Structured Review

3M Co primer sequences
Primer Sequences, supplied by 3M Co, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/3M Co
Average 90 stars, based on 2 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
90/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Clara cell 10-kDa protein inhibits TH17 responses through modulating dendritic cells in the setting of allergic rhinitis
Article Snippet: .. Primer sequences for real-time PCR (1.3M, pdf) ..

other:

Article Title: Phosphorylation of Mad Controls Competition Between Wingless and BMP Signaling
Article Snippet: Primer sequences. (2.3M, pdf)

Article Title: ThermoMouse: an in vivo model to identify modulators of UCP1 expression in brown adipose tissue
Article Snippet: Supplementary Table related to Experimental Procedures: Primer sequences (3.3M, pdf)

Article Title: Phosphorylation of Mad Controls Competition Between Wingless and BMP Signaling
Article Snippet: Primer sequences. (2.3M)

Article Title: Novel insights into the composition and function of the Toxoplasma IMC sutures
Article Snippet: All primer sequences are shown in the 5′ to 3′ orientation. (7.3M)

Article Title: Novel insights into the composition and function of the Toxoplasma IMC sutures
Article Snippet: All primer sequences are shown in the 5′ to 3′ orientation. (7.3M, tif)

Article Title: Displaying High-affinity Ligands on Adeno-associated Viral Vectors Enables Tumor Cell-specific and Safe Gene Transfer
Article Snippet: Primer sequences. (2.3M, pdf)

Article Title: Characterization of a protozoan Phosducin-like protein-3 (PhLP-3) reveals conserved redox activity
Article Snippet: Primer sequences. (TIF) (2.3M, tif)

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    3M Co primer 3p
    Transformed chloroplast genome and PCR analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. <t>Primer</t> 3P lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.
    Primer 3p, supplied by 3M Co, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer 3p/product/3M Co
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer 3p - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    92
    3M Co pcr primers
    Transformed chloroplast genome and <t>PCR</t> analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. Primer <t>3P</t> lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.
    Pcr Primers, supplied by 3M Co, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primers/product/3M Co
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    pcr primers - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    3M Co bac dna
    Hybridization of the test-array using <t>DNA</t> from pooled cells and amplified single cell DNA from a patient with trisomy 21. The six different <t>BAC</t> DNA preparations were spotted onto one array and hybridized with Cy3- and Cy5-labeled reference and test DNA probes. The log2 transformed ratios of test-to-reference DNA fluorescence intensities are plotted against the chromosomal locations of the BAC clones. Dashed gray and black/blue lines represent the base line and the upper/lower significance thresholds defined by the three-times standard deviation, respectively. ( A–F ) Non-amplified DNA from 10 6 cells ( G–L ) Amplified single cell DNA. Note that the trisomy 21 is only detected by the PFGE-amplified BAC-clones ( G–I ). Red dots represent the experiment in which probe and reference were labeled with Cy5 and Cy3, respectively, the green dots represent the color switch experiment and ‘+’ represents the mean log2 ratio of both experiments. The 3-fold standard deviation is calculated individually from the balanced clones in each experiment and as threshold the average standard deviation is shown (blue line). ( A–C ) and ( G–I ): PFGE purification of BAC clones; ( D–F ) and ( J–L ) Qiagen preparation of BAC clones. ( A, D, G, J ): adapter-linker PCR; ( B, E, H, K ): DOP-PCR; ( C, F, I, L ): Phi29 rolling circle amplification. ( M ) Statistical evaluation of results from different BAC-preparations. Averages from three independent experiments are shown. (Mse: Adaptor-linker-PCR; STDEV: standard deviation).
    Bac Dna, supplied by 3M Co, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bac dna/product/3M Co
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bac dna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    90
    3M Co primer sequences
    Hybridization of the test-array using <t>DNA</t> from pooled cells and amplified single cell DNA from a patient with trisomy 21. The six different <t>BAC</t> DNA preparations were spotted onto one array and hybridized with Cy3- and Cy5-labeled reference and test DNA probes. The log2 transformed ratios of test-to-reference DNA fluorescence intensities are plotted against the chromosomal locations of the BAC clones. Dashed gray and black/blue lines represent the base line and the upper/lower significance thresholds defined by the three-times standard deviation, respectively. ( A–F ) Non-amplified DNA from 10 6 cells ( G–L ) Amplified single cell DNA. Note that the trisomy 21 is only detected by the PFGE-amplified BAC-clones ( G–I ). Red dots represent the experiment in which probe and reference were labeled with Cy5 and Cy3, respectively, the green dots represent the color switch experiment and ‘+’ represents the mean log2 ratio of both experiments. The 3-fold standard deviation is calculated individually from the balanced clones in each experiment and as threshold the average standard deviation is shown (blue line). ( A–C ) and ( G–I ): PFGE purification of BAC clones; ( D–F ) and ( J–L ) Qiagen preparation of BAC clones. ( A, D, G, J ): adapter-linker PCR; ( B, E, H, K ): DOP-PCR; ( C, F, I, L ): Phi29 rolling circle amplification. ( M ) Statistical evaluation of results from different BAC-preparations. Averages from three independent experiments are shown. (Mse: Adaptor-linker-PCR; STDEV: standard deviation).
    Primer Sequences, supplied by 3M Co, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer sequences/product/3M Co
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    primer sequences - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    Image Search Results


