polynucleotide kinase buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 Polynucleotide Kinase Reaction Buffer
    Description:

    Catalog Number:
    B0201S
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs polynucleotide kinase buffer

    https://www.bioz.com/result/polynucleotide kinase buffer/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polynucleotide kinase buffer - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: Templates for in vitro transcription were obtained by cloning of the pre-crRNA sequences with an upstream T7 RNA polymerase promotor sequence into pUC19 vector. .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation.

    Centrifugation:

    Article Title: Structure of HIV‐1 reverse transcriptase bound to a novel 38‐mer hairpin template‐primer DNA aptamer
    Article Snippet: Aptamers (synthesized without 5′ phosphate) were 5′ 32 P end‐labeled in a 50‐µL volume containing 10 pmole of aptamer, 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 10 U of T4 PNK enzyme, and 10 µL of (γ‐32 P) ATP (3000 Ci mmol−1 , 10 µCi µL−1 ). .. Aptamers (synthesized without 5′ phosphate) were 5′ 32 P end‐labeled in a 50‐µL volume containing 10 pmole of aptamer, 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 10 U of T4 PNK enzyme, and 10 µL of (γ‐32 P) ATP (3000 Ci mmol−1 , 10 µCi µL−1 ).

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Purified RNA samples were dephosphorylated in a 15 μl reaction containing 1× T4 polynucleotide kinase buffer, 10 U SUPERase_In, and 20 U T4 polynucleotide kinase (NEB). .. The gel was stained with SYBR Gold (Invitrogen) to visualize the RNA fragments.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Ribosomes were pelleted by centrifugation with TLA100.2 rotor (Beckman) at 215,000g for 4 h at 4 °C, and subsequently resuspended in 700 μl of RLT buffer (Qiagen). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB).

    Filtration:

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. Using 0.5 μg of single-stranded circular M13mp19 (+) phage DNA and standard annealing buffer (20 mM Tris–HCl, pH 7.5, 10 mM MgCl2 , 100 mM NaCl, 1 mM DTT) the labeled oligodeoxynucleotide was annealed by heating at 95°C for 1 min, transferring immediately to 65°C for 2 min and then cooling slowly to room temperature.

    De-Phosphorylation Assay:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Size-selected fragments were purified by ethanol precipitation and dissolved in 10 μl of 10 mM Tris-HCl (pH 8.0). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation.

    Synthesized:

    Article Title: Structure of HIV‐1 reverse transcriptase bound to a novel 38‐mer hairpin template‐primer DNA aptamer
    Article Snippet: Polypurine DNA may have biological relevance since the HIV genome contains stretches of polypurine nucleotides that play a critical role in reverse transcription., Finally, this structure offers a new framework for studying RT‐DNA complexes at higher resolution than previously available and may enable systematic approaches such as crystallographic fragment screening for identification of new small molecule classes as potential inhibitors or chemical probes of RT function. .. Aptamers (synthesized without 5′ phosphate) were 5′ 32 P end‐labeled in a 50‐µL volume containing 10 pmole of aptamer, 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 10 U of T4 PNK enzyme, and 10 µL of (γ‐32 P) ATP (3000 Ci mmol−1 , 10 µCi µL−1 ). .. PNK enzyme was heat‐inactivated by incubating the reaction at 75°C for 15 min.

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: Templates for in vitro transcription were obtained by cloning of the pre-crRNA sequences with an upstream T7 RNA polymerase promotor sequence into pUC19 vector. .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min. .. The RNAs were separated by denaturing PAGE (8 M urea; 1× TBE; 10% polyacrylamide), and afterwards respective bands were cut out using sterile scalpels in reference to brief autoradiographic exposure.

    Electrophoresis:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The ribosome-protected RNA ‘footprint' fragments were separated by electrophoresis for 65 min at 200 V using 15% polyacrylamide TBE-urea gel (Invitrogen). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB).

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. The reaction mixture (10 μl) containing the 32 P-labeled helicase substrate (1000 cpm/10 μl) in appropriate buffer (20 mM Tris–HCl, pH 8.0, 8 mM DTT, 1.0 mM MgCl2 , 20 mM KCl and 16 μg/ml BSA), and the purified protein OsSUV3 was incubated at 37°C for 60 min.

