Structured Review

Boehringer Mannheim polymerase
Polymerase, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase/product/Boehringer Mannheim
Average 92 stars, based on 9 article reviews
Price from $9.99 to $1999.99
polymerase - by Bioz Stars, 2020-12
92/100 stars

Images

Related Articles

Amplification:

Article Title: Type 1 Fimbriation and Phase Switching in a Natural Escherichia coli fimB Null Strain, Nissle 1917
Article Snippet: .. Amplification was done for 20 to 25 cycles as follows: hot start without polymerase at 94°C for 3 min; primary denaturation at 94°C for 30 s to 1 min; primer annealing at 50°C for 30 s to 1 min; and primer extension at 72°C for 30 s to 3 min. Each reaction was carried out with 50 pmol of each primer and 2 U of polymerase ( Taq [Pharmacia] for switch orientation assay; Expand High Fidelity [Boehringer Mannheim Biochemicals] for plasmid construction). .. Samples (1 μl) of chromosomal DNA were amplified with primers situated on either site of the phase switch.

Article Title: Identification, Molecular Cloning, and Evaluation of Potential Use of Isocitrate Dehydrogenase II of Mycobacterium bovis BCG in Serodiagnosis of Tuberculosis
Article Snippet: .. Amplification reaction mixtures consisted of 20 ng of DNA, 5 μl of 10× Expand buffer (Boehringer Mannheim), 1.5 mM MgCl2 , 200 μM deoxynucleoside triphosphates, each primer (primers UPPER24 and LOWER25) at a concentration of 0.1 μM, and 3.5 U of polymerase (Expand High Fidelity PCR System; Boehringer Mannheim) in a final volume of 50 μl. ..

Article Title: CD44 Occupancy Prevents Macrophage Multinucleation
Article Snippet: .. PCR amplification of this region was performed with a sense (5′TTACAGTTGAGCGAATTCCAGCAGCAGATCGATTTGAA; nt 158–195), and an antisense primer (5′AGGTCTCCTCGCCTCGAGAGAAGTTGTGGTCACTCC; nt 878–913), using rat macrophage cDNA as template (made from total RNA) and PWO as polymerase ( Boehringer Mannheim , Mannheim, Germany). .. The primers were designed to allow digestion of the resulting PCR fragment with EcoR1 and Xho1 by means of which it was ligated in frame into an EcoR1-Xho1 cut pGEX-4T-1 vector.

Polymerase Chain Reaction:

Article Title: Infectious Molecular Clones with the Nonhomologous Dimer Initiation Sequences Found in Different Subtypes of Human Immunodeficiency Virus Type 1 Can Recombine and Initiate a Spreading Infection In Vitro
Article Snippet: .. The PCR mixture contained 250 nM primers Rec1 and Rec2, 350 μM deoxynucleoside triphosphate, 1.75 mM MgCl2 , 50 mM Tris-HCl (pH 9.2), 16 mM (NH4 )2 SO4 , and 3.5 U of polymerase (Boehringer Mannheim). ..

Article Title: Differential Changes in Heat Shock Protein-, Lipoarabinomannan-, and Purified Protein Derivative-Specific Immunoglobulin G1 and G2 Isotype Responses during Bovine Mycobacterium avium subsp. paratuberculosis Infection
Article Snippet: .. PCR with these primers was done on a part of an M. avium subsp. paratuberculosis genomic library (a kind gift of M. Sharp and K. Stevenson, Moredun Research Institute, Moredun, Scotland) using a proofreading polymerase (Expand High Fidelity PCR System; Boehringer, Mannheim, Germany) according to the instructions of the manufacturer. .. Subsequently, the PCR product was cloned in the reading frame of the pTrcHis expression vector (Invitrogen), and this plasmid was used to transform E.coli Top 10 bacteria.

Article Title: Identification, Molecular Cloning, and Evaluation of Potential Use of Isocitrate Dehydrogenase II of Mycobacterium bovis BCG in Serodiagnosis of Tuberculosis
Article Snippet: .. Amplification reaction mixtures consisted of 20 ng of DNA, 5 μl of 10× Expand buffer (Boehringer Mannheim), 1.5 mM MgCl2 , 200 μM deoxynucleoside triphosphates, each primer (primers UPPER24 and LOWER25) at a concentration of 0.1 μM, and 3.5 U of polymerase (Expand High Fidelity PCR System; Boehringer Mannheim) in a final volume of 50 μl. ..

