|
Thermo Fisher
gene exp prdx4 mm00450261 m1 Gene Exp Prdx4 Mm00450261 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp prdx4 mm00450261 m1/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp prdx4 mm00450261 m1 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Proteintech
anti prdx4 Anti Prdx4, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti prdx4/product/Proteintech Average 93 stars, based on 1 article reviews
anti prdx4 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Proteintech
prdx4 ![]() Prdx4, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prdx4/product/Proteintech Average 93 stars, based on 1 article reviews
prdx4 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp prdx4 hs01056076 m1 ![]() Gene Exp Prdx4 Hs01056076 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp prdx4 hs01056076 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp prdx4 hs01056076 m1 - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Proteintech
prdx4 rabbit polyclonal antibody ![]() Prdx4 Rabbit Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prdx4 rabbit polyclonal antibody/product/Proteintech Average 93 stars, based on 1 article reviews
prdx4 rabbit polyclonal antibody - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Proteintech
elisa ![]() Elisa, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/elisa/product/Proteintech Average 93 stars, based on 1 article reviews
elisa - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
prdx4 pa5-85252 antibody ![]() Prdx4 Pa5 85252 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prdx4 pa5-85252 antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
prdx4 pa5-85252 antibody - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
OriGene
mouse prdx4 forward 50 atgagtgccacttctacgctgg ![]() Mouse Prdx4 Forward 50 Atgagtgccacttctacgctgg, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse prdx4 forward 50 atgagtgccacttctacgctgg/product/OriGene Average 99 stars, based on 1 article reviews
mouse prdx4 forward 50 atgagtgccacttctacgctgg - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
Journal: Scientific Reports
Article Title: L-ascorbate prevents non-alcoholic steatohepatitis-based hepatocarcinogenesis in Sod1/Prdx4 double-knockout mice
doi: 10.1038/s41598-025-28982-8
Figure Lengend Snippet: Asc alleviated tumor development and mortality in DKO mice. ( A ) Plasma Asc levels were measured using a fluorescent probe. The number of animals is indicated in parentheses. Statistical analysis was performed using one-way ANOVA followed by the Tukey‒Kramer test. ** P < 0.01; *** P < 0.001. ( B ) Male DKO mice with (1.5 mg/mL in drinking water) or without Asc supplementation were observed for up to one year ( n = 20 per group). Survival curves were compared using the log-rank test ( P = 0.0425). ( C ) Representative livers from DKO mice at 12 months (12 Mo). After one year, mice were euthanized and the numbers of visible hepatic tumors were determined. The incidence of tumor-bearing mice was compared among the four genetic groups. Chi-square analysis revealed P -values of 0.6714, 0.0935, and 0.0007 for Prdx4 -KO, Sod1 -KO, and DKO groups, respectively, compared with WT. Asc was supplemented in Sod1 -KO and DKO groups. Chi-square analysis showed a significant difference in tumor incidence between groups with and without Asc ( P = 0.0510 for Sod1 KO mice and P = 0.0019 for DKO mice).
Article Snippet: The primary antibodies used were: GPX4 (ab125066; Abcam), SOD1 , ACO1 (12,406–1-AP; Proteintech Group Inc.), ACO2 (67,509–1-IG; Proteintech Group Inc.),
Techniques: Clinical Proteomics
Journal: Scientific Reports
Article Title: L-ascorbate prevents non-alcoholic steatohepatitis-based hepatocarcinogenesis in Sod1/Prdx4 double-knockout mice
doi: 10.1038/s41598-025-28982-8
Figure Lengend Snippet: Changes in the status of ACOs and iron. ( A ) Immunoblot analysis was performed on liver proteins using an antibody against SOD1, PRDX4, ACO1, and ACO2 and β-ACTIN. The signal intensity was quantified using ImageJ software and is expressed relative to the β-ACTIN band. *** P < 0.001. ( B ) Aconitase activity was determined using a commercial assay kit without a further addition of iron. ** P < 0.01. ( C ) Iron contents were determined using an iron assay kit; n = 4 each in all experiments. Statistical analysis was performed using one-way ANOVA followed by the Tukey‒Kramer test.
Article Snippet: The primary antibodies used were: GPX4 (ab125066; Abcam), SOD1 , ACO1 (12,406–1-AP; Proteintech Group Inc.), ACO2 (67,509–1-IG; Proteintech Group Inc.),
Techniques: Western Blot, Software, Activity Assay, Iron Assay
Journal: Antioxidants
Article Title: Tetraselmis chuii Supplementation Increases Skeletal Muscle Nuclear Factor Erythroid 2-Related Factor 2 and Antioxidant Enzyme Gene Expression, and Peak Oxygen Uptake in Healthy Adults: A Randomised Crossover Trial
doi: 10.3390/antiox14040435
Figure Lengend Snippet: Gene names, gene symbols and ThermoFisher Scientific Assay IDs for human skeletal muscle OpenArray™ gene expression analyses.
