles are represented by RT-PCR. Lanes: M, 100-bp size markers; S, poliovirus Sabin 1; R, RPS-Vax vector-derived virus; C, insert-containing recombinant plasmid. The numbers represent the passage cycle of each recombinant PV. The bar and arrow indicate the original and truncated forms of the insert, respectively.

    Journal: Journal of Virology

    Article Title: Novel Design Architecture for Genetic Stability of Recombinant Poliovirus: the Manipulation of G/C Contents and Their Distribution Patterns Increases the Genetic Stability of Inserts in a Poliovirus-Based RPS-Vax Vector System

    doi: 10.1128/JVI.76.4.1649-1662.2002

    Figure Lengend Snippet: Genetic instability of recombinant PVs is markedly remedied by increasing the G/C contents at the A/T-rich region of the insert. (A) The genetically unstable insert HIV-1 env-98 was sequence adjusted at the A/T-rich region marked by the solid box in the diagram. Thirteen A/T sites were replaced with G/C by mutagenesis without any change in the amino acid sequence. (B) The G/C contents of the inserts before and after sequence substitution were analyzed by the DNASIS program at a window size of 9 and expressed as a histogram. Sequence substitution increased the local G/C contents of the insert. (C) The genetic stability of the original (HIV-1 env-98) and the sequence-adjusted (HIV-1 env-98/M) recombinant PVs during consecutive passage cycles are represented by RT-PCR. Lanes: M, 100-bp size markers; S, poliovirus Sabin 1; R, RPS-Vax vector-derived virus; C, insert-containing recombinant plasmid. The numbers represent the passage cycle of each recombinant PV. The bar and arrow indicate the original and truncated forms of the insert, respectively.

    Article Snippet: Reverse transcription (RT)-PCR was performed for each viral RNA sample with Sabin 1 primers (680-697/sense, 5′-CAT TGA GTG TGT TTA CTC-3′, and 797-814/antisense, 5′-GGT AGA ACC ACC ATA CGC-3′) using a Pre-Mix RT-PCR kit (Bioneer Inc.) by following the instructions given in the vendor's manual.

    Techniques: Recombinant, Sequencing, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Derivative Assay

    (A) Schematic diagram of Sabin 1-derived RPS-Vax viral genome and RPS-Vax-derived recombinant PVs. The RPS-Vax genome contains a multiple cloning site (MCS) and 3C protease cutting site at the N-terminal end of the long polyprotein. A foreign insert integrated into the MCS can easily be detected by RT-PCR with the primer set indicated by arrows. (B) Schematic illustration of the template- and ligation-free PCR procedures that was used for the synthesis of long heteromultimeric concatemers or heavily sequence-adjusted inserts without template DNA. CR, complementary region. The solid triangles represent the mutation sites on the synthetic DNA. The circled numbers 1 and 8 represent long synthetic primers of between 60 and 100 bases in length.

    Journal: Journal of Virology

    Article Title: Novel Design Architecture for Genetic Stability of Recombinant Poliovirus: the Manipulation of G/C Contents and Their Distribution Patterns Increases the Genetic Stability of Inserts in a Poliovirus-Based RPS-Vax Vector System

    doi: 10.1128/JVI.76.4.1649-1662.2002

    Figure Lengend Snippet: (A) Schematic diagram of Sabin 1-derived RPS-Vax viral genome and RPS-Vax-derived recombinant PVs. The RPS-Vax genome contains a multiple cloning site (MCS) and 3C protease cutting site at the N-terminal end of the long polyprotein. A foreign insert integrated into the MCS can easily be detected by RT-PCR with the primer set indicated by arrows. (B) Schematic illustration of the template- and ligation-free PCR procedures that was used for the synthesis of long heteromultimeric concatemers or heavily sequence-adjusted inserts without template DNA. CR, complementary region. The solid triangles represent the mutation sites on the synthetic DNA. The circled numbers 1 and 8 represent long synthetic primers of between 60 and 100 bases in length.

    Article Snippet: Reverse transcription (RT)-PCR was performed for each viral RNA sample with Sabin 1 primers (680-697/sense, 5′-CAT TGA GTG TGT TTA CTC-3′, and 797-814/antisense, 5′-GGT AGA ACC ACC ATA CGC-3′) using a Pre-Mix RT-PCR kit (Bioneer Inc.) by following the instructions given in the vendor's manual.

    Techniques: Derivative Assay, Recombinant, Clone Assay, Reverse Transcription Polymerase Chain Reaction, Ligation, Polymerase Chain Reaction, Sequencing, Mutagenesis

    Genetic stability of recombinant PVs expressing partial fragments of the HIV-1 (HXBc2)  env  gene. Partial fragments of the HIV-1  env  gene were cloned into the RPS-Vax vector, resulting in production of recombinant PVs. (A) Coverage, G/C contents, and free energy of each  env  gene fragment are schematically illustrated. The solid box in the diagram indicates the major deletion site during the passages of the recombinant PV. The numbering of the 294 bp corresponds to the sequence from 787 to 1080 of the HIV-1 envelope ( env ). (B )  RT-PCR patterns of partial  env  fragment-containing recombinant PVs during consecutive passages. Lanes: M, 100-bp size markers; S, poliovirus Sabin 1; R, RPS-Vax vector-derived virus; C, insert-containing recombinant plasmid. The numbers represent the passage cycle of each recombinant PV. The bar and arrow indicate the original and truncated forms of the insert, respectively.

    Journal: Journal of Virology

    Article Title: Novel Design Architecture for Genetic Stability of Recombinant Poliovirus: the Manipulation of G/C Contents and Their Distribution Patterns Increases the Genetic Stability of Inserts in a Poliovirus-Based RPS-Vax Vector System

    doi: 10.1128/JVI.76.4.1649-1662.2002

    Figure Lengend Snippet: Genetic stability of recombinant PVs expressing partial fragments of the HIV-1 (HXBc2) env gene. Partial fragments of the HIV-1 env gene were cloned into the RPS-Vax vector, resulting in production of recombinant PVs. (A) Coverage, G/C contents, and free energy of each env gene fragment are schematically illustrated. The solid box in the diagram indicates the major deletion site during the passages of the recombinant PV. The numbering of the 294 bp corresponds to the sequence from 787 to 1080 of the HIV-1 envelope ( env ). (B ) RT-PCR patterns of partial env fragment-containing recombinant PVs during consecutive passages. Lanes: M, 100-bp size markers; S, poliovirus Sabin 1; R, RPS-Vax vector-derived virus; C, insert-containing recombinant plasmid. The numbers represent the passage cycle of each recombinant PV. The bar and arrow indicate the original and truncated forms of the insert, respectively.

    Article Snippet: Reverse transcription (RT)-PCR was performed for each viral RNA sample with Sabin 1 primers (680-697/sense, 5′-CAT TGA GTG TGT TTA CTC-3′, and 797-814/antisense, 5′-GGT AGA ACC ACC ATA CGC-3′) using a Pre-Mix RT-PCR kit (Bioneer Inc.) by following the instructions given in the vendor's manual.

    Techniques: Recombinant, Expressing, Clone Assay, Plasmid Preparation, Sequencing, Reverse Transcription Polymerase Chain Reaction, Derivative Assay