Article Title: CD44 Occupancy Prevents Macrophage Multinucleation
Article Snippet: .. PCR amplification of this region was performed with a sense (5′TTACAGTTGAGCGAATTCCAGCAGCAGATCGATTTGAA; nt 158–195), and an antisense primer (5′AGGTCTCCTCGCCTCGAGAGAAGTTGTGGTCACTCC; nt 878–913), using rat macrophage cDNA as template (made from total RNA) and PWO as polymerase ( Boehringer Mannheim , Mannheim, Germany). .. The primers were designed to allow digestion of the resulting PCR fragment with EcoR1 and Xho1 by means of which it was ligated in frame into an EcoR1-Xho1 cut pGEX-4T-1 vector.

Reverse Transcription Polymerase Chain Reaction:

Article Title: A C. elegans patched gene, ptc-1, functions in germ-line cytokinesis
Article Snippet: .. Overlapping ptc-1 cDNA fragments were prepared by RT–PCR using Superscript RNaseH(−) reverse transcriptase (Life Technologies) and Expand polymerase (Boehringer-Mannheim), and blunt-end-cloned into the Eco RV site of pBluescript KSII(+). cDNA sequencing was performed on an ABI 377 sequencer. .. The deletion breakpoint of ptc-1(nr2029) was obtained by amplifying DNA prepared from ptc-1(nr2029) homozygotes with the primers ptc1 (5′-CATACCGGAAGTCTGCTTTCG) and ptc1R2 (5′-CGGAAACATTGCTGCCAATAACTG), and sequencing the product with the ptc1 primer.

Concentration Assay:

Article Title: Identification, Molecular Cloning, and Evaluation of Potential Use of Isocitrate Dehydrogenase II of Mycobacterium bovis BCG in Serodiagnosis of Tuberculosis
Article Snippet: .. Amplification reaction mixtures consisted of 20 ng of DNA, 5 μl of 10× Expand buffer (Boehringer Mannheim), 1.5 mM MgCl2 , 200 μM deoxynucleoside triphosphates, each primer (primers UPPER24 and LOWER25) at a concentration of 0.1 μM, and 3.5 U of polymerase (Expand High Fidelity PCR System; Boehringer Mannheim) in a final volume of 50 μl. ..

Sequencing:

Article Title: A C. elegans patched gene, ptc-1, functions in germ-line cytokinesis
Article Snippet: .. Overlapping ptc-1 cDNA fragments were prepared by RT–PCR using Superscript RNaseH(−) reverse transcriptase (Life Technologies) and Expand polymerase (Boehringer-Mannheim), and blunt-end-cloned into the Eco RV site of pBluescript KSII(+). cDNA sequencing was performed on an ABI 377 sequencer. .. The deletion breakpoint of ptc-1(nr2029) was obtained by amplifying DNA prepared from ptc-1(nr2029) homozygotes with the primers ptc1 (5′-CATACCGGAAGTCTGCTTTCG) and ptc1R2 (5′-CGGAAACATTGCTGCCAATAACTG), and sequencing the product with the ptc1 primer.

Plasmid Preparation:

Article Title: Type 1 Fimbriation and Phase Switching in a Natural Escherichia coli fimB Null Strain, Nissle 1917
Article Snippet: .. Amplification was done for 20 to 25 cycles as follows: hot start without polymerase at 94°C for 3 min; primary denaturation at 94°C for 30 s to 1 min; primer annealing at 50°C for 30 s to 1 min; and primer extension at 72°C for 30 s to 3 min. Each reaction was carried out with 50 pmol of each primer and 2 U of polymerase ( Taq [Pharmacia] for switch orientation assay; Expand High Fidelity [Boehringer Mannheim Biochemicals] for plasmid construction). .. Samples (1 μl) of chromosomal DNA were amplified with primers situated on either site of the phase switch.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Boehringer Mannheim rna polymerase ii inhibition
    <t>RAE1's</t> association with the NE requires <t>RNA</t> polymerase II activity. (A–H) Images of HtTA cells stained for RAE1 or NUP98 after treatment with RNA polymerase inhibitors. RAE1-stained cells treated with (A) 0 μg/ml AMD for 1 h, (B) 0.04 μg/ml AMD for 1 h, (C) 5.0 μg/ml AMD for 1 h, (D) 50 μg/ml DRB for 1 h, (E) 50 μg/ml DRB for 1 h and cultured 6 h in the absence of DRB, and (F) 50 μg/ml DRB for 1 h, cultured 6 h without DRB, and finally treated again with 50 μg/ml DRB for 1 h. Images shown are representative for results obtained from three independent experiments. (G and H) Respective nontreated and 5.0 μg/ml AMD–treated HtTA cells stained with NUP98-specific antibodies. Note that NUP98 levels at the NE are not dependent on RNA polymerase II activity. (I and J) Effect of AMD treatment on HtTA cells that moderately express HA1-RAE1.
    Rna Polymerase Ii Inhibition, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 80/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna polymerase ii inhibition/product/Boehringer Mannheim
    Average 80 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rna polymerase ii inhibition - by Bioz Stars, 2020-12
    80/100 stars
      Buy from Supplier

