Review



potb7 vector  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    ATCC potb7 vector
    Potb7 Vector, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/4D9D4/pmc03407025-73-12-14
    Average 92 stars, based on 12 article reviews
    potb7 vector - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Mel-18 Negatively RegulatesINK4a/ARF-Independent Cell Cycle Progression via Akt Inactivation in Breast Cancer
    Article Snippet: .. Full-length Mel-18 cDNA in pOTB7 vector was purchased (clone MGC-10336; American Type Culture Collection). ..

    Article Title: Structure and Kinetic Analysis of H2S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Article Title: Structure and Kinetic Analysis of H 2 S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Cloning of Human MST Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Article Title: Structure and Kinetic Analysis of H 2 S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Clone Assay:

    Article Title: Structure and Kinetic Analysis of H2S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Article Title: Structure and Kinetic Analysis of H 2 S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Cloning of Human MST Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Article Title: Structure and Kinetic Analysis of H 2 S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Cloning:

    Article Title: Structure and Kinetic Analysis of H 2 S Production by Human Mercaptopyruvate Sulfurtransferase
    Article Snippet: DHLA was purchased from Santa Cruz Biotechnology (Dallas, TX). .. Cloning of Human MST Human MST cDNA cloned in the pOTB7 vector (ATCC number MGC-10492) was purchased from ATCC (Manassas, VA). ..

    Amplification:

    Article Title: Galectin-1, a gene preferentially expressed at the tumor margin, promotes glioblastoma cell invasion
    Article Snippet: .. A cDNA clone of human galectin-1 was obtained from ATCC in the pOTB7 vector (ATCC #MGC-1818) and amplified using primers harboring BglII (forward) and SalI (reverse) sites: · forward - CGGATCAGATCTTGTAAAACGACGGCCAGTAAC, · reverse - CATCGTTGTCGACATGGGCTGGCTGATTTCAGTC), Both this PCR product and the pIRES2-acGFP1 vector (Clontech, Mountain View, CA) were cut, using these restriction sites, subsequently gel purified, and finally ligated together (Roche Rapid Ligation Kit, Roche). .. The resulting pIRES2-Gal1-acGFP1 vector was transformed into Top10 cells (Invitrogen, Eugene, OR) for amplification.

    Polymerase Chain Reaction:

    Article Title: Galectin-1, a gene preferentially expressed at the tumor margin, promotes glioblastoma cell invasion
    Article Snippet: .. A cDNA clone of human galectin-1 was obtained from ATCC in the pOTB7 vector (ATCC #MGC-1818) and amplified using primers harboring BglII (forward) and SalI (reverse) sites: · forward - CGGATCAGATCTTGTAAAACGACGGCCAGTAAC, · reverse - CATCGTTGTCGACATGGGCTGGCTGATTTCAGTC), Both this PCR product and the pIRES2-acGFP1 vector (Clontech, Mountain View, CA) were cut, using these restriction sites, subsequently gel purified, and finally ligated together (Roche Rapid Ligation Kit, Roche). .. The resulting pIRES2-Gal1-acGFP1 vector was transformed into Top10 cells (Invitrogen, Eugene, OR) for amplification.

    Purification:

    Article Title: Galectin-1, a gene preferentially expressed at the tumor margin, promotes glioblastoma cell invasion
    Article Snippet: .. A cDNA clone of human galectin-1 was obtained from ATCC in the pOTB7 vector (ATCC #MGC-1818) and amplified using primers harboring BglII (forward) and SalI (reverse) sites: · forward - CGGATCAGATCTTGTAAAACGACGGCCAGTAAC, · reverse - CATCGTTGTCGACATGGGCTGGCTGATTTCAGTC), Both this PCR product and the pIRES2-acGFP1 vector (Clontech, Mountain View, CA) were cut, using these restriction sites, subsequently gel purified, and finally ligated together (Roche Rapid Ligation Kit, Roche). .. The resulting pIRES2-Gal1-acGFP1 vector was transformed into Top10 cells (Invitrogen, Eugene, OR) for amplification.

