primer nebnext multiplex oligos  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs
    Description:
    NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs 384 rxns
    Catalog Number:
    e6440l
    Price:
    1925
    Size:
    384 rxns
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs primer nebnext multiplex oligos
    NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs
    NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs 384 rxns
    https://www.bioz.com/result/primer nebnext multiplex oligos/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer nebnext multiplex oligos - by Bioz Stars, 2020-05
    95/100 stars

    Related Products / Commonly Used Together

    aatgatacggcgaccaccgagatctacacgttcagagttctacagtccga

    Images

    Related Articles

    Multiplex Assay:

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering
    Article Snippet: .. A second cleanup step was then performed on a QIAquick PCR purification column to attain maximum sample purity. gDNA and cDNA deep sequencing libraries containing indexed adapters were then constructed using the NEBNext® Ultra DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (NEB). .. Library QC and quantification was performed using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific), D1000 High Sensitivity Screen Tape (Agilent), and Illumina Library Quantification Kit (KAPA Biosystems).

    Article Title: Protein and small non-coding RNA-enriched extracellular vesicles are released by the pathogenic blood fluke Schistosoma mansoni
    Article Snippet: .. Small RNA concentrations ranged from 60 pg/ml (EV-enriched fraction) to 750 pg/ml (EV-depleted fraction) as determined by the Bioanalyzer. sncRNA libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set and NEBNext index primer for Illumina (New England Biolabs, Ipswich, MA, USA), according to the manufacturer's protocol. .. Size selection of the polymerase chain reaction (PCR) products was performed using 6% non-denaturing polyacrylamide gel electrophoresis, and bands between 130 and 200 bp were recovered following gel extraction.

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples
    Article Snippet: .. For the pilot experiment, the library was dual indexed using NEBNext® Multiplex Oligos for Illumina® (NEB). ..

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 3 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 3 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) 24 µL water Resuspend the beads in 50 µL amplification mix (reserve the extra 10 µL as you will need it in step 25 ) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72°C for 40 s 98°C for 3 min then 8 cycles of Stop the PCR, pull down beads in a magnetic rack .. NOTE: The NEBNext adaptor is a 65 nt hairpin… adaptor dimers would be 65 bp, because each hairpin is ~32 bp long… however, the indexing primers are also 65 nts, so amplification of adaptor dimer results in a 130 bp fragment that must be removed at this step, and adds 130 bp to the ideal target length of 150 bp, so our molecules of interest are now 280–300 bp Allow AMPure bead slurry to warm to room temperature Add an equal volume of AMPure beads to the PCR supernatant, mix by pipetting and incubate for 5 min at room temperature Pull down beads with magnet, give 1–2 min to clear solution.

    Article Title: The Arrival of Siberian Ancestry Connecting the Eastern Baltic to Uralic Speakers Further East
    Article Snippet: .. The libraries were amplified and both the indexed and universal primer (NEBNext® Multiplex Oligos for Illumina, New England Biolabs) were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). ..

    Article Title: The Y-located proto-oncogene TSPY exacerbates and its X-homologue TSPX inhibits transactivation functions of androgen receptor and its constitutively active variants
    Article Snippet: .. The NEBNext Multiplex Oligos primer sets (New England Bio Laboratory) were used to bar code the respective libraries, and sequenced with the High-Output Kit (75 cycles, FC404-1005, Illumina) using a NextSeq 500 Sequencer (Illumina, Inc.). ..

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. Step 25: Off bead amplification (library PCR 2) For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 25 µL eluted library from Step 24 2.5 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 2.5 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72C for 40 s 98C for 3 min then N cycles of NOTE: the number of additional cycles, N, is ascertained by estimating the number of additional cycles required to reach 1/3 saturation from the qPCR analysis in Step 24. .. Step 26: High and low size selection using AMPure XP beads (final polishing) Allow AMPure bead slurry to warm to room temperature Add 0.5 volumes of AMPure bead slurry (30 µL) to PCR mix (60 µL).