    Article Title: MNAzymes, a Versatile New Class of Nucleic Acid Enzymes That Can Function as Biosensors and Molecular Switches
    Article Snippet: Substrate Sub2-FB (1 μM) was 5′ end-labeled in 10 μCi [γ-32 P]ATP (Perkin-Elmer), 1× PNK buffer, and 1 unit of polynucleotide kinase (New England Biolabs) at 37 °C for 30 min. .. Substrate Sub2-FB (1 μM) was 5′ end-labeled in 10 μCi [γ-32 P]ATP (Perkin-Elmer), 1× PNK buffer, and 1 unit of polynucleotide kinase (New England Biolabs) at 37 °C for 30 min.

    Incubation:

    Article Title: Mechanism of HIV-1 RNA Dimerization in the Central Region of the Genome and Significance for Viral Evolution
    Article Snippet: The gel-cleaned RNA template was treated with shrimp alkaline phosphatase (Fermentas) at 37 °C for 60 min and then incubated at 65 °C for 25 min to inactivate the enzyme. .. After cooling on ice, the reaction mixture was treated with [γ-32 P]ATP (6000 Ci/mmol), 10× PNK T4 Polynucleotide Kinase Reaction buffer and T4 polynucleotide kinase (New England Biolabs).

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min. .. The RNAs were separated by denaturing PAGE (8 M urea; 1× TBE; 10% polyacrylamide), and afterwards respective bands were cut out using sterile scalpels in reference to brief autoradiographic exposure.

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: The RNAs were transferred to Zeta-probe GT membranes (BioRad) using semi-dry transfer equipment (Owl Separation Systems) for 1 h at 10 V. After electro-blotting, RNAs were fixed to the membrane by ultraviolet (UV) cross-linking for 1 min followed by baking in a vacuum oven at 80° for 1 h. The membrane was prehybridized with Ultrahyb-oligo hybridization buffer (Ambion) for 2 h at 40°. .. During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences). .. The membrane was hybridized with the 5′ end-labeled antisense oligonucleotide probe for approximately 20 h at 40°.

    Article Title: Telomerase abrogates aneuploidy-induced telomere replication stress, senescence and cell depletion
    Article Snippet: Membrane was prehybridized by rapid hybridization buffer (Amersham; RPN1635) for 1 h and incubated over night with radiolabeled telomere (TTAGGG)3 or Alu probe (5′-CGGGAAGCAGAGGTTGTAGTGAGCC). .. Reaction mixture was 1 μl telomere restriction fragment, 13.5 μl H2 O, 2 μl T4 PNK buffer, 2.5 μl 32 P-γATP and 1 μl T4-polynucleotide kinase (New England Biolabs) at 37°C.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Size-selected fragments were purified by ethanol precipitation and dissolved in 10 μl of 10 mM Tris-HCl (pH 8.0). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation.

    Article Title: 5-Formylcytosine mediated DNA–protein cross-links block DNA replication and induce mutations in human cells
    Article Snippet: The mixtures were heated at 90°C for 10 min and allowed to slowly cool down to room temperature overnight to generate primer–template complexes for primer extension assays. .. To digest the protein component of DPCs, primer–template complexes containing histone H4-5fC cross-link (2 pmol) were incubated with proteinase K (2.4 units) at 37°C for 48 h in the presence of 1× T4 PNK buffer (New England Biolabs, Beverly, MA, USA). .. 32 P-labeled primer–template duplexes containing unmodified dC, 5-formyl-dC, DNA–peptide or DNA–protein crosslinks, or proteinase K digested DPCs (1 pmol) were incubated with human DNA polymerase η or κ (2 pmol) in the presence of 50 mM Tris–HCl (pH 7.5), 5 mM DTT, 5 mM MgCl2 , 50 mM NaCl, 100 μg/mL BSA and 10% glycerol (v/v) (total volume, 30 μl) at 37°C.

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. Using gel filtration through a Sepharose-4B column (Pharmacia, Sweden) the non-hybridized oligodeoxynucleotide was removed.

    Article Title: Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
    Article Snippet: ODNs were radioactively labeled at their 5′ termini by phosphoryl transfer with phosphorous-32 adenosine tri-phosphate [γ-32 P]ATP. .. Briefly, an ODN (20 nmoles) was incubated with 2 microliters (μl) T4 Polynucleotide Kinase (PNK) (10 units/μl, New England Biolabs, Ipswich, MA, USA), 8 μl [γ-32 P]ATP (10 μCi/μl), 8 μl PNK Buffer A (New England Biolabs, Ipswich, MA, USA) and 25 μl double-distilled water (ddH2 O) for 1 hour at 37°C. .. One μl of the reaction was separated by 12% denaturing polyacrylamide gel electrophoresis (PAGE) for 1 hour at 150 volts (V).