    Transformed chloroplast genome and PCR analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. Primer 3P lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.

    Journal: Journal of molecular biology

    Article Title: Expression of the Native Cholera Toxin B Subunit Gene and Assembly as Functional Oligomers in Transgenic Tobacco Chloroplasts

    doi: 10.1006/jmbi.2001.4921

    Figure Lengend Snippet: Transformed chloroplast genome and PCR analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. Primer 3P lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.

    Article Snippet: The strategy employed was to land one primer (3P) on the native chloroplast genome adjacent to the point of integration and the second primer (3M) on the aadA gene ( ).

    Techniques: Transformation Assay, Polymerase Chain Reaction, Homologous Recombination, CtB Assay, Plasmid Preparation, Sequencing, Generated, Marker, Transgenic Assay

    Transformed chloroplast genome and PCR analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. Primer 3P lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.

    Journal: Journal of molecular biology

    Article Title: Expression of the Native Cholera Toxin B Subunit Gene and Assembly as Functional Oligomers in Transgenic Tobacco Chloroplasts

    doi: 10.1006/jmbi.2001.4921

    Figure Lengend Snippet: Transformed chloroplast genome and PCR analysis of control and chloroplast transformants. (a) Chloroplast genome after homologous recombination with the pLD-LH-CTB vector. Flanking sequences involved in recombination are indicated in white. Primer 3P lands on the native chloroplast genome and 3M lands on the aadA gene, generating a 1.65 kb fragment. Primer 5P lands on the aadA gene and 2M lands on the trnA flanking sequence, generating a 1.9 kb fragment. (b) PCR analysis: primers 3P 3M generated PCR products using total plant DNA as template. Lane 1, molecular mass marker; lane 2, untransformed plant; lanes 3–12, PCR products with DNA template from independent transgenic lines 1–10. (c) PCR analysis: primers 5P 2M generated PCR products using total plant DNA as template. Lane 1, untransformed plant; lane 2, molecular mass marker; lanes 3–5, PCR products with DNA template from independent transgenic lines 1–3 and 5–10, lanes 3–11.

    Article Snippet: PCR primers, AAAACCCGTCCTCAGTTCGGATTGC (3P), CCGCGTTGTTTCATCAAGCCTTACG (3M), CTGTAGAAGTCACCATTGTTGTGC (5P), and TGACTGCCCACCTGAGAGCGGACA (2M) were used to perform PCR on both putative transgenic and untransformed plant total DNA.