    Ligation:

    Article Title: Galectin-1, a gene preferentially expressed at the tumor margin, promotes glioblastoma cell invasion
    Article Snippet: .. A cDNA clone of human galectin-1 was obtained from ATCC in the pOTB7 vector (ATCC #MGC-1818) and amplified using primers harboring BglII (forward) and SalI (reverse) sites: · forward - CGGATCAGATCTTGTAAAACGACGGCCAGTAAC, · reverse - CATCGTTGTCGACATGGGCTGGCTGATTTCAGTC), Both this PCR product and the pIRES2-acGFP1 vector (Clontech, Mountain View, CA) were cut, using these restriction sites, subsequently gel purified, and finally ligated together (Roche Rapid Ligation Kit, Roche). .. The resulting pIRES2-Gal1-acGFP1 vector was transformed into Top10 cells (Invitrogen, Eugene, OR) for amplification.



    Similar Products

    92
    ATCC potb7 vector
    Potb7 Vector, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/4D9D4/pmc03407025-73-12-14
    Average 92 stars, based on 1 article reviews
    potb7 vector - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    imaGenes GmbH potb7 vector
    Alternative splicing or alternative translation can give rise to hNaa40 S expression. ( A ) Scheme depicting two alternatively spliced h NAA40 transcripts; being transcript ENST00000377793.9 (3649 bp, transcript expected to code for the main functional isoform with transcript support level 1 according to the APPRIS database ( http://appris.bioinfo.cnio.es , accessed on 1 December 2020)) and transcript ENST00000542163.1 (1035 bp, transcript support level 2). Exons are indicated as boxes and corresponding non-coding and coding regions colored grey and orange, respectively. When considering the longest transcript, hNaa40 L and hNaa40 S translation initiates at the first (black arrow) and second in-frame AUG codon (orange arrow), respectively. Exon 1 encodes for the first 2 amino acids of hNaa40 L . The protein sequence of hNaa40 L (aa 1-237) with an indication of corresponding secondary structure elements of structure PDB:4U9V is provided above the transcripts. ( B ) Codon alignment of representative mammalian genomic sequences (alignment set hg38_58) in the vicinity of the canonical, database-annotated AUG TIS (dbTIS) (matching the human chr11:63939079-63939102 sequence indicated below) and the downstream AUG TIS (dTIS) (chr11:63945879-63945917 in human) of the NAA40 locus using WebLogo. The heights of the nucleotides are indicative for their degree of conservation at the indicated position . ( C ) Autoradiograph showing translation initiation of in vitro transcribed h NAA40 at the AUG start codons encoding M1 (black arrowhead) and M22 (dashed arrowhead). For this, wild type (1) and a dTIS mutagenized (mutation of ATG encoding M22 to CTG (dTIS > CTG)) h NAA40 <t>pOTB7</t> constructs were in vitro transcribed and translated, and radiolabeled proteins visualized by radiography following sodium dodecyl sulfate (SDS)-PAGE and electroblotting.
    Potb7 Vector, supplied by imaGenes GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/potb7+fen+1/pmc08037211-158-19-23
    Average 90 stars, based on 1 article reviews
    potb7 vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioResource International Inc potb7 vector
    Alternative splicing or alternative translation can give rise to hNaa40 S expression. ( A ) Scheme depicting two alternatively spliced h NAA40 transcripts; being transcript ENST00000377793.9 (3649 bp, transcript expected to code for the main functional isoform with transcript support level 1 according to the APPRIS database ( http://appris.bioinfo.cnio.es , accessed on 1 December 2020)) and transcript ENST00000542163.1 (1035 bp, transcript support level 2). Exons are indicated as boxes and corresponding non-coding and coding regions colored grey and orange, respectively. When considering the longest transcript, hNaa40 L and hNaa40 S translation initiates at the first (black arrow) and second in-frame AUG codon (orange arrow), respectively. Exon 1 encodes for the first 2 amino acids of hNaa40 L . The protein sequence of hNaa40 L (aa 1-237) with an indication of corresponding secondary structure elements of structure PDB:4U9V is provided above the transcripts. ( B ) Codon alignment of representative mammalian genomic sequences (alignment set hg38_58) in the vicinity of the canonical, database-annotated AUG TIS (dbTIS) (matching the human chr11:63939079-63939102 sequence indicated below) and the downstream AUG TIS (dTIS) (chr11:63945879-63945917 in human) of the NAA40 locus using WebLogo. The heights of the nucleotides are indicative for their degree of conservation at the indicated position . ( C ) Autoradiograph showing translation initiation of in vitro transcribed h NAA40 at the AUG start codons encoding M1 (black arrowhead) and M22 (dashed arrowhead). For this, wild type (1) and a dTIS mutagenized (mutation of ATG encoding M22 to CTG (dTIS > CTG)) h NAA40 <t>pOTB7</t> constructs were in vitro transcribed and translated, and radiolabeled proteins visualized by radiography following sodium dodecyl sulfate (SDS)-PAGE and electroblotting.