    85
    Boehringer Mannheim e coli rna polymerase rnap
    Selected circular DNA motifs engender <t>RNA</t> synthesis in vitro with E. coli <t>RNAP.</t> ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).
    E Coli Rna Polymerase Rnap, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli rna polymerase rnap/product/Boehringer Mannheim
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli rna polymerase rnap - by Bioz Stars, 2020-12
    85/100 stars
      Buy from Supplier

    90
    Boehringer Mannheim tth dna polymerase
    The analysis of <t>DNA</t> product synthesized by <t>Tth</t> and Δ Tth DNA polymerases by restriction enzymes. The DNA product synthesized in the standard reaction mixture at 74°C for 30 min by Tth or Δ Tth DNA polymerase in the presence of 1 µg/ml of the indicated oligoDNA (third line) was electrophoresed on an agarose gel under non-denaturing conditions before (lanes 1, 3, 5 and 7) or after (lanes 2, 4, 6 and 8) treatment with 1 U/ml of the restriction enzyme indicated at the bottom. The size markers are shown in kb on the left. The recognition sequence of the restriction enzyme is shown below each enzyme.
    Tth Dna Polymerase, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tth dna polymerase/product/Boehringer Mannheim
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    tth dna polymerase - by Bioz Stars, 2020-12
    90/100 stars
      Buy from Supplier

    89
    Boehringer Mannheim e coli rna polymerase holoenzyme
    Selected circular <t>DNA</t> motifs engender <t>RNA</t> synthesis in vitro with E. coli RNAP. ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).
    E Coli Rna Polymerase Holoenzyme, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli rna polymerase holoenzyme/product/Boehringer Mannheim
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli rna polymerase holoenzyme - by Bioz Stars, 2020-12
    89/100 stars
      Buy from Supplier

    Image Search Results


    RAE1's association with the NE requires RNA polymerase II activity. (A–H) Images of HtTA cells stained for RAE1 or NUP98 after treatment with RNA polymerase inhibitors. RAE1-stained cells treated with (A) 0 μg/ml AMD for 1 h, (B) 0.04 μg/ml AMD for 1 h, (C) 5.0 μg/ml AMD for 1 h, (D) 50 μg/ml DRB for 1 h, (E) 50 μg/ml DRB for 1 h and cultured 6 h in the absence of DRB, and (F) 50 μg/ml DRB for 1 h, cultured 6 h without DRB, and finally treated again with 50 μg/ml DRB for 1 h. Images shown are representative for results obtained from three independent experiments. (G and H) Respective nontreated and 5.0 μg/ml AMD–treated HtTA cells stained with NUP98-specific antibodies. Note that NUP98 levels at the NE are not dependent on RNA polymerase II activity. (I and J) Effect of AMD treatment on HtTA cells that moderately express HA1-RAE1.