    Techniques: Transformation Assay, Polymerase Chain Reaction, Homologous Recombination, CtB Assay, Plasmid Preparation, Sequencing, Generated, Marker, Transgenic Assay

    Hybridization of the test-array using DNA from pooled cells and amplified single cell DNA from a patient with trisomy 21. The six different BAC DNA preparations were spotted onto one array and hybridized with Cy3- and Cy5-labeled reference and test DNA probes. The log2 transformed ratios of test-to-reference DNA fluorescence intensities are plotted against the chromosomal locations of the BAC clones. Dashed gray and black/blue lines represent the base line and the upper/lower significance thresholds defined by the three-times standard deviation, respectively. ( A–F ) Non-amplified DNA from 10 6 cells ( G–L ) Amplified single cell DNA. Note that the trisomy 21 is only detected by the PFGE-amplified BAC-clones ( G–I ). Red dots represent the experiment in which probe and reference were labeled with Cy5 and Cy3, respectively, the green dots represent the color switch experiment and ‘+’ represents the mean log2 ratio of both experiments. The 3-fold standard deviation is calculated individually from the balanced clones in each experiment and as threshold the average standard deviation is shown (blue line). ( A–C ) and ( G–I ): PFGE purification of BAC clones; ( D–F ) and ( J–L ) Qiagen preparation of BAC clones. ( A, D, G, J ): adapter-linker PCR; ( B, E, H, K ): DOP-PCR; ( C, F, I, L ): Phi29 rolling circle amplification. ( M ) Statistical evaluation of results from different BAC-preparations. Averages from three independent experiments are shown. (Mse: Adaptor-linker-PCR; STDEV: standard deviation).

    Journal: Nucleic Acids Research

    Article Title: High-resolution array comparative genomic hybridization of single micrometastatic tumor cells

    doi: 10.1093/nar/gkn101

    Figure Lengend Snippet: Hybridization of the test-array using DNA from pooled cells and amplified single cell DNA from a patient with trisomy 21. The six different BAC DNA preparations were spotted onto one array and hybridized with Cy3- and Cy5-labeled reference and test DNA probes. The log2 transformed ratios of test-to-reference DNA fluorescence intensities are plotted against the chromosomal locations of the BAC clones. Dashed gray and black/blue lines represent the base line and the upper/lower significance thresholds defined by the three-times standard deviation, respectively. ( A–F ) Non-amplified DNA from 10 6 cells ( G–L ) Amplified single cell DNA. Note that the trisomy 21 is only detected by the PFGE-amplified BAC-clones ( G–I ). Red dots represent the experiment in which probe and reference were labeled with Cy5 and Cy3, respectively, the green dots represent the color switch experiment and ‘+’ represents the mean log2 ratio of both experiments. The 3-fold standard deviation is calculated individually from the balanced clones in each experiment and as threshold the average standard deviation is shown (blue line). ( A–C ) and ( G–I ): PFGE purification of BAC clones; ( D–F ) and ( J–L ) Qiagen preparation of BAC clones. ( A, D, G, J ): adapter-linker PCR; ( B, E, H, K ): DOP-PCR; ( C, F, I, L ): Phi29 rolling circle amplification. ( M ) Statistical evaluation of results from different BAC-preparations. Averages from three independent experiments are shown. (Mse: Adaptor-linker-PCR; STDEV: standard deviation).

    Article Snippet: The BAC DNA was gel-extracted by an overnight agarase digest (1 U agarase per 100 µl gel-volume in 30 mM Bis-Tris pH 4.5; 10 mM EDTA) and precipitated with isopropanol and Na-acetate (3M) at 4°C.