    Article Title: YAP‐TEAD signaling promotes basal cell carcinoma development via a c‐JUN/AP1 axis
    Article Snippet: .. The ChIPseq libraries were prepared with the NEBNext® Ultra DNA Library Prep Kit and NEBNext® Multiplex Oligos for Illumina (NEB) according to the manufacturer's recommendations. .. All of the libraries were sequenced on the NextSeq High 75 cycles (Illumina) sequencer at Harvard University Bauer Core Facility.

    Amplification:

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 3 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 3 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) 24 µL water Resuspend the beads in 50 µL amplification mix (reserve the extra 10 µL as you will need it in step 25 ) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72°C for 40 s 98°C for 3 min then 8 cycles of Stop the PCR, pull down beads in a magnetic rack .. NOTE: The NEBNext adaptor is a 65 nt hairpin… adaptor dimers would be 65 bp, because each hairpin is ~32 bp long… however, the indexing primers are also 65 nts, so amplification of adaptor dimer results in a 130 bp fragment that must be removed at this step, and adds 130 bp to the ideal target length of 150 bp, so our molecules of interest are now 280–300 bp Allow AMPure bead slurry to warm to room temperature Add an equal volume of AMPure beads to the PCR supernatant, mix by pipetting and incubate for 5 min at room temperature Pull down beads with magnet, give 1–2 min to clear solution.

    Article Title: The Arrival of Siberian Ancestry Connecting the Eastern Baltic to Uralic Speakers Further East
    Article Snippet: .. The libraries were amplified and both the indexed and universal primer (NEBNext® Multiplex Oligos for Illumina, New England Biolabs) were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). ..

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. Step 25: Off bead amplification (library PCR 2) For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 25 µL eluted library from Step 24 2.5 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 2.5 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72C for 40 s 98C for 3 min then N cycles of NOTE: the number of additional cycles, N, is ascertained by estimating the number of additional cycles required to reach 1/3 saturation from the qPCR analysis in Step 24. .. Step 26: High and low size selection using AMPure XP beads (final polishing) Allow AMPure bead slurry to warm to room temperature Add 0.5 volumes of AMPure bead slurry (30 µL) to PCR mix (60 µL).

    Construct:

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering
    Article Snippet: .. A second cleanup step was then performed on a QIAquick PCR purification column to attain maximum sample purity. gDNA and cDNA deep sequencing libraries containing indexed adapters were then constructed using the NEBNext® Ultra DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (NEB). .. Library QC and quantification was performed using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific), D1000 High Sensitivity Screen Tape (Agilent), and Illumina Library Quantification Kit (KAPA Biosystems).

    Purification:

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering
    Article Snippet: .. A second cleanup step was then performed on a QIAquick PCR purification column to attain maximum sample purity. gDNA and cDNA deep sequencing libraries containing indexed adapters were then constructed using the NEBNext® Ultra DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (NEB). .. Library QC and quantification was performed using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific), D1000 High Sensitivity Screen Tape (Agilent), and Illumina Library Quantification Kit (KAPA Biosystems).

    Real-time Polymerase Chain Reaction:

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. Step 25: Off bead amplification (library PCR 2) For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 25 µL eluted library from Step 24 2.5 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 2.5 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72C for 40 s 98C for 3 min then N cycles of NOTE: the number of additional cycles, N, is ascertained by estimating the number of additional cycles required to reach 1/3 saturation from the qPCR analysis in Step 24. .. Step 26: High and low size selection using AMPure XP beads (final polishing) Allow AMPure bead slurry to warm to room temperature Add 0.5 volumes of AMPure bead slurry (30 µL) to PCR mix (60 µL).

    Polymerase Chain Reaction:

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering
    Article Snippet: .. A second cleanup step was then performed on a QIAquick PCR purification column to attain maximum sample purity. gDNA and cDNA deep sequencing libraries containing indexed adapters were then constructed using the NEBNext® Ultra DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (NEB). .. Library QC and quantification was performed using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific), D1000 High Sensitivity Screen Tape (Agilent), and Illumina Library Quantification Kit (KAPA Biosystems).