    Journal: The Journal of Cell Biology

    Article Title: RAE1 Is a Shuttling mRNA Export Factor That Binds to a GLEBS-like NUP98 Motif at the Nuclear Pore Complex through Multiple Domains

    doi:

    Figure Lengend Snippet: RAE1's association with the NE requires RNA polymerase II activity. (A–H) Images of HtTA cells stained for RAE1 or NUP98 after treatment with RNA polymerase inhibitors. RAE1-stained cells treated with (A) 0 μg/ml AMD for 1 h, (B) 0.04 μg/ml AMD for 1 h, (C) 5.0 μg/ml AMD for 1 h, (D) 50 μg/ml DRB for 1 h, (E) 50 μg/ml DRB for 1 h and cultured 6 h in the absence of DRB, and (F) 50 μg/ml DRB for 1 h, cultured 6 h without DRB, and finally treated again with 50 μg/ml DRB for 1 h. Images shown are representative for results obtained from three independent experiments. (G and H) Respective nontreated and 5.0 μg/ml AMD–treated HtTA cells stained with NUP98-specific antibodies. Note that NUP98 levels at the NE are not dependent on RNA polymerase II activity. (I and J) Effect of AMD treatment on HtTA cells that moderately express HA1-RAE1.

    Article Snippet: To study the effect of the RNA–polymerase II inhibition on the RAE1 distribution in HtTA cells, the culture medium was supplemented with 0.04 or 5.0 μg/ml actinomycin D (AMD; Boehringer Mannheim Biochemicals ), or 50 μg/ml DRB (Fluka Chemical Corp.).

    Techniques: Activity Assay, Staining, Cell Culture

    Overexpression of the GLEBS-like motif of NUP98 results in accumulation of poly(A) + RNA in the nucleus. (A–J′, inclusive) Paired confocal images from HtTA cells that are transiently expressing HA1-NUP98 mutants. These cells were double stained for HA1-tagged protein by immunohistochemistry using the 12CA5 monoclonal antibody (left) and for poly(A) + RNA by in situ hybridization using a FITC-labeled oligo-(dT) 50 mer (right). The identity of the HA1-tagged NUP98 mutants is indicated as the left of each pair. The poly(A) + RNA accumulation in B′ appears more robust than that in C′, which represents a photographic rather than a real difference. The arrow in F′ points to one of the sites of preferred poly(A) + RNA localization (also reported by Huang et al., 1994 ). K and L Show poly(A) + distribution in HtTA cells overexpressing mouse RAE1 protein and, at the same time, HA1-NUP98(150–224) or HA1-NUP98(181–224). Each row of three images shows the same field of cells stained for either HA1-tagged protein (left), ectopically expressed mouse RAE1 and native human RAE1 (middle), and poly(A) + RNA (right). Note that mouse RAE1 overexpression restores proper mRNA export in cells expressing various forms of the GLEBS-like motif. The combined anti–HA1/poly(A) + staining procedure does not allow extensive blocking of nonspecific 12CA5 antibody binding. Therefore, nontransfected cells display higher levels of background staining than those shown in Fig. 7 .

    Journal: The Journal of Cell Biology

    Article Title: RAE1 Is a Shuttling mRNA Export Factor That Binds to a GLEBS-like NUP98 Motif at the Nuclear Pore Complex through Multiple Domains

    doi:

    Figure Lengend Snippet: Overexpression of the GLEBS-like motif of NUP98 results in accumulation of poly(A) + RNA in the nucleus. (A–J′, inclusive) Paired confocal images from HtTA cells that are transiently expressing HA1-NUP98 mutants. These cells were double stained for HA1-tagged protein by immunohistochemistry using the 12CA5 monoclonal antibody (left) and for poly(A) + RNA by in situ hybridization using a FITC-labeled oligo-(dT) 50 mer (right). The identity of the HA1-tagged NUP98 mutants is indicated as the left of each pair. The poly(A) + RNA accumulation in B′ appears more robust than that in C′, which represents a photographic rather than a real difference. The arrow in F′ points to one of the sites of preferred poly(A) + RNA localization (also reported by Huang et al., 1994 ). K and L Show poly(A) + distribution in HtTA cells overexpressing mouse RAE1 protein and, at the same time, HA1-NUP98(150–224) or HA1-NUP98(181–224). Each row of three images shows the same field of cells stained for either HA1-tagged protein (left), ectopically expressed mouse RAE1 and native human RAE1 (middle), and poly(A) + RNA (right). Note that mouse RAE1 overexpression restores proper mRNA export in cells expressing various forms of the GLEBS-like motif. The combined anti–HA1/poly(A) + staining procedure does not allow extensive blocking of nonspecific 12CA5 antibody binding. Therefore, nontransfected cells display higher levels of background staining than those shown in Fig. 7 .

