power sybr green pcr master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher power sybr green pcr master mix
    Polyacrylamide gel electrophoresis of hCoV <t>PCR</t> products. PCR products from two experiments, one where each well contained 3 μl of hCoV229E RNA (Exp1) and another 5 μl, to increase yield (Exp2) and products from RNA produced from the pEX-A vector. HypperLadder V marks are from bottom, 25, 50, 75, 100 bp up to 500. The marks at 50 bp are due to primer dimmers which are known to form in <t>SYBR</t> Green PCRs
    Power Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6704 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/power sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 6704 article reviews
    Price from $9.99 to $1999.99
    power sybr green pcr master mix - by Bioz Stars, 2020-05
    99/100 stars

    Images

    1) Product Images from "Pan-human coronavirus and human bocavirus SYBR Green and TaqMan PCR assays; use in studying influenza A viruses co-infection and risk of hospitalization"

    Article Title: Pan-human coronavirus and human bocavirus SYBR Green and TaqMan PCR assays; use in studying influenza A viruses co-infection and risk of hospitalization

    Journal: Infection

    doi: 10.1007/s15010-014-0710-5

    Polyacrylamide gel electrophoresis of hCoV PCR products. PCR products from two experiments, one where each well contained 3 μl of hCoV229E RNA (Exp1) and another 5 μl, to increase yield (Exp2) and products from RNA produced from the pEX-A vector. HypperLadder V marks are from bottom, 25, 50, 75, 100 bp up to 500. The marks at 50 bp are due to primer dimmers which are known to form in SYBR Green PCRs
    Figure Legend Snippet: Polyacrylamide gel electrophoresis of hCoV PCR products. PCR products from two experiments, one where each well contained 3 μl of hCoV229E RNA (Exp1) and another 5 μl, to increase yield (Exp2) and products from RNA produced from the pEX-A vector. HypperLadder V marks are from bottom, 25, 50, 75, 100 bp up to 500. The marks at 50 bp are due to primer dimmers which are known to form in SYBR Green PCRs

    Techniques Used: Polyacrylamide Gel Electrophoresis, Polymerase Chain Reaction, Produced, Plasmid Preparation, SYBR Green Assay

    Related Articles

    other:

    Article Title:
    Article Snippet: Total RNA was reverse transcribed into cDNA using Superscript III (Invitrogen), and quantitative PCR (qPCR) was performed using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) on a 7500 Fast Real-Time PCR System (Applied Biosystems).

    Article Title:
    Article Snippet: RT-PCR reactions were conducted in triplicate using Power SYBR Green PCR Master Mix (Applied Biosystems) on a CFX96 real-time PCR detection system (BioRad) to determine cycle threshold (Ct) values.

    Article Title:
    Article Snippet: Reverse transcription was performed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA), and qPCR was performed in a LightCycler480 Ⅱ (Roche, Switzerland) with power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title:
    Article Snippet: The reaction mix (15 μL) contains Power SYBR Green PCR Master Mix (Applied Biosystems), 200 nM of forward and reverse primers, and either sample cDNAs or serially-diluted standard cDNAs; the latter was used to generate standard curves for quantification.

    Article Title:
    Article Snippet: RT-qPCR amplification of cDNAs was carried out in a 20-μL reaction mixture containing Applied Biosystems Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    Article Title:
    Article Snippet: The 25-μl qRT-PCR mixture contained 12.5 μl of Power SYBR green PCR master mix (Applied Biosystems), 0.5 μl of a 10 μM concentration of each primer, 2 μl diluted template (cDNA), and 9.5 μl of nuclease-free water.

    Article Title:
    Article Snippet: Reverse-transcription was performed using Transcriptor First Strand cDNA Synthesis Kit (Roche, 04379012001). qPCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, 4367659), and a housekeeping gene Peptidylpropyl isomerase ( Ppib ) was used as an internal standard ( ). mRNA levels of all the genes were normalized against Ppib level within each sample, using a formula 2^(−ΔCt(Gene of interest − Ppib ))×1000, and compared across different samples.