    Potb7 Vector, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/hsf1+cdna++bc014638++potb7/pm31677131-58-6-9
    Average 90 stars, based on 1 article reviews
    potb7 vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Transomic Technologies Inc cdna encoding human add3 bc062559) potb7 vector
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Cdna Encoding Human Add3 Bc062559) Potb7 Vector, supplied by Transomic Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/potb7+mgst2+plasmid/pmc06311435-185-23-35
    Average 90 stars, based on 1 article reviews
    cdna encoding human add3 bc062559) potb7 vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher human ho-1 cdna in potb7 vector (mgc:1723)
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Human Ho 1 Cdna In Potb7 Vector (Mgc:1723), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/pmc06909070-24-7-13
    Average 90 stars, based on 1 article reviews
    human ho-1 cdna in potb7 vector (mgc:1723) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    imaGenes GmbH full-length human p21 cdna (potb7-vector
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Full Length Human P21 Cdna (Potb7 Vector, supplied by imaGenes GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/potb7+fen+1/pmc05226578-133-0-8
    Average 90 stars, based on 1 article reviews
    full-length human p21 cdna (potb7-vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher potb7 vector
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Potb7 Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/pm26960140-83-15-17
    Average 90 stars, based on 1 article reviews
    potb7 vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Fisher Scientific potb7/hfis1 vector 108
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Potb7/Hfis1 Vector 108, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/potb7+hfis1+vector+108/10__1530_slash_joe___16___0111-38-8-11
    Average 90 stars, based on 1 article reviews
    potb7/hfis1 vector 108 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    95
    ATCC vector potb7
    (A) A comparative analysis of ADD1 and <t>ADD3</t> mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.
    Vector Potb7, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/potb7+vector/G-7/us09290745-1034-11-13
    Average 95 stars, based on 1 article reviews
    vector potb7 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Alternative splicing or alternative translation can give rise to hNaa40 S expression. ( A ) Scheme depicting two alternatively spliced h NAA40 transcripts; being transcript ENST00000377793.9 (3649 bp, transcript expected to code for the main functional isoform with transcript support level 1 according to the APPRIS database ( http://appris.bioinfo.cnio.es , accessed on 1 December 2020)) and transcript ENST00000542163.1 (1035 bp, transcript support level 2). Exons are indicated as boxes and corresponding non-coding and coding regions colored grey and orange, respectively. When considering the longest transcript, hNaa40 L and hNaa40 S translation initiates at the first (black arrow) and second in-frame AUG codon (orange arrow), respectively. Exon 1 encodes for the first 2 amino acids of hNaa40 L . The protein sequence of hNaa40 L (aa 1-237) with an indication of corresponding secondary structure elements of structure PDB:4U9V is provided above the transcripts. ( B ) Codon alignment of representative mammalian genomic sequences (alignment set hg38_58) in the vicinity of the canonical, database-annotated AUG TIS (dbTIS) (matching the human chr11:63939079-63939102 sequence indicated below) and the downstream AUG TIS (dTIS) (chr11:63945879-63945917 in human) of the NAA40 locus using WebLogo. The heights of the nucleotides are indicative for their degree of conservation at the indicated position . ( C ) Autoradiograph showing translation initiation of in vitro transcribed h NAA40 at the AUG start codons encoding M1 (black arrowhead) and M22 (dashed arrowhead). For this, wild type (1) and a dTIS mutagenized (mutation of ATG encoding M22 to CTG (dTIS > CTG)) h NAA40 pOTB7 constructs were in vitro transcribed and translated, and radiolabeled proteins visualized by radiography following sodium dodecyl sulfate (SDS)-PAGE and electroblotting.