    Article Snippet: To study the effect of the RNA–polymerase II inhibition on the RAE1 distribution in HtTA cells, the culture medium was supplemented with 0.04 or 5.0 μg/ml actinomycin D (AMD; Boehringer Mannheim Biochemicals ), or 50 μg/ml DRB (Fluka Chemical Corp.).

    Techniques: Over Expression, Expressing, Staining, Immunohistochemistry, RNA In Situ Hybridization, Labeling, Blocking Assay, Binding Assay

    Poly(A) + RNA is not a cofactor in the binding reaction between RAE1 and the GLEBS-like motif of NUP98 in vitro. (A) Pull-down assay performed with GST-NUP98(150– 224) fusion protein purified from E . coli and [ 35 S]-methionine– labeled in vitro–translated HA1-RAE1 pretreated with or without Micrococcal nuclease. GST alone did not pull-down HA1-RAE1 (not shown). (B) As in A, but pretreated with or without RNase A. GST alone did not pull-down HA1-RAE1 (not shown). (C) Pull-down assay with GST-NUP98(150–224) and in vitro–translated HA1-RAE1 in the presence of various concentrations of poly(A) + RNA isolated from HtTA cells. GST alone does not pull-down HA1-RAE1, as indicated in lane 6.

    Journal: The Journal of Cell Biology

    Article Title: RAE1 Is a Shuttling mRNA Export Factor That Binds to a GLEBS-like NUP98 Motif at the Nuclear Pore Complex through Multiple Domains

    doi:

    Figure Lengend Snippet: Poly(A) + RNA is not a cofactor in the binding reaction between RAE1 and the GLEBS-like motif of NUP98 in vitro. (A) Pull-down assay performed with GST-NUP98(150– 224) fusion protein purified from E . coli and [ 35 S]-methionine– labeled in vitro–translated HA1-RAE1 pretreated with or without Micrococcal nuclease. GST alone did not pull-down HA1-RAE1 (not shown). (B) As in A, but pretreated with or without RNase A. GST alone did not pull-down HA1-RAE1 (not shown). (C) Pull-down assay with GST-NUP98(150–224) and in vitro–translated HA1-RAE1 in the presence of various concentrations of poly(A) + RNA isolated from HtTA cells. GST alone does not pull-down HA1-RAE1, as indicated in lane 6.

    Article Snippet: To study the effect of the RNA–polymerase II inhibition on the RAE1 distribution in HtTA cells, the culture medium was supplemented with 0.04 or 5.0 μg/ml actinomycin D (AMD; Boehringer Mannheim Biochemicals ), or 50 μg/ml DRB (Fluka Chemical Corp.).

    Techniques: Binding Assay, In Vitro, Pull Down Assay, Purification, Labeling, Isolation

    A GLEBS-like motif within NUP98 is necessary and sufficient for interaction with human RAE1. (A) Schematic of the NUP98 structure. Vertical bars indicate FG (phenylalanine-glycine) repeats; HA1, hemagglutinin tag; NRM, nucleoporin RNA-binding motif (shaded box); Nup116p homology region (gray box). (B) [ 35 S]-methionine–labeled proteins immunoprecipitated with monoclonal antibody 12CA5 from HtTA cells transiently expressing an HA1-tagged version of NUP98, separated by SDS-PAGE (8% polyacrylamide) and visualized by autoradiography. A molecular weight standard is indicated at right. (C) Western blot analysis (8% polyacrylamide) of the 40-kD protein coimmunoprecipitated with HA1-NUP98 transiently expressed in HtTA cells (lanes 2 and 4). Nontransfected cells served as a negative control (lanes 1 and 3). The blots were first incubated with 12CA5 antibody (lanes 1 and 2), and then with affinity-purified anti–mouse RAE1 antibodies (lanes 3 and 4). The position of human RAE1 is indicated with an arrow. Molecular weight standards are indicated at left. (D) Western blot analysis (8% polyacrylamide) of proteins coimmunoprecipitated from HtTA lysates with anti–RAE1 (left) or anti–NUP98 antibodies (right). The antibodies used to visualize NU P98 or RAE1 proteins are indicated above the lanes. Molecular weight standards are indicated to the left. (E) Structure of NUP98 mutants used to define the GLEBS-like motif. The various NUP98 motifs are as indicated in A. (F) Western blot analysis (7% polyacrylamide) of proteins precipitated with 12CA5 antibody from HtTA cells transiently transfected with HA1-NUP98 or HA1-NUP98Δ(192–221). Molecular weight standards are indicated at left. (G) As in F for a set of HA1-tagged GLEBS-like motif mutants. Immunoprecipitated proteins were split in two equal portions, half was run through a 15% polyacrylamide gel to verify proper expression of HA1-tagged mutant peptides (top), and half on an 8% polyacrylamide gel to determine coimmunoprecipitation of RAE1. Because HA1-NUP98(150–186) protein (lane 3, top) was expressed at a lower level than the other HA1-tagged mutants, we also collected longer exposures of the RAE1 immunoblot (bottom); however, we were still unable to detect a RAE1-specific signal in lane 3. With the transfection protocol applied, levels of HA1-NUP98(150–224) were consistently higher than those of HA1-NUP98(181–224), which causes the difference in intensity of RAE1 signals in lanes 2 and 4. Molecular weight standards for each gel are indicated at left.