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 3 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 3 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) 24 µL water Resuspend the beads in 50 µL amplification mix (reserve the extra 10 µL as you will need it in step 25 ) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72°C for 40 s 98°C for 3 min then 8 cycles of Stop the PCR, pull down beads in a magnetic rack .. NOTE: The NEBNext adaptor is a 65 nt hairpin… adaptor dimers would be 65 bp, because each hairpin is ~32 bp long… however, the indexing primers are also 65 nts, so amplification of adaptor dimer results in a 130 bp fragment that must be removed at this step, and adds 130 bp to the ideal target length of 150 bp, so our molecules of interest are now 280–300 bp Allow AMPure bead slurry to warm to room temperature Add an equal volume of AMPure beads to the PCR supernatant, mix by pipetting and incubate for 5 min at room temperature Pull down beads with magnet, give 1–2 min to clear solution.

    Article Title: The Arrival of Siberian Ancestry Connecting the Eastern Baltic to Uralic Speakers Further East
    Article Snippet: .. The libraries were amplified and both the indexed and universal primer (NEBNext® Multiplex Oligos for Illumina, New England Biolabs) were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). ..

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
    Article Snippet: .. Step 25: Off bead amplification (library PCR 2) For each index, pre-mix the following 30 µL 2x NEB Next High Fidelity master mix 25 µL eluted library from Step 24 2.5 µL 10 uM Universal Primer (NEBNext Multiplex Oligos for Illumina) 2.5 µL 10 uM Indexing Primer (NEBNext Multiplex Oligos for Illumina) Run the following PCR cycle 98°C for 30 s 63°C for 30 s 72C for 40 s 98C for 3 min then N cycles of NOTE: the number of additional cycles, N, is ascertained by estimating the number of additional cycles required to reach 1/3 saturation from the qPCR analysis in Step 24. .. Step 26: High and low size selection using AMPure XP beads (final polishing) Allow AMPure bead slurry to warm to room temperature Add 0.5 volumes of AMPure bead slurry (30 µL) to PCR mix (60 µL).

    Sequencing:

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering
    Article Snippet: .. A second cleanup step was then performed on a QIAquick PCR purification column to attain maximum sample purity. gDNA and cDNA deep sequencing libraries containing indexed adapters were then constructed using the NEBNext® Ultra DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (NEB). .. Library QC and quantification was performed using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific), D1000 High Sensitivity Screen Tape (Agilent), and Illumina Library Quantification Kit (KAPA Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs universal pcr primers
    Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative <t>PCR</t> for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture <t>oligos</t> and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
    Universal Pcr Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/universal pcr primers/product/New England Biolabs
    Average 97 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    universal pcr primers - by Bioz Stars, 2020-05
    97/100 stars
      Buy from Supplier