    Article Title:
    Article Snippet: Power SYBR Green PCR Master Mix was purchased from Applied Biosystems (Carlsbad, CA, USA).

    Article Title:
    Article Snippet: Each 20μl well reaction comprised of 10μl Power SYBR Green Master mix (4367659, Invitrogen), 1μl primer mix (Final concentration 0.5μM) and 1μl cDNA.

    Article Title:
    Article Snippet: The reaction was 20 µL: 10 µL of Power SYBR Green PCR Master Mix (Applied Biosystems), 2 µL (10 pmoles/µL) each Primer, 2 µL cDNA, 4 µL ultrapure water.

    Article Title:
    Article Snippet: We measured the expression levels of the genes of interest by quantitative RT-PCR using Power SYBR Green PCR Master Mix (Applied Biosystems) and the StepOnePlus Real-Time PCR System (Applied Biosystems).

    Article Title:
    Article Snippet: Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title:
    Article Snippet: Total RNA (2 μg) was used to prepare cDNA using high capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA). qRT-PCR was performed on a 7500 ABI Real-time PCR system (Applied Biosystems, CA, USA) using the Power SYBR Green PCR master mix (Applied Biosystems, CA, USA) to check the expression levels of pluripotent marker genes Oct4 , Sox2 , and Nanog .

    Article Title:
    Article Snippet: PCR reaction were performed with Power SYB Green PCR Master Mix (Applied Biosystems 4367659) in a 20 μl reaction containing 5 pmol forward and reverse primer, 0.1 μl cDNA template and 10 μl of Power SYBR Green PCR Master Mix.

    Article Title:
    Article Snippet: Reactions were carried out in final volumes of 20 µL, consisting of 10 µL of Power SYBR Green PCR Master Mix (Life Technologies, USA), 0.25 µM of each primer (forward and reverse; Supplementary Table 1), 1 µL of cDNA template and 7 µL of PCR-grade water.

    Article Title:
    Article Snippet: Reactions were prepared using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) and universal cycling conditions (95 °C for 10 min followed by 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s).

    Article Title:
    Article Snippet: Q‐PCR reactions contained 1× Power SYBR Green PCR Master Mix® (Applied Biosystems, Carlsbad, CA, USA), 2.5 μl of 100‐fold diluted cDNA and 0.1 μM of each primer.

    Article Title:
    Article Snippet: We generated first-strand cDNA using TaqMan Reverse Transcription Reagent (Applied Biosystems) and carried out quantitative PCR using StepOnePlus Real-Time PCR System (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title:
    Article Snippet: Each 20μl reaction comprised 1μl Power SYBR Green Master Mix (4367659, Invitrogen), 1μl primer mix (Final concentration 0.5μM) and 1μl cDNA.

    Article Title:
    Article Snippet: , via Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    Article Title:
    Article Snippet: Applied Biosystems® Power SYBR Green PCR Master Mix.

    Article Title:
    Article Snippet: Real-time PCR (qPCR) was performed using Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific, Cat. 4367659) together with specific primers for HPRT1 ( Forward : cctcctcagaccgcttttt; Reverse : aacctggttcatcatcgctaa), FoxN1 ( Forward : tgacggagcacttcccttac; Reverse : gacaggttatggcgaacagaa), FGF7 ( Forward : tggctgacaccatgactagc; Reverse : ggctacaggctgtcgttttt), FGFR2IIIb ( Forward : tgcatggttgacagttctgc; Reverse : tgcaggcgattaagaagacc), IL7 ( Forward : ctgctgcagtcccagtcat; Reverse : tcagtggaggaattccaaagat) or Dll4 ( Forward : aggtgccacttcggttacac; Reverse : gggagagcaaatggctgata).

    Article Title:
    Article Snippet: Reactions were prepared with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), according to the manufacturer's protocol, with each reaction containing 1 μl of cDNA from the aforementioned reverse transcription reaction (with the exception of 18S reactions, which contained 1 μl of 1:100 diluted cDNA), 1× Power SYBR Green PCR Master Mix, 0.3μM of both the forward and reverse primers (with the exception of Dnmt3b , 0.1μM), and DEPC-treated water (Ambion, Inc., Austin, TX) up to 50 μl.