    Journal: The Journal of Cell Biology

    Article Title: RAE1 Is a Shuttling mRNA Export Factor That Binds to a GLEBS-like NUP98 Motif at the Nuclear Pore Complex through Multiple Domains

    doi:

    Figure Lengend Snippet: A GLEBS-like motif within NUP98 is necessary and sufficient for interaction with human RAE1. (A) Schematic of the NUP98 structure. Vertical bars indicate FG (phenylalanine-glycine) repeats; HA1, hemagglutinin tag; NRM, nucleoporin RNA-binding motif (shaded box); Nup116p homology region (gray box). (B) [ 35 S]-methionine–labeled proteins immunoprecipitated with monoclonal antibody 12CA5 from HtTA cells transiently expressing an HA1-tagged version of NUP98, separated by SDS-PAGE (8% polyacrylamide) and visualized by autoradiography. A molecular weight standard is indicated at right. (C) Western blot analysis (8% polyacrylamide) of the 40-kD protein coimmunoprecipitated with HA1-NUP98 transiently expressed in HtTA cells (lanes 2 and 4). Nontransfected cells served as a negative control (lanes 1 and 3). The blots were first incubated with 12CA5 antibody (lanes 1 and 2), and then with affinity-purified anti–mouse RAE1 antibodies (lanes 3 and 4). The position of human RAE1 is indicated with an arrow. Molecular weight standards are indicated at left. (D) Western blot analysis (8% polyacrylamide) of proteins coimmunoprecipitated from HtTA lysates with anti–RAE1 (left) or anti–NUP98 antibodies (right). The antibodies used to visualize NU P98 or RAE1 proteins are indicated above the lanes. Molecular weight standards are indicated to the left. (E) Structure of NUP98 mutants used to define the GLEBS-like motif. The various NUP98 motifs are as indicated in A. (F) Western blot analysis (7% polyacrylamide) of proteins precipitated with 12CA5 antibody from HtTA cells transiently transfected with HA1-NUP98 or HA1-NUP98Δ(192–221). Molecular weight standards are indicated at left. (G) As in F for a set of HA1-tagged GLEBS-like motif mutants. Immunoprecipitated proteins were split in two equal portions, half was run through a 15% polyacrylamide gel to verify proper expression of HA1-tagged mutant peptides (top), and half on an 8% polyacrylamide gel to determine coimmunoprecipitation of RAE1. Because HA1-NUP98(150–186) protein (lane 3, top) was expressed at a lower level than the other HA1-tagged mutants, we also collected longer exposures of the RAE1 immunoblot (bottom); however, we were still unable to detect a RAE1-specific signal in lane 3. With the transfection protocol applied, levels of HA1-NUP98(150–224) were consistently higher than those of HA1-NUP98(181–224), which causes the difference in intensity of RAE1 signals in lanes 2 and 4. Molecular weight standards for each gel are indicated at left.

    Article Snippet: To study the effect of the RNA–polymerase II inhibition on the RAE1 distribution in HtTA cells, the culture medium was supplemented with 0.04 or 5.0 μg/ml actinomycin D (AMD; Boehringer Mannheim Biochemicals ), or 50 μg/ml DRB (Fluka Chemical Corp.).