    98
    New England Biolabs nebnext multiplex oligos for illumina
    The newly developed mTSS-Capture method combined with paired-end sequencing maps genome-wide nucleosome distribution in primary patient samples and identifies bona fide nucleosome characteristics, concordant with other human nucleosome mapping studies A . Work-flow of the mTSS-seq method. Following MNase digestion using a titration of MNase, populations of mononucleosomally protected DNA and subnucleosomal fragments are isolated, and prepared as libraries for <t>Illumina</t> sequencing. Solution-based sequence capture is performed using biotinylated <t>oligos,</t> enabling the enrichment of fragments within 2kb of each transcription start site in the human genome. Paired-end 50bp sequencing was then performed on each index. B . Alignment of the mTSS-seq midpoints to the human genome using the UCSC genome browser for LAC patient #4137 Normal tissue is shown for chr11, hg19 ( http://genome.ucsc.edu ). Zooming in twice at 100X allows for further visualization of the sequence capture oligos surrounding the TSS in a 500kb and a 5kb region showing the ATM locus. C . Averaged, normalized reads per million (y-axis) from mTSS-seq plotted as fragments (gray) and midpoints (black), centered on and surrounding 2kb of the TSS for ~22,000 open reading frames in hg19 (x-axis). DNase I-hypersensitivity (GSM736580; green) and RNA polymerase II from ChIP-seq (GSM935299; blue) data from A549 cells are shown. (D) LAC patient 4137 Normal nucleosomal midpoints (blue track) were plotted in the UCSC genome browser against the published human lymphocyte nucleosome distribution maps by Gaffney et. al. (green track) for the ZNF451 and CCDC97 loci. Sequence capture oligos and corresponding RefSeq gene models are shown for each locus. Correlations are shown for ZNF451 and CCDC87, respectively.
    Nebnext Multiplex Oligos For Illumina, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiplex oligos for illumina/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nebnext multiplex oligos for illumina - by Bioz Stars, 2020-05
    98/100 stars
      Buy from Supplier

    95
    New England Biolabs nebnext index primer for illumina
    Schistosomula excrete/secrete extracellular miRNAs. Supernatant from 72 h in vitro cultured schistosomula was separated into EV-enriched and EV-depleted fractions (n=3) by preparatory ultracentrifugation. Total RNA from each fraction was extracted using the miRNeasy kit (Qiagen) and prepared for RNA-seq using the <t>NEBNext</t> Small RNA (for <t>Illumina</t> HiSeq sequencing) kit. To identify sma-miRNAs in our samples, the miRDeep2 package was utilized (29). Only miRNAs with at least 10 reads in 2 out of the 3 biological replicates (in at least one of the fractions, EV-enriched OR EV-depleted) were considered in the study. A total of 205 putative sma-miRNAs passed this criterion. sma-miRNA read count data were normalized using the DESeq2 package (33) as described in the Materials and methods . (a) Heatmap depiction of sma-miRNA abundance (represented by Z-scores) found within EV-enriched and EV-depleted supernatant fractions after agglomerative hierarchical clustering and standardization. Each row represents a miRNA and its relative Z-score value in EV-enriched and EV-depleted fractions is displayed in the 2 columns. All sma-miRNA specifics (name, sequence, raw/normalized read counts and cluster location) are included in Supplementary file 3 . (b) sma-miRNA localization found throughout the S. mansoni karyotype (v5.2). Vertical grey bars represent the position of known sma-miRNAs available in miRBase (v.21). Vertical black bars represent the localization of all extracellular sma-miRNAs (within EV-depleted and EV-enriched fractions) newly identified in our study. Black stars above the vertical lines represent 13 sma-miRNAs found in our study that are also present in miRBase. Eighteen miRNAs localized on unmapped scaffolds (16 not mapped at all; 1 unplaced on Ch 7, 4 and 3; 5 unplaced on Ch 1) as well as 15 miRNAs not yet mapped to the current S. mansoni genome assembly were not included in this analysis. All available sma-miRNA localization coordinates are available in Supplementary file 3 .
    Nebnext Index Primer For Illumina, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext index primer for illumina/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nebnext index primer for illumina - by Bioz Stars, 2020-05
    95/100 stars
      Buy from Supplier