    Techniques: Hybridization, Amplification, BAC Assay, Labeling, Transformation Assay, Fluorescence, Clone Assay, Standard Deviation, Purification, Polymerase Chain Reaction, Degenerate Oligonucleotide–primed Polymerase Chain Reaction

    Performance of 3 K BAC array. ( A ) and ( B ) Hybridization of amplified single cell-DNA from a female healthy donor and a patient with trisomy 21, respectively, to 3 K BAC array versus male reference DNA. The log2-transformed fluorescence intensity ratios are plotted against the chromosomal locations of the BAC clones. Gray color of dots indicates normal clones, green indicates loss and red indicates gain of chromosomal material. Blue indicates high-copy amplification. Outliers are marked by a box around the data point; (data normalization and visualization were performed with CAPweb software). ( C ) GC-content (%) of BAC clones from chromosomes 3 (light gray) and 19 (dark gray) ( n = 30 clones were analyzed for both chromosomes). ( D ) and ( E ) Details of chromosomes 3 and 19 from panels A and B after selection of chromosome 19 BAC clones with GC-content

    Journal: Nucleic Acids Research

    Article Title: High-resolution array comparative genomic hybridization of single micrometastatic tumor cells

    doi: 10.1093/nar/gkn101

    Figure Lengend Snippet: Performance of 3 K BAC array. ( A ) and ( B ) Hybridization of amplified single cell-DNA from a female healthy donor and a patient with trisomy 21, respectively, to 3 K BAC array versus male reference DNA. The log2-transformed fluorescence intensity ratios are plotted against the chromosomal locations of the BAC clones. Gray color of dots indicates normal clones, green indicates loss and red indicates gain of chromosomal material. Blue indicates high-copy amplification. Outliers are marked by a box around the data point; (data normalization and visualization were performed with CAPweb software). ( C ) GC-content (%) of BAC clones from chromosomes 3 (light gray) and 19 (dark gray) ( n = 30 clones were analyzed for both chromosomes). ( D ) and ( E ) Details of chromosomes 3 and 19 from panels A and B after selection of chromosome 19 BAC clones with GC-content

    Article Snippet: The BAC DNA was gel-extracted by an overnight agarase digest (1 U agarase per 100 µl gel-volume in 30 mM Bis-Tris pH 4.5; 10 mM EDTA) and precipitated with isopropanol and Na-acetate (3M) at 4°C.

    Techniques: BAC Assay, Hybridization, Amplification, Transformation Assay, Fluorescence, Clone Assay, Software, Selection

    Comparison of the 3 K BAC array and the 19 K and 244 K oligonucleotide arrays. ( A ) Hybridization profiles of chromosome 10 from hybridization with T47D cell line DNA. From left to right: Hybridization profile of 10 6 T47D cells to a 32 K BAC array taken from Shadeo et al ., hybridization of T47D DNA amplified from two individual single cells on the 3 K BAC array, the 19 K and 244 K oligonucleotide arrays. In all profiles, the blue line represents the hybridization profile of 10 6 T47D cells on the 244 K oligonucleotide array as a reference. The red line represents the single cell profiles on the various platforms. Log2 ratios are plotted against chromosomal location of data points. The vertical lines in the profiles indicate the threshold of significant deviations from normal (±0.2). ( B–D ) Percentage of correctly detected amplifications, deletions and normal regions in T47D single cell profiles on the three different platforms. Regions between 1 and 20 Mb detected in single cell 1 ( B ) and single cell 2 ( C ). Regions between > 20 and 200 Mb are provided as an average of single cell 1 and 2 ( D ).

    Journal: Nucleic Acids Research

    Article Title: High-resolution array comparative genomic hybridization of single micrometastatic tumor cells

    doi: 10.1093/nar/gkn101

    Figure Lengend Snippet: Comparison of the 3 K BAC array and the 19 K and 244 K oligonucleotide arrays. ( A ) Hybridization profiles of chromosome 10 from hybridization with T47D cell line DNA. From left to right: Hybridization profile of 10 6 T47D cells to a 32 K BAC array taken from Shadeo et al ., hybridization of T47D DNA amplified from two individual single cells on the 3 K BAC array, the 19 K and 244 K oligonucleotide arrays. In all profiles, the blue line represents the hybridization profile of 10 6 T47D cells on the 244 K oligonucleotide array as a reference. The red line represents the single cell profiles on the various platforms. Log2 ratios are plotted against chromosomal location of data points. The vertical lines in the profiles indicate the threshold of significant deviations from normal (±0.2). ( B–D ) Percentage of correctly detected amplifications, deletions and normal regions in T47D single cell profiles on the three different platforms. Regions between 1 and 20 Mb detected in single cell 1 ( B ) and single cell 2 ( C ). Regions between > 20 and 200 Mb are provided as an average of single cell 1 and 2 ( D ).