    Journal: International Journal of Molecular Sciences

    Article Title: N-Terminal Acetyltransferase Naa40p Whereabouts Put into N-Terminal Proteoform Perspective

    doi: 10.3390/ijms22073690

    Figure Lengend Snippet: Alternative splicing or alternative translation can give rise to hNaa40 S expression. ( A ) Scheme depicting two alternatively spliced h NAA40 transcripts; being transcript ENST00000377793.9 (3649 bp, transcript expected to code for the main functional isoform with transcript support level 1 according to the APPRIS database ( http://appris.bioinfo.cnio.es , accessed on 1 December 2020)) and transcript ENST00000542163.1 (1035 bp, transcript support level 2). Exons are indicated as boxes and corresponding non-coding and coding regions colored grey and orange, respectively. When considering the longest transcript, hNaa40 L and hNaa40 S translation initiates at the first (black arrow) and second in-frame AUG codon (orange arrow), respectively. Exon 1 encodes for the first 2 amino acids of hNaa40 L . The protein sequence of hNaa40 L (aa 1-237) with an indication of corresponding secondary structure elements of structure PDB:4U9V is provided above the transcripts. ( B ) Codon alignment of representative mammalian genomic sequences (alignment set hg38_58) in the vicinity of the canonical, database-annotated AUG TIS (dbTIS) (matching the human chr11:63939079-63939102 sequence indicated below) and the downstream AUG TIS (dTIS) (chr11:63945879-63945917 in human) of the NAA40 locus using WebLogo. The heights of the nucleotides are indicative for their degree of conservation at the indicated position . ( C ) Autoradiograph showing translation initiation of in vitro transcribed h NAA40 at the AUG start codons encoding M1 (black arrowhead) and M22 (dashed arrowhead). For this, wild type (1) and a dTIS mutagenized (mutation of ATG encoding M22 to CTG (dTIS > CTG)) h NAA40 pOTB7 constructs were in vitro transcribed and translated, and radiolabeled proteins visualized by radiography following sodium dodecyl sulfate (SDS)-PAGE and electroblotting.

    Article Snippet: A sequence-verified full-length I.M.A.G.E. cDNA clone of h NAA40 (matching mRNA gi:13376118, cDNA clone MGC:59726, IMAGE:6292760)) cloned in the pOTB7 vector (IRAUp969D10104D, RZPD Imagenes, Germany) served as template for site-directed PCR-mutagenesis (QuickChange, Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions and as described in [ ] and using the primer pairs (10 nmol, RP-cartridge Gold, Eurogentec) Naa40a120c forward: 5′-GGAGCGAGCAGCCCTGGATGCCGTTTG-3′ and Naa40a120c reverse: 5′-CAAACGGCATCCAGGGCTGCTCGCTCC-3′ to introduce an ATG to CTG mutation of the newly identified dTIS in the coding sequence of h NAA40 , concomitantly resulting in recoding of Met22 to Leu. pMET7 Flag-tagged hNaa40p expressing constructs encoding either wild type full-length and thus also potential short hNaa40p (hNaa40 L/S ), hNaa40p with mutation of the dTIS (hNaa40 L(dTIS>CTG) ) or mutation of the dbTIS (hNaa40 S(dbTIS>CTG) ), in addition to the shorter hNaa40 S coding sequence (CDS) were generated using standard ApaI and SalI-HF restriction cloning and ligation.

    Techniques: Expressing, Functional Assay, Sequencing, Genomic Sequencing, Autoradiography, In Vitro, Mutagenesis, Construct, SDS Page

    (A) A comparative analysis of ADD1 and ADD3 mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.

    Journal: Biochimica et biophysica acta. Molecular cell research

    Article Title: Adducins inhibit lung cancer cell migration through mechanisms involving regulation of cell-matrix adhesion and cadherin-11 expression

    doi: 10.1016/j.bbamcr.2018.10.001

    Figure Lengend Snippet: (A) A comparative analysis of ADD1 and ADD3 mRNA expression levels in normal (n=59) and tumor (n=457) tissues from patients with lung adenocarcinoma. Error bars indicate the median absolute deviations. (B) Immunoblotting analysis of adducins expression in epithelial and mesenchymal-type non-small cell lung cancer cells. (C) Immunofluorescence labeling of ADD1 and ADD3 in non-tumorigenic bronchial epithelial cells (16HBE14o), epithelial-type (H1573) and mesenchymal-type (H1299) lung cancer cells. Arrows point on plasma membrane localization of ADD1 and ADD3 in epithelial-type cells. Arrowheads indicate cytoplasmic and nuclear localization of ADD1 in mesenchymal-type lung cancer cells. Scale bar, 20μm.

    Article Snippet: AS2.neomycin vector encoding FLAG-tagged wild-type ADD1 was obtained from Dr. Hong-Chen Chen, National Chung Hsing University, Taiwan [ 45 ], A cDNA encoding human ADD3 (clone {"type":"entrez-nucleotide","attrs":{"text":"BC062559","term_id":"38512197","term_text":"BC062559"}} BC062559 in the pOTB7 vector) was obtained from Transomic Technologies (Huntsville, AL) and the ADD3 insert was cloned into the pLKO.AS2.neo vector.