    Article Title:
    Article Snippet: Gene expression was quantified using Power SYBR Green PCR Master Mix (Applied Biosystems) by reverse transcriptase PCR on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems).

    Article Title:
    Article Snippet: The thermal cycler conditions were as follows: 10 minutes at 95°C, followed by 45 cycles of a 2-step PCR consisting of a 95°C step for 15 seconds followed by a 60°C step for 25 seconds.

    Article Title:
    Article Snippet: Power SYBR Green PCR master mix was purchased from Life Technologies (Carlsbad, CA).

    Article Title:
    Article Snippet: Quantitative PCR was performed with Power SYBR Green PCR Master Mix (Cat. #4368708) using a StepOnePlusTM Real-time PCR System (Applied Biosystems).

    Article Title:
    Article Snippet: The obtained RNA was reverse‐transcribed to cDNA using the RevertAid First‐Strand cDNA Synthesis Kit (Thermo, Shanghai, China), and Power SYBR Green PCR Master Mix (Thermo, Shanghai, China) was used for determination.

    Article Title:
    Article Snippet: Band smearing in agarose gels of PCR amplified bacterial 16S rRNA genes is understood to comprise amplicons of varying sizes arising from PCR errors, and requires elimination.

    Article Title:
    Article Snippet: The Power SYBR® Green PCR Master mix (Applied Biosystems) was employed for the qPCR with 4 μL of cDNA solution in a volume of 10 μL according to the manufacturer’s protocol.

    Article Title:
    Article Snippet: Fifty micrograms of total RNA were reverse transcribed using 500 ng poly-dT (Invitrogen) and 0.25 U avian myeloblastosis virus-reverse transcriptase at 42 °C for 75 min and 95 °C for 5 min. cDNA and primers were added to 15 μl total reaction volume of Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA).

    Article Title:
    Article Snippet: Total RNA was isolated using Direct-zol RNA mini prep kit (Zymo Research) and reverse-transcribed using SuperScript II (Life Technologies) with oligo(dT18 ). qPCR was performed using Power SYBR Green PCR Master Mix (Invitrogen) on a CFX-Connect detection system (Bio-Rad, Hercules, CA) with Bio-Rad CFX Manager 3.1 software.

    Article Title:
    Article Snippet: RT-qPCR was run with Power SYBR Green PCR Master Mix (Applied Biosystems) in a Step-One-Plus Real-Time PCR machine (Applied Biosystems).

    Article Title:
    Article Snippet: Real‐time RT–PCR analysis was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and an Applied Biosystems 7500 Real‐Time PCR System.

    Article Title:
    Article Snippet: For identification of bocavirus the Power SYBR Green PCR Master Mix (Applied Biosystems) was used: reaction mixture 10 µl of Power SYBR Green PCR Master Mix (2×), 2.5 µl forward and reverse primer (20 µM), 2 µl RNAse free water and 3 µl of template in positive control well or sample in test wells.