    Techniques: RNA Binding Assay, Labeling, Immunoprecipitation, Expressing, SDS Page, Autoradiography, Molecular Weight, Western Blot, Negative Control, Incubation, Affinity Purification, Transfection, Mutagenesis

    Selected circular DNA motifs engender RNA synthesis in vitro with E. coli RNAP. ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Efficient bacterial transcription of DNA nanocircle vectors with optimized single-stranded promoters

    doi: 10.1073/pnas.012589099

    Figure Lengend Snippet: Selected circular DNA motifs engender RNA synthesis in vitro with E. coli RNAP. ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).

    Article Snippet: All RCT reactions were done under condition as indicated above by using E. coli RNA polymerase (RNAP) (Boehringer Mannheim) with 0.2 μM circular ssDNA templates.

    Techniques: In Vitro

    The analysis of DNA product synthesized by Tth and Δ Tth DNA polymerases by restriction enzymes. The DNA product synthesized in the standard reaction mixture at 74°C for 30 min by Tth or Δ Tth DNA polymerase in the presence of 1 µg/ml of the indicated oligoDNA (third line) was electrophoresed on an agarose gel under non-denaturing conditions before (lanes 1, 3, 5 and 7) or after (lanes 2, 4, 6 and 8) treatment with 1 U/ml of the restriction enzyme indicated at the bottom. The size markers are shown in kb on the left. The recognition sequence of the restriction enzyme is shown below each enzyme.

    Journal: Nucleic Acids Research

    Article Title: Elongation of repetitive DNA by DNA polymerase from a hyperthermophilic bacterium Thermus thermophilus

    doi:

    Figure Lengend Snippet: The analysis of DNA product synthesized by Tth and Δ Tth DNA polymerases by restriction enzymes. The DNA product synthesized in the standard reaction mixture at 74°C for 30 min by Tth or Δ Tth DNA polymerase in the presence of 1 µg/ml of the indicated oligoDNA (third line) was electrophoresed on an agarose gel under non-denaturing conditions before (lanes 1, 3, 5 and 7) or after (lanes 2, 4, 6 and 8) treatment with 1 U/ml of the restriction enzyme indicated at the bottom. The size markers are shown in kb on the left. The recognition sequence of the restriction enzyme is shown below each enzyme.

    Article Snippet: The amount of DNA synthesized was 12 pmol by Tth DNA polymerase and < 1 pmol by Δ Tth DNA polymerase, a mutant Tth DNA polymerase lacking 5′→3′ exonuclease activity , when no oligoDNA was added to the reaction mixture (Table ).

    Techniques: Synthesized, Agarose Gel Electrophoresis, Sequencing

    Selected circular DNA motifs engender RNA synthesis in vitro with E. coli RNAP. ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Efficient bacterial transcription of DNA nanocircle vectors with optimized single-stranded promoters

    doi: 10.1073/pnas.012589099

    Figure Lengend Snippet: Selected circular DNA motifs engender RNA synthesis in vitro with E. coli RNAP. ( A ) Autoradiogram of denaturing 10% polyacrylamide gel showing in vitro transcription of the 103-nt initial library, a control 63-nt nanocircle lacking the randomized domain, and selected individual nanocircles E1, E15, and E38 (after 1.5 h). ( B ) The relative total RNA amounts (all lengths > 80 nt) for the 103-nt initial library, 63-nt nanocircle lacking the randomized domain, and E1, E15, and E38. ( C ) Time course of the production of monomeric ribozyme for the 103-nt initial library (■), 63-nt nanocircle lacking the randomized domain (○), E1 (▴), and E15 (●).

    Article Snippet: Conditions for initial RCT reaction were: 1 μM circular DNA, 2 units E. coli RNA polymerase holoenzyme (Boehringer Mannheim), 0.5 mM ATP, CTP, and GTP, 60 μM UTP, and 0.30 μCi (1 Ci = 37 GBq) of [α-32 P]UTP in 25 mM Tris⋅HCl (pH 8.1) buffer containing 20 mM NaCl, 15 mM MgCl2 , 0.4 mM spermine⋅HCl, 100 μg/ml acetylated BSA, 10 mM DTT, and 12.5 units/ml RNase inhibitor (Promega), in a total reaction volume of 15 μl.

    Techniques: In Vitro