    Article Snippet: The BAC DNA was gel-extracted by an overnight agarase digest (1 U agarase per 100 µl gel-volume in 30 mM Bis-Tris pH 4.5; 10 mM EDTA) and precipitated with isopropanol and Na-acetate (3M) at 4°C.

    Techniques: BAC Assay, Hybridization, Amplification

    Contamination of amplified DNA samples and PFGE purification of BAC DNA from E. coli DNA. ( A ) Amplified DNA from empty-control for the amplification PCR, 1 cell, 100 cells and 40 000 cells (from left to right) were spotted onto a membrane and hybridized with Dig-labeled bacterial contamination. The more human cellular DNA was added, the weaker the hybridization signal of the labeled contamination. The PCR-mock-control contains the highest amount of contamination. ( B ) Schematic illustration of the pulsed-field-gel-electrophoresis (PFGE) of PI-SceI digested RP11-BAC clones. A PI-SceI site is located in the pBACe3.6 vector sequence, while no restriction site is present in the genomic DNA of E. coli . The linearized BAC DNA is recovered after gel-electrophoresis by gel extraction (BAC clones 86c20, 106m3). ( C ) and ( D ) E. coli contamination of BAC clone preparations determined by qPCR before and after adapter-linker-amplification, respectively. The same 15 BAC clones were prepared by PFGE- and conventional purification. The contamination with E. coli DNA is expressed as percentage of TRPE sequence in comparison to pBACe3.6 sequence.

    Journal: Nucleic Acids Research

    Article Title: High-resolution array comparative genomic hybridization of single micrometastatic tumor cells

    doi: 10.1093/nar/gkn101

    Figure Lengend Snippet: Contamination of amplified DNA samples and PFGE purification of BAC DNA from E. coli DNA. ( A ) Amplified DNA from empty-control for the amplification PCR, 1 cell, 100 cells and 40 000 cells (from left to right) were spotted onto a membrane and hybridized with Dig-labeled bacterial contamination. The more human cellular DNA was added, the weaker the hybridization signal of the labeled contamination. The PCR-mock-control contains the highest amount of contamination. ( B ) Schematic illustration of the pulsed-field-gel-electrophoresis (PFGE) of PI-SceI digested RP11-BAC clones. A PI-SceI site is located in the pBACe3.6 vector sequence, while no restriction site is present in the genomic DNA of E. coli . The linearized BAC DNA is recovered after gel-electrophoresis by gel extraction (BAC clones 86c20, 106m3). ( C ) and ( D ) E. coli contamination of BAC clone preparations determined by qPCR before and after adapter-linker-amplification, respectively. The same 15 BAC clones were prepared by PFGE- and conventional purification. The contamination with E. coli DNA is expressed as percentage of TRPE sequence in comparison to pBACe3.6 sequence.

    Article Snippet: The BAC DNA was gel-extracted by an overnight agarase digest (1 U agarase per 100 µl gel-volume in 30 mM Bis-Tris pH 4.5; 10 mM EDTA) and precipitated with isopropanol and Na-acetate (3M) at 4°C.

    Techniques: Amplification, Purification, BAC Assay, Polymerase Chain Reaction, Labeling, Hybridization, Pulsed-Field Gel, Electrophoresis, Clone Assay, Plasmid Preparation, Sequencing, Nucleic Acid Electrophoresis, Gel Extraction, Real-time Polymerase Chain Reaction