    Article Title:
    Article Snippet: RNA samples were reverse transcribed with 5 × HiScript®II qRT SuperMix. cDNA was then amplified with specific primers and Power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title:
    Article Snippet: Quantitative PCR was performed with commercially available reagents (Power SYBR Green PCR Master Mix, Applied Biosystems, Foster City, CA) using an automated system (Applied Biosystems 7300 Real Time PCR System) with 0.5 pmol/μl of each of the following primers: Runx2 forward, CGA CAG TCC CAA CTT CCT GT, and reverse, CGG TAA CCA CAG TCC CAT CT; Rgs2 forward, GAG GAG AAG CGG GAG AAA AT, and reverse, GCT TTT CTT GCC AGT TTT GG; osteocalcin forward, CTG ACA AAG CCT TCA TGT CCA A, and reverse, GCG CCG GAG TCT GTT CAC TA; Rgs4 forward, TGC CTT TCT CTC CTC GCT AA, and reverse, GCC GAT GTT TCA TGT CCT TT; Gpr30 forward, CCA AGC CTC AAC ACT CAC AC, and reverse, GAA AAC CAG AAG GGT GGA CA; Rgs5 forward, GCC AGC CAA AAT GTG TAA GG, and reverse, AGC AGA GTC TGG CTT CTG GA; Gpr23 forward, CTG GTG CCA GAG TTT GGT TT, and reverse, TTT TCC CAG AGA GCC TGC TA; Rgs16 forward, GCT CCG ATA CTG GGG GTA TT, and reverse, TTC AGC AGC AAA TCG AAA GA; Gpr54 forward, GGT GCT GGG AGA CTT CAT GT, and reverse, ACA TAC CAG CGG TCC ACA CT; Gna13 forward, CCA CCA TCT ACA GCA ACG TG, and reverse, CCA TGG AGC TGG TTT TTG TT; Gpr64 forward, CTG TGG TTG TGT CCA TCG TC, and reverse, CCA CAT TGC TGT TGA TCC AG; osteopontin forward, ACT CCA ATC GTC CCT ACA GTC G, and reverse, TGA GGT CCT CAT CTG TGG CAT; Wnt7b forward, ATG CCC GTG AGA TCA AAA AG, and reverse, CCT GAC ACA CCG TGA CAC TT; Serpin b2 (PAI2) forward, CAA GAT GGT GCT GGT GAA TG, and reverse, GCT CTC ATG CGA GTT CAC AC; Alk Phos forward, TTG TGC GAG AGA AAG AGA GAG A, and reverse, GTT TCA GGG CAT TTT TCA AGG T; p21 forward, TTG CAC TCT GGT GTC TGA GC, and reverse, TCT GCG CTT GGA GTG ATA GA; Mcox forward, ACG AAA TCA ACA ACC CCG TA, and reverse, GGC AGA ACG ACT CGG TTA TC; Hprt forward, CAG GCC AGA CTT TGT TGG AT, and reverse, TTG CGC TCA TCT TAG GCT TT; histone H4 forward, TGA GCT TCC TTC CTA GTT TGC, and reverse, GCT TAG CAC CAC CCT TAC CA; p27 forward, GTG GAC CAA ATG CCT GAC TC, and reverse, TCT GTT GGC CCT TTT GTT TT; cyclin B2 forward, GCC TCT TGC CTG TCT CAG AA, and reverse, GCT GCA TGA CTT CCA GGA CT. Rodent GAPDH and ribosomal 18 S RNA internal control primers were purchased from Applied Biosystems.

    Article Title:
    Article Snippet: Total RNA was quantified using the NanoDrop2000 spectrophotometer (Thermo Fisher, Waltham, MA, United States) and either used immediately or stored at -80°C until further use. cDNA was synthesised by retro-transcribing 200 ng of total RNA using the High Capacity cDNA reverse transcription kit (Thermo Fisher, Waltham, MA, United States), according to the manufacturer’s protocol. qRT PCR was performed using the StepOnePlus RT-PCR machine (Thermo Fisher, Waltham, MA, United States) in 20 μl reactions with Power SYBR Green PCR Master Mix (Thermo Fisher, Waltham, MA, United States) and specific oligonucleotide primers ( ) (MWG−Biotech, Eurofins Scientific, Brussels, Belgium).