    Image Search Results


    Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

    Journal: Oncotarget

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response

    doi: 10.18632/oncotarget.6841

    Figure Lengend Snippet: Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

    Article Snippet: The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

    Techniques: Real-time Polymerase Chain Reaction, Sequencing

    The newly developed mTSS-Capture method combined with paired-end sequencing maps genome-wide nucleosome distribution in primary patient samples and identifies bona fide nucleosome characteristics, concordant with other human nucleosome mapping studies A . Work-flow of the mTSS-seq method. Following MNase digestion using a titration of MNase, populations of mononucleosomally protected DNA and subnucleosomal fragments are isolated, and prepared as libraries for Illumina sequencing. Solution-based sequence capture is performed using biotinylated oligos, enabling the enrichment of fragments within 2kb of each transcription start site in the human genome. Paired-end 50bp sequencing was then performed on each index. B . Alignment of the mTSS-seq midpoints to the human genome using the UCSC genome browser for LAC patient #4137 Normal tissue is shown for chr11, hg19 ( http://genome.ucsc.edu ). Zooming in twice at 100X allows for further visualization of the sequence capture oligos surrounding the TSS in a 500kb and a 5kb region showing the ATM locus. C . Averaged, normalized reads per million (y-axis) from mTSS-seq plotted as fragments (gray) and midpoints (black), centered on and surrounding 2kb of the TSS for ~22,000 open reading frames in hg19 (x-axis). DNase I-hypersensitivity (GSM736580; green) and RNA polymerase II from ChIP-seq (GSM935299; blue) data from A549 cells are shown. (D) LAC patient 4137 Normal nucleosomal midpoints (blue track) were plotted in the UCSC genome browser against the published human lymphocyte nucleosome distribution maps by Gaffney et. al. (green track) for the ZNF451 and CCDC97 loci. Sequence capture oligos and corresponding RefSeq gene models are shown for each locus. Correlations are shown for ZNF451 and CCDC87, respectively.

    Journal: Oncotarget

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression

    doi: 10.18632/oncotarget.6811

    Figure Lengend Snippet: The newly developed mTSS-Capture method combined with paired-end sequencing maps genome-wide nucleosome distribution in primary patient samples and identifies bona fide nucleosome characteristics, concordant with other human nucleosome mapping studies A . Work-flow of the mTSS-seq method. Following MNase digestion using a titration of MNase, populations of mononucleosomally protected DNA and subnucleosomal fragments are isolated, and prepared as libraries for Illumina sequencing. Solution-based sequence capture is performed using biotinylated oligos, enabling the enrichment of fragments within 2kb of each transcription start site in the human genome. Paired-end 50bp sequencing was then performed on each index. B . Alignment of the mTSS-seq midpoints to the human genome using the UCSC genome browser for LAC patient #4137 Normal tissue is shown for chr11, hg19 ( http://genome.ucsc.edu ). Zooming in twice at 100X allows for further visualization of the sequence capture oligos surrounding the TSS in a 500kb and a 5kb region showing the ATM locus. C . Averaged, normalized reads per million (y-axis) from mTSS-seq plotted as fragments (gray) and midpoints (black), centered on and surrounding 2kb of the TSS for ~22,000 open reading frames in hg19 (x-axis). DNase I-hypersensitivity (GSM736580; green) and RNA polymerase II from ChIP-seq (GSM935299; blue) data from A549 cells are shown. (D) LAC patient 4137 Normal nucleosomal midpoints (blue track) were plotted in the UCSC genome browser against the published human lymphocyte nucleosome distribution maps by Gaffney et. al. (green track) for the ZNF451 and CCDC97 loci. Sequence capture oligos and corresponding RefSeq gene models are shown for each locus. Correlations are shown for ZNF451 and CCDC87, respectively.

    Article Snippet: Universal and indexed sequences were added through 8 cycles of PCR, using NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1, NEB #E7335S/L).

    Techniques: Sequencing, Genome Wide, Titration, Isolation, Chromatin Immunoprecipitation