    Article Title: Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli
    Article Snippet: Obtaining the oligodeoxyribonucleotide primers labeled with 32 P at the 5’-terminus The labeled primer (3’-terminal primer for PCR) for reverse transcription was obtained using kination with PNK in the presence of [γ- 32 Р]АТР. .. PNK buffer (10µl) containing 20 pmol of the primer, 3 µl of the [γ- 32 Р]АТР (0.4 MBq/µl), and10 AU PNR, and subsequently incubated at 37 0 С for 1 h. The reaction was halted by adding 90 µl of 0.3 M NaAc (pH 5.2) with subsequent phenol deproteinization and chloroform extraction. .. Mapping the Eco16S nucleotide cross-linked to protein S7 in the EcoS7–Eco16S and the TthS7–Eco16 complexes After the irradiation, the complex was treated with proteinase K to remove protein S7.

    Article Title: Crystal structure of the Borna disease virus matrix protein (BDV-M) reveals ssRNA binding properties
    Article Snippet: Five microliters of 10× PNK buffer (New England Biolabs), 0.5 μL of RNasin (Promega), 0.5 μL of 100 mM CDP (Sigma), 5 μL of 500 nM ATP (Sigma), 17.5 μL of DEPC H2 O, 20 μL of nucleic acid isolate, 1 μL of γ[32 ]ATP (Amersham Bioscience), and 0.5 μL of PNK (New England Biolabs) were added. .. Five microliters of 10× PNK buffer (New England Biolabs), 0.5 μL of RNasin (Promega), 0.5 μL of 100 mM CDP (Sigma), 5 μL of 500 nM ATP (Sigma), 17.5 μL of DEPC H2 O, 20 μL of nucleic acid isolate, 1 μL of γ[32 ]ATP (Amersham Bioscience), and 0.5 μL of PNK (New England Biolabs) were added.

    Activity Assay:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: Primed DNA was formed by heating a 1:1 plasmid/primer mix in activity buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl) to 90° C for 5′ and cooling to RT over several hours. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: This oligodeoxynucleotide contains 15 base-pairs of non-complementary region at both 5’ and 3’ ends. .. Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. Using 0.5 μg of single-stranded circular M13mp19 (+) phage DNA and standard annealing buffer (20 mM Tris–HCl, pH 7.5, 10 mM MgCl2 , 100 mM NaCl, 1 mM DTT) the labeled oligodeoxynucleotide was annealed by heating at 95°C for 1 min, transferring immediately to 65°C for 2 min and then cooling slowly to room temperature.

    Modification:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: The DNA substrate for electrochemistry consisted of a 49:58-mer primer-template composed of three oligomers: a 20-mer with a 3′ thiol modification, a 38-mer, and a 49-mer complement; sequences are as follows (see also ): 20-mer Thiol: 5′ - GCT GTC GTA CAG CTC AAT GC - 3′ - (CH2 )2 O(CH2 )3 SH 38-mer: 5′ - TAA CAG GTT GAT GCA TCG CGC TTC GGT GCT GCG TGT CT - 3′ 49-mer: 5′ - GCA TTG AGC TGT ACG ACA GCA GAC ACG CAG CAC CGA AGC GCG ATG CAT C - 3′ The bold G of the 49-mer was changed to an A or an abasic (AP) site for CA mismatch and abasic site discrimination experiments. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Western Blot:

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: The RNAs were transferred to Zeta-probe GT membranes (BioRad) using semi-dry transfer equipment (Owl Separation Systems) for 1 h at 10 V. After electro-blotting, RNAs were fixed to the membrane by ultraviolet (UV) cross-linking for 1 min followed by baking in a vacuum oven at 80° for 1 h. The membrane was prehybridized with Ultrahyb-oligo hybridization buffer (Ambion) for 2 h at 40°. .. During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: The DNA substrate for electrochemistry consisted of a 49:58-mer primer-template composed of three oligomers: a 20-mer with a 3′ thiol modification, a 38-mer, and a 49-mer complement; sequences are as follows (see also ): 20-mer Thiol: 5′ - GCT GTC GTA CAG CTC AAT GC - 3′ - (CH2 )2 O(CH2 )3 SH 38-mer: 5′ - TAA CAG GTT GAT GCA TCG CGC TTC GGT GCT GCG TGT CT - 3′ 49-mer: 5′ - GCA TTG AGC TGT ACG ACA GCA GAC ACG CAG CAC CGA AGC GCG ATG CAT C - 3′ The bold G of the 49-mer was changed to an A or an abasic (AP) site for CA mismatch and abasic site discrimination experiments. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Hybridization:

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: The RNAs were transferred to Zeta-probe GT membranes (BioRad) using semi-dry transfer equipment (Owl Separation Systems) for 1 h at 10 V. After electro-blotting, RNAs were fixed to the membrane by ultraviolet (UV) cross-linking for 1 min followed by baking in a vacuum oven at 80° for 1 h. The membrane was prehybridized with Ultrahyb-oligo hybridization buffer (Ambion) for 2 h at 40°. .. During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences).

    Article Title: Telomerase abrogates aneuploidy-induced telomere replication stress, senescence and cell depletion
    Article Snippet: Membrane was prehybridized by rapid hybridization buffer (Amersham; RPN1635) for 1 h and incubated over night with radiolabeled telomere (TTAGGG)3 or Alu probe (5′-CGGGAAGCAGAGGTTGTAGTGAGCC). .. Reaction mixture was 1 μl telomere restriction fragment, 13.5 μl H2 O, 2 μl T4 PNK buffer, 2.5 μl 32 P-γATP and 1 μl T4-polynucleotide kinase (New England Biolabs) at 37°C.

    High Performance Liquid Chromatography:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: Primers were purchased from IDT and purified by HPLC as described above. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Gas Chromatography:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: The DNA substrate for electrochemistry consisted of a 49:58-mer primer-template composed of three oligomers: a 20-mer with a 3′ thiol modification, a 38-mer, and a 49-mer complement; sequences are as follows (see also ): 20-mer Thiol: 5′ - GCT GTC GTA CAG CTC AAT GC - 3′ - (CH2 )2 O(CH2 )3 SH 38-mer: 5′ - TAA CAG GTT GAT GCA TCG CGC TTC GGT GCT GCG TGT CT - 3′ 49-mer: 5′ - GCA TTG AGC TGT ACG ACA GCA GAC ACG CAG CAC CGA AGC GCG ATG CAT C - 3′ The bold G of the 49-mer was changed to an A or an abasic (AP) site for CA mismatch and abasic site discrimination experiments. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Transferring:

    Article Title: Manipulating Archaeal Systems to Permit Analyses of Transcription Elongation-Termination Decisions In Vitro
    Article Snippet: OmniFlex 200 μl Gel-Load pipette tips (Life Science Products). .. 10× T4 PNK buffer (We use the buffer supplied from New England Biolabs).

    Northern Blot:

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: Paragraph title: 6.2. Small RNA Northern blotting ... During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences).

    Generated:

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: The spacer2–repeat–spacer3 and repeat–spacer27–repeat RNA substrates were generated by in vitro run-off transcription using T7 RNA polymerase and internally labelled using [α-32 P] adenosine triphosphate (ATP) (5000 ci/mmol, Hartman Analytic) ( ). .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min.

    other:

    Article Title: Quality control of purified proteins involved in homologous recombination
    Article Snippet: Add 5 μl 10× PNK buffer, and 10 units (1 μl) T4 polynucleotide kinase.

    Sequencing:

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: Templates for in vitro transcription were obtained by cloning of the pre-crRNA sequences with an upstream T7 RNA polymerase promotor sequence into pUC19 vector. .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min.

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: Primed DNA was formed by heating a 1:1 plasmid/primer mix in activity buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl) to 90° C for 5′ and cooling to RT over several hours. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes. .. 2 log DNA ladder (NEB) was dephosphorylated by calf intestinal alkaline phosphatase (CIAP; 60 minutes, 37° C) prior to labeling in the same manner.

    Radioactivity:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes. .. 2 log DNA ladder (NEB) was dephosphorylated by calf intestinal alkaline phosphatase (CIAP; 60 minutes, 37° C) prior to labeling in the same manner.

    Methylation:

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences). .. During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences).