    Article Title:
    Article Snippet: Experiments were done on at least three independent chromatin preparations, and quantitative PCR analysis was performed in real time with Power SYBR Green PCR Master Mix (Applied Biosystems) using an Applied Biosystems 7.700 sequence detector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher power sybr green pcr master mix
    Hypermutation of the FeLV-B genome and APOBEC3G mRNA expression in human cells. FeLV genomic sequences (segments of Gag and Pol) were cloned by <t>PCR</t> from infected human cells, and individual templates were sequenced and compared to the reference input virus (pFGB clone). APOBEC3G mRNA expression was determined in the same cells (prior to infection) by quantitative real-time PCR (with <t>SYBR</t> green). (A) Representative plots of hypermutation visualized by the online HYPERMUT program ( www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html ), where sequence changes relative to the reference FeLV-B genome are color coded (red, GG→AG; cyan, GA→AA; green, GC→AC; magenta, GT→AT; black, non-G→A). (B) X/Y plots of G→A mutation (per kilobase) against APOBEC3G mRNA levels (where the level in HEK293 cells is taken as 1) with cell lines sorted according to FeLV restriction phenotype. Results for LCLs, which are discordant by virtue of their low levels of infectious virion release ( Table 2 ) but postinfection accumulation of proviral DNA ( Fig. 3 ), are enclosed by a dashed oval. (C) Percentage of G→A mutations that conform to the A3G signature ( 42 ) for all cell lines in which significant levels of mutations were detected. Blue-gray bars, hematopoietic cells; yellow bars, nonhematopoietic cells. (D) Relative levels of APOBEC3G mRNA (on a log 10 scale, with the level in HEK293 cells taken as 1) for all the cell lines tested, sorted into hematopoietic (blue circles) and nonhematopoietic (green circles) cell lines. Nonpermissive cells (nonspreading, with low virion release) are represented by black circles.
    Power Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6709 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/power sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 6709 article reviews
    Price from $9.99 to $1999.99
    power sybr green pcr master mix - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher power sybr green rna to ct rt qpcr kit
    COS hiPSC cohort reprogramming and differentiation. a Validated hiPSCs (from 14 individuals with childhood-onset-schizophrenia (COS) and 12 unrelated healthy controls) and NPCs (12 COS; 12 control individuals) yielded 94 <t>RNA-Seq</t> samples (11 COS; 11 control individuals). b Schematic illustration of the reprogramming and differentiation process, noting the yield at each stage. c Sex breakdown of the COS-control cohort. d Breakdown of SZ-associated copy number variants in the 11 COS patients with RNA-Seq data. e Representative <t>qPCR</t> validation of NANOG, NESTIN , and SYN1 expression in hiPSCs (white bar), NPCs (light gray) and 6-week-old neurons (dark gray) from three individuals. f FACS analysis for pluripotency markers TRA-1-60 (left) and SSEA4 (right) in representative control (blue, n = 17) and COS (red, n = 16) hiPSCs. g FACS analysis for NPC markers SOX2 (left) and NESTIN (right) in control (blue, n = 34) and COS (red, n = 37) NPCs. h Representative images of NPCs (left) and 6-week-old forebrain neurons (right) from control (top) and COS (bottom). NPCs stained with SOX2 (red) and NESTIN (green); neurons stained with MAP2 (red). DAPI-stained nuclei (blue). Scale bar=50 μm. i Computational workflow showing quality control, integration with external data sets, computational deconvolution with Cibersort, decomposition multiple sources of expression variation with variancePartition, coexpression analysis with WGCNA, differential expression and concordance analysis
    Power Sybr Green Rna To Ct Rt Qpcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/power sybr green rna to ct rt qpcr kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    power sybr green rna to ct rt qpcr kit - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Hypermutation of the FeLV-B genome and APOBEC3G mRNA expression in human cells. FeLV genomic sequences (segments of Gag and Pol) were cloned by PCR from infected human cells, and individual templates were sequenced and compared to the reference input virus (pFGB clone). APOBEC3G mRNA expression was determined in the same cells (prior to infection) by quantitative real-time PCR (with SYBR green). (A) Representative plots of hypermutation visualized by the online HYPERMUT program ( www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html ), where sequence changes relative to the reference FeLV-B genome are color coded (red, GG→AG; cyan, GA→AA; green, GC→AC; magenta, GT→AT; black, non-G→A). (B) X/Y plots of G→A mutation (per kilobase) against APOBEC3G mRNA levels (where the level in HEK293 cells is taken as 1) with cell lines sorted according to FeLV restriction phenotype. Results for LCLs, which are discordant by virtue of their low levels of infectious virion release ( Table 2 ) but postinfection accumulation of proviral DNA ( Fig. 3 ), are enclosed by a dashed oval. (C) Percentage of G→A mutations that conform to the A3G signature ( 42 ) for all cell lines in which significant levels of mutations were detected. Blue-gray bars, hematopoietic cells; yellow bars, nonhematopoietic cells. (D) Relative levels of APOBEC3G mRNA (on a log 10 scale, with the level in HEK293 cells taken as 1) for all the cell lines tested, sorted into hematopoietic (blue circles) and nonhematopoietic (green circles) cell lines. Nonpermissive cells (nonspreading, with low virion release) are represented by black circles.