    Techniques: Expressing, Western Blot, Immunofluorescence, Labeling

    ADD1 expression was down-regulated H1573 cells using CRISPR/Cas9-mediated gene editing. (A) Immunoblotting analysis shows co-depletion of ADD1 and ADD3 by 4 different ADD1 small guide (sg) RNAs. (B) Quantification of the planar migration of the control and ADDl-depleted H1573 cell monolayers at 24 h post-wounding. (C, D) Representative images and quantitative analysis of the DAPI-labeled control and ADD 1-deficient HI 573 cells after 16 h of transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control and ADD 1-deficient H1573 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); **p < 0.005, as compared to the control sgRNA-transfected group.

    Journal: Biochimica et biophysica acta. Molecular cell research

    Article Title: Adducins inhibit lung cancer cell migration through mechanisms involving regulation of cell-matrix adhesion and cadherin-11 expression

    doi: 10.1016/j.bbamcr.2018.10.001

    Figure Lengend Snippet: ADD1 expression was down-regulated H1573 cells using CRISPR/Cas9-mediated gene editing. (A) Immunoblotting analysis shows co-depletion of ADD1 and ADD3 by 4 different ADD1 small guide (sg) RNAs. (B) Quantification of the planar migration of the control and ADDl-depleted H1573 cell monolayers at 24 h post-wounding. (C, D) Representative images and quantitative analysis of the DAPI-labeled control and ADD 1-deficient HI 573 cells after 16 h of transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control and ADD 1-deficient H1573 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); **p < 0.005, as compared to the control sgRNA-transfected group.

    Article Snippet: AS2.neomycin vector encoding FLAG-tagged wild-type ADD1 was obtained from Dr. Hong-Chen Chen, National Chung Hsing University, Taiwan [ 45 ], A cDNA encoding human ADD3 (clone {"type":"entrez-nucleotide","attrs":{"text":"BC062559","term_id":"38512197","term_text":"BC062559"}} BC062559 in the pOTB7 vector) was obtained from Transomic Technologies (Huntsville, AL) and the ADD3 insert was cloned into the pLKO.AS2.neo vector.

    Techniques: Expressing, CRISPR, Western Blot, Migration, Labeling, Transfection

    ADD3 expression was down-regulated HI573 cells using CRISPR/Cas9-mediated gene editing. (A) Immunoblotting analysis shows co-depletion of ADD3 and ADD1 by 4 different ADD3 small guide (sg) RNAs. (B) Quantification of the planar migration of the control and ADD3-depleted HI573 cell monolayers at 24 h post-wounding. (C, D) Representative images and quantitative analysis of the DAPI-labeled control and ADD3-deficient HI 573 cells after 16 h of transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control and ADD3-deficient HI573 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005, as compared to the control sgRNA-transfected group.

    Journal: Biochimica et biophysica acta. Molecular cell research

    Article Title: Adducins inhibit lung cancer cell migration through mechanisms involving regulation of cell-matrix adhesion and cadherin-11 expression

    doi: 10.1016/j.bbamcr.2018.10.001

    Figure Lengend Snippet: ADD3 expression was down-regulated HI573 cells using CRISPR/Cas9-mediated gene editing. (A) Immunoblotting analysis shows co-depletion of ADD3 and ADD1 by 4 different ADD3 small guide (sg) RNAs. (B) Quantification of the planar migration of the control and ADD3-depleted HI573 cell monolayers at 24 h post-wounding. (C, D) Representative images and quantitative analysis of the DAPI-labeled control and ADD3-deficient HI 573 cells after 16 h of transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control and ADD3-deficient HI573 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005, as compared to the control sgRNA-transfected group.

    Article Snippet: AS2.neomycin vector encoding FLAG-tagged wild-type ADD1 was obtained from Dr. Hong-Chen Chen, National Chung Hsing University, Taiwan [ 45 ], A cDNA encoding human ADD3 (clone {"type":"entrez-nucleotide","attrs":{"text":"BC062559","term_id":"38512197","term_text":"BC062559"}} BC062559 in the pOTB7 vector) was obtained from Transomic Technologies (Huntsville, AL) and the ADD3 insert was cloned into the pLKO.AS2.neo vector.