    Isolation:

    Article Title: Approaches for Studying MicroRNA and Small Interfering RNA Methylation In Vitro and In Vivo
    Article Snippet: The RNAs were transferred to Zeta-probe GT membranes (BioRad) using semi-dry transfer equipment (Owl Separation Systems) for 1 h at 10 V. After electro-blotting, RNAs were fixed to the membrane by ultraviolet (UV) cross-linking for 1 min followed by baking in a vacuum oven at 80° for 1 h. The membrane was prehybridized with Ultrahyb-oligo hybridization buffer (Ambion) for 2 h at 40°. .. During the prehybridization, a 5′ end-labeled probe was prepared as follows: 5 μl 10× T4 DNA polynucleotide kinase buffer (New England Biolabs), 5 μl T4 DNA polynucleotide kinase (New England Biolabs), 0.5 μl 100-μ M DNA oligonucleotide (antisense strand), 5 μl gamma [32 P]-ATP (6000 Ci/mmol; PerkinElmer), and 34.5 μl H2 O were mixed and incubated at 37° for 1 h. The oligonucleotide was isolated from the free [32 P]-ATP by passing the reaction mixture through a MinSpin G-25 Column (Amersham Pharmacia Biosciences). .. The membrane was hybridized with the 5′ end-labeled antisense oligonucleotide probe for approximately 20 h at 40°.

    Labeling:

    Article Title: Mechanism of HIV-1 RNA Dimerization in the Central Region of the Genome and Significance for Viral Evolution
    Article Snippet: DNA primers were labeled at the 5′ end using T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6000 Ci/mmol). .. After cooling on ice, the reaction mixture was treated with [γ-32 P]ATP (6000 Ci/mmol), 10× PNK T4 Polynucleotide Kinase Reaction buffer and T4 polynucleotide kinase (New England Biolabs).

    Article Title: Soluble expression, purification and characterization of the full length IS2 Transposase
    Article Snippet: Primer B - 5'GCTTATATGCCTGCAGGTCGAT[TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAA]GGATCCCCGTCCCGTCAAGTCAGC3'. .. A 20 μL labeling reaction contained 40 units of T4 polynucleotide kinase in 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 20 μM of the primer (upper strand) and 50 μCi of γ32 P-ATP. .. The reaction was incubated at 37°C for 30 minutes and heat-killed at 90°C for 5 minutes.

    Article Title: Identification of specific let-7 microRNA binding complexes in Caenorhabditis elegans
    Article Snippet: To monitor ribonucleoprotein complex formation in vitro, oligonucleotides were labeled at the 5′-end using T4 polynucleotide kinase and [γ-32 P]ATP. .. Reaction mixtures (25 μL) contained 1× kinase buffer (NEB, 50 mM Tris at pH 7.5, 5 mM MgCl2 ), 2.0 μM RNA, 50 μCi of [γ-32 P]ATP (3000 Ci/mmol, NEN), and 25 units of T4 polynucleotide kinase.

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: This oligodeoxynucleotide contains 15 base-pairs of non-complementary region at both 5’ and 3’ ends. .. Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. Using 0.5 μg of single-stranded circular M13mp19 (+) phage DNA and standard annealing buffer (20 mM Tris–HCl, pH 7.5, 10 mM MgCl2 , 100 mM NaCl, 1 mM DTT) the labeled oligodeoxynucleotide was annealed by heating at 95°C for 1 min, transferring immediately to 65°C for 2 min and then cooling slowly to room temperature.

    Article Title: Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
    Article Snippet: Paragraph title: Radioactive Labeling and Purification of Oligonucleotides ... Briefly, an ODN (20 nmoles) was incubated with 2 microliters (μl) T4 Polynucleotide Kinase (PNK) (10 units/μl, New England Biolabs, Ipswich, MA, USA), 8 μl [γ-32 P]ATP (10 μCi/μl), 8 μl PNK Buffer A (New England Biolabs, Ipswich, MA, USA) and 25 μl double-distilled water (ddH2 O) for 1 hour at 37°C.

    Article Title: Coordinated DNA dynamics during the human telomerase catalytic cycle
    Article Snippet: 10 pmol probe oligo was 5′ 32 P labeled using 10 μL γ32 P-ATP (PerkinElmer BLU002Z250UC). .. The reaction was carried out in 1 x PNK Buffer (NEB) at a total volume of 20 μL with 10 U of PNK (NEB).