    Journal: Journal of Virology

    Article Title: Barriers to Infection of Human Cells by Feline Leukemia Virus: Insights into Resistance to Zoonosis

    doi: 10.1128/JVI.02119-16

    Figure Lengend Snippet: Hypermutation of the FeLV-B genome and APOBEC3G mRNA expression in human cells. FeLV genomic sequences (segments of Gag and Pol) were cloned by PCR from infected human cells, and individual templates were sequenced and compared to the reference input virus (pFGB clone). APOBEC3G mRNA expression was determined in the same cells (prior to infection) by quantitative real-time PCR (with SYBR green). (A) Representative plots of hypermutation visualized by the online HYPERMUT program ( www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html ), where sequence changes relative to the reference FeLV-B genome are color coded (red, GG→AG; cyan, GA→AA; green, GC→AC; magenta, GT→AT; black, non-G→A). (B) X/Y plots of G→A mutation (per kilobase) against APOBEC3G mRNA levels (where the level in HEK293 cells is taken as 1) with cell lines sorted according to FeLV restriction phenotype. Results for LCLs, which are discordant by virtue of their low levels of infectious virion release ( Table 2 ) but postinfection accumulation of proviral DNA ( Fig. 3 ), are enclosed by a dashed oval. (C) Percentage of G→A mutations that conform to the A3G signature ( 42 ) for all cell lines in which significant levels of mutations were detected. Blue-gray bars, hematopoietic cells; yellow bars, nonhematopoietic cells. (D) Relative levels of APOBEC3G mRNA (on a log 10 scale, with the level in HEK293 cells taken as 1) for all the cell lines tested, sorted into hematopoietic (blue circles) and nonhematopoietic (green circles) cell lines. Nonpermissive cells (nonspreading, with low virion release) are represented by black circles.

    Article Snippet: Aliquots (12.5 ng) of cDNA were amplified in triplicate using Power SYBR green PCR master mix (Thermo Fisher Scientific) and Qiagen QuantiTect primer assays for human hypoxanthine phosphoribosyltransferase (HPRT) (QT00059066), APOBEC3G (QT00070770), SLC20A1 (PIT-1) (QT00028763), or SLC19A2 (THTR1) (QT00007847) on an ABI 7500 real-time PCR system.

    Techniques: Expressing, Genomic Sequencing, Clone Assay, Polymerase Chain Reaction, Infection, Real-time Polymerase Chain Reaction, SYBR Green Assay, Sequencing, Mutagenesis

    Accumulation of immunostimulatory 5′-ppp-vtRNAs during lytic reactivation. a Predicted secondary structure of vtRNAs generated by RNAfold. b SYBR-Gold staining of in vitro transcribed vtRNAs with or without CIP treatment. c HCT116 ISG54-luciferase reporter cells were transfected with 100 ng in vitro transcribed vtRNAs with or without CIP treatment. Cells were harvested 24 h posttransfection and subjected to luciferase assay. Mock indicated cells without RNA transfection and was set as 1. d BC-3 cells were reactivated for 3 days and expression of DUSP11 was quantified by RT-qPCR. L latency, D1–D3 lytic reactivation for 1 day to 3 days. The DUSP11 expression was normalized to the level of 18S rRNA and L was set as 1. e Cell lysates were prepared from BC-3 cells described in ( d ) and DUSP11 protein levels were monitored by Western blot. GAPDH was run as a loading control. f Latent and lytic BC-3 cells were subjected to RNAP II ChIP-qPCR analysis. Signals were normalized to input. g ). h HCT116 ISG54-luciferase reporter cells were transfected with vtRNA or U1 RNA isolated by antisense oligonucleotide affinity selection from either latent or lytic BC-3 cells. Cells were harvested 12 h posttransfection and subjected to luciferase assay. Mock indicated cells without RNA transfection and was set as 1. Error bars in all panels represent mean ± SD from three independent experiments. p Values were determined by the Student’s t test, * p