    Techniques: Expressing, CRISPR, Western Blot, Migration, Labeling, Transfection

    FLAG-tagged ADD1 or ADD3 were stably expressed in H1299 lung cancer cells using a lentiviral expression vector. (A) Immunoblotting analysis shows the levels of ADD1 and ADD3 proteins in the generated cell lines. (B) Quantification of the planar migration of the control, ADD1 or ADD3-overexpressing H1299 cell monolayers after 12 h of wound healing. (C, D) Representative images and quantitative analysis of the DAPI-labeled control, ADD1, or ADD3-overexpressing H1299 cells after 12 h transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control, ADD1, or ADD3-overexpressing H1299 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005, as compared to the control group.

    Journal: Biochimica et biophysica acta. Molecular cell research

    Article Title: Adducins inhibit lung cancer cell migration through mechanisms involving regulation of cell-matrix adhesion and cadherin-11 expression

    doi: 10.1016/j.bbamcr.2018.10.001

    Figure Lengend Snippet: FLAG-tagged ADD1 or ADD3 were stably expressed in H1299 lung cancer cells using a lentiviral expression vector. (A) Immunoblotting analysis shows the levels of ADD1 and ADD3 proteins in the generated cell lines. (B) Quantification of the planar migration of the control, ADD1 or ADD3-overexpressing H1299 cell monolayers after 12 h of wound healing. (C, D) Representative images and quantitative analysis of the DAPI-labeled control, ADD1, or ADD3-overexpressing H1299 cells after 12 h transfilter migration in the Boyden chamber. (E, F) Representative images and quantitative analysis of the DAPI-labeled control, ADD1, or ADD3-overexpressing H1299 cells after 24 h invasion into Matrigel. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005, as compared to the control group.

    Article Snippet: AS2.neomycin vector encoding FLAG-tagged wild-type ADD1 was obtained from Dr. Hong-Chen Chen, National Chung Hsing University, Taiwan [ 45 ], A cDNA encoding human ADD3 (clone {"type":"entrez-nucleotide","attrs":{"text":"BC062559","term_id":"38512197","term_text":"BC062559"}} BC062559 in the pOTB7 vector) was obtained from Transomic Technologies (Huntsville, AL) and the ADD3 insert was cloned into the pLKO.AS2.neo vector.

    Techniques: Stable Transfection, Expressing, Plasmid Preparation, Western Blot, Generated, Migration, Labeling

    (A, B) Representative immunoblots showing expression of different cadherins and densitometric quantification of the cadherin-11 protein level in the control, ADD1, or ADD3-depleted H1573 cells. (C, D) Cadherin-11 was transiently depleted by siRNA in control and ADD 1-deficient H1573 cells. (C) Immunoblotting analysis shows the efficiency of cadherin-11 depletion. (D) Results of the transfilter migration assay of the control and ADD 1-deficient H1573 cells with and without cadherin-11 depletion. (E, F) Transfilter migration data for the control and ADD 1-deficient H1573 cells treated with either anti-cadherin-11 antibody or control IgG. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005.

    Journal: Biochimica et biophysica acta. Molecular cell research

    Article Title: Adducins inhibit lung cancer cell migration through mechanisms involving regulation of cell-matrix adhesion and cadherin-11 expression

    doi: 10.1016/j.bbamcr.2018.10.001

    Figure Lengend Snippet: (A, B) Representative immunoblots showing expression of different cadherins and densitometric quantification of the cadherin-11 protein level in the control, ADD1, or ADD3-depleted H1573 cells. (C, D) Cadherin-11 was transiently depleted by siRNA in control and ADD 1-deficient H1573 cells. (C) Immunoblotting analysis shows the efficiency of cadherin-11 depletion. (D) Results of the transfilter migration assay of the control and ADD 1-deficient H1573 cells with and without cadherin-11 depletion. (E, F) Transfilter migration data for the control and ADD 1-deficient H1573 cells treated with either anti-cadherin-11 antibody or control IgG. Data are presented as mean ± SE (n =3); *p < 0.05; **p < 0.005.

    Article Snippet: AS2.neomycin vector encoding FLAG-tagged wild-type ADD1 was obtained from Dr. Hong-Chen Chen, National Chung Hsing University, Taiwan [ 45 ], A cDNA encoding human ADD3 (clone {"type":"entrez-nucleotide","attrs":{"text":"BC062559","term_id":"38512197","term_text":"BC062559"}} BC062559 in the pOTB7 vector) was obtained from Transomic Technologies (Huntsville, AL) and the ADD3 insert was cloned into the pLKO.AS2.neo vector.

    Techniques: Western Blot, Expressing, Migration