    Article Title: Crystal structure of the Borna disease virus matrix protein (BDV-M) reveals ssRNA binding properties
    Article Snippet: Paragraph title: Radioactive Labeling and RNase Digestion. ... Five microliters of 10× PNK buffer (New England Biolabs), 0.5 μL of RNasin (Promega), 0.5 μL of 100 mM CDP (Sigma), 5 μL of 500 nM ATP (Sigma), 17.5 μL of DEPC H2 O, 20 μL of nucleic acid isolate, 1 μL of γ[32 ]ATP (Amersham Bioscience), and 0.5 μL of PNK (New England Biolabs) were added.

    Article Title: Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases
    Article Snippet: Oligonucleotides were labeled either at the 5’ terminus with [γ-32 P]ATP and T4 polynucleotide kinase (New England Biolabs), or at the 3' terminus with [α-32 P] cordycepin-5-triphosphate and terminal transferase (New England Biolabs) according to standard protocols. .. The substrates were prepared by annealing the 32 P-labeled oligonucleotide with a two-fold excess of the unlabeled oligonucleotide in a PNK buffer (New England Biolabs).

    Purification:

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Total RNA extraction was performed using TRIzol reagent. .. Purified RNA samples were dephosphorylated in a 15 μl reaction containing 1× T4 polynucleotide kinase buffer, 10 U SUPERase_In, and 20 U T4 polynucleotide kinase (NEB). .. Dephosphorylation was carried out for 1 h at 37 °C, and the enzyme was then heat inactivated for 20 min at 65 °C.

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: Primers were purchased from IDT and purified by HPLC as described above. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Size-selected fragments were purified by ethanol precipitation and dissolved in 10 μl of 10 mM Tris-HCl (pH 8.0). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB).

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. Using gel filtration through a Sepharose-4B column (Pharmacia, Sweden) the non-hybridized oligodeoxynucleotide was removed.

    Article Title: Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
    Article Snippet: Paragraph title: Radioactive Labeling and Purification of Oligonucleotides ... Briefly, an ODN (20 nmoles) was incubated with 2 microliters (μl) T4 Polynucleotide Kinase (PNK) (10 units/μl, New England Biolabs, Ipswich, MA, USA), 8 μl [γ-32 P]ATP (10 μCi/μl), 8 μl PNK Buffer A (New England Biolabs, Ipswich, MA, USA) and 25 μl double-distilled water (ddH2 O) for 1 hour at 37°C.

    Article Title: Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases
    Article Snippet: The substrates were prepared by annealing the 32 P-labeled oligonucleotide with a two-fold excess of the unlabeled oligonucleotide in a PNK buffer (New England Biolabs). .. The substrates and component oligonucleotides are listed in . λDNA/HindIII fragments (Bacteriophage λ DNA-HindIII Digest, New England Biolabs) were labeled at the 3’ ends with [α-32 P]dATP and Klenow fragment of DNA polymerase I (New England Biolabs) in NEBuffer 2.

    Dot Blot:

    Article Title: Telomerase abrogates aneuploidy-induced telomere replication stress, senescence and cell depletion
    Article Snippet: Paragraph title: Dot blot ... Reaction mixture was 1 μl telomere restriction fragment, 13.5 μl H2 O, 2 μl T4 PNK buffer, 2.5 μl 32 P-γATP and 1 μl T4-polynucleotide kinase (New England Biolabs) at 37°C.

    Article Title: Coordinated DNA dynamics during the human telomerase catalytic cycle
    Article Snippet: Paragraph title: Preparation of Dot Blot Oligo Probe ... The reaction was carried out in 1 x PNK Buffer (NEB) at a total volume of 20 μL with 10 U of PNK (NEB).

    Selection:

    Article Title: Structure of HIV‐1 reverse transcriptase bound to a novel 38‐mer hairpin template‐primer DNA aptamer
    Article Snippet: Paragraph title: Aptamer design and selection: End‐labeling of 38NT2,4‐methyl aptamer with T4 polynucleotide kinase (PNK) ... Aptamers (synthesized without 5′ phosphate) were 5′ 32 P end‐labeled in a 50‐µL volume containing 10 pmole of aptamer, 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 10 U of T4 PNK enzyme, and 10 µL of (γ‐32 P) ATP (3000 Ci mmol−1 , 10 µCi µL−1 ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour. .. The reaction mixture (10 μl) containing the 32 P-labeled helicase substrate (1000 cpm/10 μl) in appropriate buffer (20 mM Tris–HCl, pH 8.0, 8 mM DTT, 1.0 mM MgCl2 , 20 mM KCl and 16 μg/ml BSA), and the purified protein OsSUV3 was incubated at 37°C for 60 min.