    Journal: Nature Communications

    Article Title: RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection

    doi: 10.1038/s41467-018-07314-7

    Figure Lengend Snippet: Accumulation of immunostimulatory 5′-ppp-vtRNAs during lytic reactivation. a Predicted secondary structure of vtRNAs generated by RNAfold. b SYBR-Gold staining of in vitro transcribed vtRNAs with or without CIP treatment. c HCT116 ISG54-luciferase reporter cells were transfected with 100 ng in vitro transcribed vtRNAs with or without CIP treatment. Cells were harvested 24 h posttransfection and subjected to luciferase assay. Mock indicated cells without RNA transfection and was set as 1. d BC-3 cells were reactivated for 3 days and expression of DUSP11 was quantified by RT-qPCR. L latency, D1–D3 lytic reactivation for 1 day to 3 days. The DUSP11 expression was normalized to the level of 18S rRNA and L was set as 1. e Cell lysates were prepared from BC-3 cells described in ( d ) and DUSP11 protein levels were monitored by Western blot. GAPDH was run as a loading control. f Latent and lytic BC-3 cells were subjected to RNAP II ChIP-qPCR analysis. Signals were normalized to input. g ). h HCT116 ISG54-luciferase reporter cells were transfected with vtRNA or U1 RNA isolated by antisense oligonucleotide affinity selection from either latent or lytic BC-3 cells. Cells were harvested 12 h posttransfection and subjected to luciferase assay. Mock indicated cells without RNA transfection and was set as 1. Error bars in all panels represent mean ± SD from three independent experiments. p Values were determined by the Student’s t test, * p

    Article Snippet: RNA was DNase I (NEB) treated at 37 °C for 20 min, and inactivated with EDTA at 70 °C for 10 min. cDNA was synthesized from DNase-treated RNA with random 9-mer (Integrated DNA Technologies) and M-MLV RT (Promega). qPCR was performed using the PowerUp SYBR Green qPCR kit (Thermo Scientific) with appropriate primers (Supplementary Table ).

    Techniques: Generated, Staining, In Vitro, Luciferase, Transfection, Expressing, Quantitative RT-PCR, Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Isolation, Selection

    The thymus produces a significant number of Pth transcripts that increase after TPTX. (A) The thymus produced Pth transcripts. Mice in which serum PTH levels recovered (n = 10) were euthanized, and the heart, lung, liver, spleen, kidney, pancreas, testis or ovary, hypothalamus, pituitary gland, thymus, and adrenal glands were harvested. RNA qRT-PCR was performed on the tissue samples using SYBR Green/Taqman Master Mix with custom primers for the mouse Pth transcript and a commercial probe-set for 18S rRNA (endogenous control). Expression data were normalized to 18S rRNA, and fold changes of expression against arbitrary numbers were calculated using the 2 − ΔΔ Ct ). (B) Pth transcripts increased after TPTX. Thymi from unoperated mice (control) were harvested, and the same procedures were performed as in (A). qRT-PCR was performed as described with a commercial probe (gray) and custom probes (black). Student t test was performed. ** P

    Journal: Endocrinology

    Article Title: Thymic PTH Increases After Thyroparathyroidectomy in C57BL/KaLwRij Mice

    doi: 10.1210/en.2017-03083

    Figure Lengend Snippet: The thymus produces a significant number of Pth transcripts that increase after TPTX. (A) The thymus produced Pth transcripts. Mice in which serum PTH levels recovered (n = 10) were euthanized, and the heart, lung, liver, spleen, kidney, pancreas, testis or ovary, hypothalamus, pituitary gland, thymus, and adrenal glands were harvested. RNA qRT-PCR was performed on the tissue samples using SYBR Green/Taqman Master Mix with custom primers for the mouse Pth transcript and a commercial probe-set for 18S rRNA (endogenous control). Expression data were normalized to 18S rRNA, and fold changes of expression against arbitrary numbers were calculated using the 2 − ΔΔ Ct ). (B) Pth transcripts increased after TPTX. Thymi from unoperated mice (control) were harvested, and the same procedures were performed as in (A). qRT-PCR was performed as described with a commercial probe (gray) and custom probes (black). Student t test was performed. ** P

    Article Snippet: Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the Power SYBR Green PCR Master Mix on the Step-One-Plus system (Thermo Fisher Scientific).