Article Snippet: Peroxiredoxin 4 , PRDX4 ,
Techniques: Gene Expression, Binding Assay
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: The representative histological and immunostaining images of the Low-High (low SGLT2 and high PRDX4) group and High-Low (high SGLT2 and low PRDX4) group in same areas. ( A , 100×, scale bar: 250 μm) H&E staining of the Low-High group showed obvious atypia of tumor cells in this area, eosinophilic cytoplasm, profibrotic reaction and inflammatory cell infiltration. ( B , 400×, scale bar: 50 μm) Under high power, it can be seen that the tumor cells have obvious nuclear pleomorphism, abundant eosinophilic cytoplasm, and obvious nucleoli. ( C , 100×, scale bar: 250 μm) H&E staining of the High-Low group showed that tumor cells were arranged in nests, with eosinophilic cytoplasm and a small amount of pigmentation. ( D , 400×, scale bar: 50 μm) High magnification showed that the tumor cells have significant atypia, obvious nucleoli, and an increased nucleocytoplasmic ratio. ( E , 100×, scale bar: 250 μm) Low magnification area of low SGLT2 expression, with most tumor cells showing no staining. ( F , 400×, scale bar: 50 μm) In the area of low SGLT2 expression under high magnification, a small number of tumor cells can show weak staining in the cytoplasm. ( G , 100×, scale bar: 250 μm) In the area of high SGLT2 expression under low magnification, strong intracytoplasmic staining can be seen in most tumor cells. ( H , 400×, scale bar: 50 μm) In the area of high SGLT2 expression under high magnification, strong intracytoplasmic staining can be seen in most tumor cells. ( I , 100×, scale bar: 250 μm) In the area of high PRDX4 expression under low magnification, diffuse and strong staining in the cytoplasm of tumor cells can be seen. ( J , 400×, scale bar: 50 μm) In the area of high PRDX4 expression under high magnification, diffuse and strong staining in the cytoplasm of tumor cells can be seen. ( K , 100×, scale bar: 250 μm) Low-power PRDX4 expression area, with a small number of tumor cells showing staining. ( L , 400×, scale bar: 50 μm) In the area of low expression of PRDX4 under high magnification, a small number of tumor cells showed weak staining in the cytoplasm
Article Snippet: The
Techniques: Immunostaining, Staining, Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: A Kaplan-Meier analysis of low-expression and high-expression groups of SGLT2 and PRDX4 in HB. ( A ) There was no significant difference in the EFS between the low- and high-SGLT2 groups ( P = 0.167). ( B ) The OS of the low-SGLT2 group was significantly worse than that of the high-SGLT2 group ( P = 0.024). C , D . The EFS and OS of the high-PRDX4 group were significantly worse than those of the low-PRDX4 group ( P = 0.043, 0.027)
Article Snippet: The
Techniques: Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: A Kaplan-Meier analysis of different combinations of SGLT2 and PRDX4 expression in hepatoblastoma. ( A , B ). The EFS and OS of the Low-High group (low SGLT2 and high PRDX4) were significantly worse than those of the other groups ( P = 0.004, < 0.001). ( C , D ). Among the four groups (Low-Low group, Low-High group, High-Low group, and High-High group), the EFS and OS of the Low-High group were significantly worse than those of the other groups ( P = 0.038, 0.005)
Article Snippet: The
Techniques: Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: The univariate and multivariate analyses of EFS according to the clinicopathological variables and the expression of SGLT2 and PRDX4
Article Snippet: The
Techniques: Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: The univariate and multivariate analyses of OS according to the clinicopathological variables and the expression of SGLT2 and PRDX4
Article Snippet: The
Techniques: Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: Detailed correlations between different SGLT2 and PRDX4 expression levels and clinicopathological variables
Article Snippet: The
Techniques: Expressing
Journal: Diagnostic Pathology
Article Title: The immunohistochemical combination of low SGLT2 expression and high PRDX4 expression independently predicts shortened survival in patients undergoing surgical resection for hepatoblastoma
doi: 10.1186/s13000-025-01596-4
Figure Lengend Snippet: Detailed correlations between different SGLT2 and PRDX4 expression levels and others of the clinicopathological variables
Article Snippet: The
Techniques: Expressing