    Staining:

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Purified RNA samples were dephosphorylated in a 15 μl reaction containing 1× T4 polynucleotide kinase buffer, 10 U SUPERase_In, and 20 U T4 polynucleotide kinase (NEB). .. Purified RNA samples were dephosphorylated in a 15 μl reaction containing 1× T4 polynucleotide kinase buffer, 10 U SUPERase_In, and 20 U T4 polynucleotide kinase (NEB).

    cDNA Library Assay:

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Paragraph title: cDNA library construction of RPF ... Purified RNA samples were dephosphorylated in a 15 μl reaction containing 1× T4 polynucleotide kinase buffer, 10 U SUPERase_In, and 20 U T4 polynucleotide kinase (NEB).

    Activated Clotting Time Assay:

    Article Title: 5-Formylcytosine mediated DNA–protein cross-links block DNA replication and induce mutations in human cells
    Article Snippet: Synthetic DNA 12-mers (500 pmol, 5′-AAC GTC GTG ACT-3′) were radiolabelled by incubating with γ-32 P ATP (1 μl, PerkinElmer Life Sciences, Boston, MA) and T4 PNK (20 units) in 20 μl 1 × T4 PNK buffer (New England Biolabs, Beverly, MA, USA) at 37°C for 1 h. The enzyme was deactivated by heating at 65°C for 10 min, and excess γ-32 P ATP was removed using Microspin G25 columns (GE Healthcare, Pittsburgh, PA, USA). .. To digest the protein component of DPCs, primer–template complexes containing histone H4-5fC cross-link (2 pmol) were incubated with proteinase K (2.4 units) at 37°C for 48 h in the presence of 1× T4 PNK buffer (New England Biolabs, Beverly, MA, USA).

    Plasmid Preparation:

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: Templates for in vitro transcription were obtained by cloning of the pre-crRNA sequences with an upstream T7 RNA polymerase promotor sequence into pUC19 vector. .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min. .. The RNAs were separated by denaturing PAGE (8 M urea; 1× TBE; 10% polyacrylamide), and afterwards respective bands were cut out using sterile scalpels in reference to brief autoradiographic exposure.

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: Primed DNA was formed by heating a 1:1 plasmid/primer mix in activity buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl) to 90° C for 5′ and cooling to RT over several hours. .. The M13mp18 DNA primer had the following sequence (complementary to positions 6265-6235): 5′ - GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC G - 3′ Primers were radiolabeled by incubating 10 pmol of 31-mer M13mp18 primer with T4 polynucleotide kinase (PNK) and [γ-32 P] ATP (Perkin Elmer) in T4 buffer (NEB) for 15 minutes at 37° C. Reactions were stopped by addition of EDTA to 10 mM and heating at 75° C for 10 minutes.

    Article Title: Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases
    Article Snippet: The substrates were prepared by annealing the 32 P-labeled oligonucleotide with a two-fold excess of the unlabeled oligonucleotide in a PNK buffer (New England Biolabs). .. The substrates and component oligonucleotides are listed in . λDNA/HindIII fragments (Bacteriophage λ DNA-HindIII Digest, New England Biolabs) were labeled at the 3’ ends with [α-32 P]dATP and Klenow fragment of DNA polymerase I (New England Biolabs) in NEBuffer 2.

    Helicase Assay:

    Article Title: Rice SUV3 is a bidirectional helicase that binds both DNA and RNA
    Article Snippet: Paragraph title: Preparation of DNA helicase substrate and helicase assay ... Using T4 polynucleotide kinase (PNK) (5U) (New England Biolabs) in the standard PNK buffer (New England Biolabs) and 1.85 MBq of [γ-32 P] ATP (specific activity 222 TBq/mmol)10 ng of the oligodeoxynucleotide was labeled at 5′-end at 37°C for one hour.