    Techniques: Produced, Mouse Assay, Quantitative RT-PCR, SYBR Green Assay, Expressing

    COS hiPSC cohort reprogramming and differentiation. a Validated hiPSCs (from 14 individuals with childhood-onset-schizophrenia (COS) and 12 unrelated healthy controls) and NPCs (12 COS; 12 control individuals) yielded 94 RNA-Seq samples (11 COS; 11 control individuals). b Schematic illustration of the reprogramming and differentiation process, noting the yield at each stage. c Sex breakdown of the COS-control cohort. d Breakdown of SZ-associated copy number variants in the 11 COS patients with RNA-Seq data. e Representative qPCR validation of NANOG, NESTIN , and SYN1 expression in hiPSCs (white bar), NPCs (light gray) and 6-week-old neurons (dark gray) from three individuals. f FACS analysis for pluripotency markers TRA-1-60 (left) and SSEA4 (right) in representative control (blue, n = 17) and COS (red, n = 16) hiPSCs. g FACS analysis for NPC markers SOX2 (left) and NESTIN (right) in control (blue, n = 34) and COS (red, n = 37) NPCs. h Representative images of NPCs (left) and 6-week-old forebrain neurons (right) from control (top) and COS (bottom). NPCs stained with SOX2 (red) and NESTIN (green); neurons stained with MAP2 (red). DAPI-stained nuclei (blue). Scale bar=50 μm. i Computational workflow showing quality control, integration with external data sets, computational deconvolution with Cibersort, decomposition multiple sources of expression variation with variancePartition, coexpression analysis with WGCNA, differential expression and concordance analysis

    Journal: Nature Communications

    Article Title: Transcriptional signatures of schizophrenia in hiPSC-derived NPCs and neurons are concordant with post-mortem adult brains

    doi: 10.1038/s41467-017-02330-5

    Figure Lengend Snippet: COS hiPSC cohort reprogramming and differentiation. a Validated hiPSCs (from 14 individuals with childhood-onset-schizophrenia (COS) and 12 unrelated healthy controls) and NPCs (12 COS; 12 control individuals) yielded 94 RNA-Seq samples (11 COS; 11 control individuals). b Schematic illustration of the reprogramming and differentiation process, noting the yield at each stage. c Sex breakdown of the COS-control cohort. d Breakdown of SZ-associated copy number variants in the 11 COS patients with RNA-Seq data. e Representative qPCR validation of NANOG, NESTIN , and SYN1 expression in hiPSCs (white bar), NPCs (light gray) and 6-week-old neurons (dark gray) from three individuals. f FACS analysis for pluripotency markers TRA-1-60 (left) and SSEA4 (right) in representative control (blue, n = 17) and COS (red, n = 16) hiPSCs. g FACS analysis for NPC markers SOX2 (left) and NESTIN (right) in control (blue, n = 34) and COS (red, n = 37) NPCs. h Representative images of NPCs (left) and 6-week-old forebrain neurons (right) from control (top) and COS (bottom). NPCs stained with SOX2 (red) and NESTIN (green); neurons stained with MAP2 (red). DAPI-stained nuclei (blue). Scale bar=50 μm. i Computational workflow showing quality control, integration with external data sets, computational deconvolution with Cibersort, decomposition multiple sources of expression variation with variancePartition, coexpression analysis with WGCNA, differential expression and concordance analysis

    Article Snippet: Transcript analysis was carried out using a QuantStudio™ 7 Flex Real-Time PCR System using the Power SYBR green RNA-to-Ct RT-qPCR kit for primers (all ThermoFisher Scientific).

    Techniques: RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Expressing, FACS, Staining