    Schistosomula excrete/secrete extracellular miRNAs. Supernatant from 72 h in vitro cultured schistosomula was separated into EV-enriched and EV-depleted fractions (n=3) by preparatory ultracentrifugation. Total RNA from each fraction was extracted using the miRNeasy kit (Qiagen) and prepared for RNA-seq using the NEBNext Small RNA (for Illumina HiSeq sequencing) kit. To identify sma-miRNAs in our samples, the miRDeep2 package was utilized (29). Only miRNAs with at least 10 reads in 2 out of the 3 biological replicates (in at least one of the fractions, EV-enriched OR EV-depleted) were considered in the study. A total of 205 putative sma-miRNAs passed this criterion. sma-miRNA read count data were normalized using the DESeq2 package (33) as described in the Materials and methods . (a) Heatmap depiction of sma-miRNA abundance (represented by Z-scores) found within EV-enriched and EV-depleted supernatant fractions after agglomerative hierarchical clustering and standardization. Each row represents a miRNA and its relative Z-score value in EV-enriched and EV-depleted fractions is displayed in the 2 columns. All sma-miRNA specifics (name, sequence, raw/normalized read counts and cluster location) are included in Supplementary file 3 . (b) sma-miRNA localization found throughout the S. mansoni karyotype (v5.2). Vertical grey bars represent the position of known sma-miRNAs available in miRBase (v.21). Vertical black bars represent the localization of all extracellular sma-miRNAs (within EV-depleted and EV-enriched fractions) newly identified in our study. Black stars above the vertical lines represent 13 sma-miRNAs found in our study that are also present in miRBase. Eighteen miRNAs localized on unmapped scaffolds (16 not mapped at all; 1 unplaced on Ch 7, 4 and 3; 5 unplaced on Ch 1) as well as 15 miRNAs not yet mapped to the current S. mansoni genome assembly were not included in this analysis. All available sma-miRNA localization coordinates are available in Supplementary file 3 .

    Journal: Journal of Extracellular Vesicles

    Article Title: Protein and small non-coding RNA-enriched extracellular vesicles are released by the pathogenic blood fluke Schistosoma mansoni

    doi: 10.3402/jev.v4.28665

    Figure Lengend Snippet: Schistosomula excrete/secrete extracellular miRNAs. Supernatant from 72 h in vitro cultured schistosomula was separated into EV-enriched and EV-depleted fractions (n=3) by preparatory ultracentrifugation. Total RNA from each fraction was extracted using the miRNeasy kit (Qiagen) and prepared for RNA-seq using the NEBNext Small RNA (for Illumina HiSeq sequencing) kit. To identify sma-miRNAs in our samples, the miRDeep2 package was utilized (29). Only miRNAs with at least 10 reads in 2 out of the 3 biological replicates (in at least one of the fractions, EV-enriched OR EV-depleted) were considered in the study. A total of 205 putative sma-miRNAs passed this criterion. sma-miRNA read count data were normalized using the DESeq2 package (33) as described in the Materials and methods . (a) Heatmap depiction of sma-miRNA abundance (represented by Z-scores) found within EV-enriched and EV-depleted supernatant fractions after agglomerative hierarchical clustering and standardization. Each row represents a miRNA and its relative Z-score value in EV-enriched and EV-depleted fractions is displayed in the 2 columns. All sma-miRNA specifics (name, sequence, raw/normalized read counts and cluster location) are included in Supplementary file 3 . (b) sma-miRNA localization found throughout the S. mansoni karyotype (v5.2). Vertical grey bars represent the position of known sma-miRNAs available in miRBase (v.21). Vertical black bars represent the localization of all extracellular sma-miRNAs (within EV-depleted and EV-enriched fractions) newly identified in our study. Black stars above the vertical lines represent 13 sma-miRNAs found in our study that are also present in miRBase. Eighteen miRNAs localized on unmapped scaffolds (16 not mapped at all; 1 unplaced on Ch 7, 4 and 3; 5 unplaced on Ch 1) as well as 15 miRNAs not yet mapped to the current S. mansoni genome assembly were not included in this analysis. All available sma-miRNA localization coordinates are available in Supplementary file 3 .

    Article Snippet: Small RNA concentrations ranged from 60 pg/ml (EV-enriched fraction) to 750 pg/ml (EV-depleted fraction) as determined by the Bioanalyzer. sncRNA libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set and NEBNext index primer for Illumina (New England Biolabs, Ipswich, MA, USA), according to the manufacturer's protocol.

    Techniques: In Vitro, Cell Culture, RNA Sequencing Assay, Sequencing