    In Vitro:

    Article Title: Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis
    Article Snippet: Templates for in vitro transcription were obtained by cloning of the pre-crRNA sequences with an upstream T7 RNA polymerase promotor sequence into pUC19 vector. .. After linearization of the plasmid with HindIII, in vitro transcription was performed in a final volume of 20 μl [40 mM HEPES–KOH (pH8.0); 22 mM MgCl2 ; 5 mM DTT; 1 mM spermidine; 4 mM UTP, CTP, GTP and 2 mM ATP; 20 U RNase Inhibitor; 1 µg T7 RNA polymerase; 1 μg linearized plasmid] at 37°C for 1 h. End labelling of synthesized RNA was done in a 20 µl reaction volume: 10 µl of the RNA was labelled using 2 µl T4 Polynucleotide Kinase (PNK) buffer (New England Biolabs (NEB)) and 25 U T4 PNK (Ambion) at 37°C for 30 min. .. The RNAs were separated by denaturing PAGE (8 M urea; 1× TBE; 10% polyacrylamide), and afterwards respective bands were cut out using sterile scalpels in reference to brief autoradiographic exposure.

    Article Title: Identification of specific let-7 microRNA binding complexes in Caenorhabditis elegans
    Article Snippet: To monitor ribonucleoprotein complex formation in vitro, oligonucleotides were labeled at the 5′-end using T4 polynucleotide kinase and [γ-32 P]ATP. .. Reaction mixtures (25 μL) contained 1× kinase buffer (NEB, 50 mM Tris at pH 7.5, 5 mM MgCl2 ), 2.0 μM RNA, 50 μCi of [γ-32 P]ATP (3000 Ci/mmol, NEN), and 25 units of T4 polynucleotide kinase.

    Article Title: Manipulating Archaeal Systems to Permit Analyses of Transcription Elongation-Termination Decisions In Vitro
    Article Snippet: Paragraph title: 2.3 In Vitro Transcription ... 10× T4 PNK buffer (We use the buffer supplied from New England Biolabs).

    Ethanol Precipitation:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Size-selected fragments were purified by ethanol precipitation and dissolved in 10 μl of 10 mM Tris-HCl (pH 8.0). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB).

    Article Title: Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases
    Article Snippet: The substrates were prepared by annealing the 32 P-labeled oligonucleotide with a two-fold excess of the unlabeled oligonucleotide in a PNK buffer (New England Biolabs). .. The substrates and component oligonucleotides are listed in . λDNA/HindIII fragments (Bacteriophage λ DNA-HindIII Digest, New England Biolabs) were labeled at the 3’ ends with [α-32 P]dATP and Klenow fragment of DNA polymerase I (New England Biolabs) in NEBuffer 2.

    End Labeling:

    Article Title: Structure of HIV‐1 reverse transcriptase bound to a novel 38‐mer hairpin template‐primer DNA aptamer
    Article Snippet: Paragraph title: Aptamer design and selection: End‐labeling of 38NT2,4‐methyl aptamer with T4 polynucleotide kinase (PNK) ... Aptamers (synthesized without 5′ phosphate) were 5′ 32 P end‐labeled in a 50‐µL volume containing 10 pmole of aptamer, 1X T4 polynucleotide kinase reaction buffer (New England Biolabs), 10 U of T4 PNK enzyme, and 10 µL of (γ‐32 P) ATP (3000 Ci mmol−1 , 10 µCi µL−1 ).

    Gel Extraction:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: RNA fragments between 26 and 32 bp were size-selected and eluted in 400 μl of RNA gel extraction buffer (300 mM sodium acetate (pH 5.5), 1 mM EDTA and 0.25% (w/v) SDS). .. The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 pnk buffer
    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the   Materials and Methods . Error bars indicate SD.
    T4 Pnk Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 pnk buffer/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    t4 pnk buffer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs t4 polynucleotide kinase pnk buffer
    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the   Materials and Methods . Error bars indicate SD.
    T4 Polynucleotide Kinase Pnk Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase pnk buffer/product/New England Biolabs
    Average 98 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase pnk buffer - by Bioz Stars, 2019-12
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 polynucleotide kinase
    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the   Materials and Methods . Error bars indicate SD.
    T4 Polynucleotide Kinase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 817 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/New England Biolabs
    Average 99 stars, based on 817 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the   Materials and Methods . Error bars indicate SD.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    doi: 10.1016/j.omtn.2017.07.008

    Figure Lengend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Article Snippet: The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad.

    Techniques: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing