pcr plate  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    iQ SYBR Green Supermix
    Description:
    2 5 ml 2 x 1 25 ml 2x qPCR mix contains dNTPs iTaq DNA polymerase MgCl2 SYBR Green I enhancers stabilizers fluorescein for 100 x 50 µl reactions education use only
    Catalog Number:
    1708880EDU
    Price:
    None
    Category:
    PCR Instrumentation
    Buy from Supplier


    Structured Review

    Bio-Rad pcr plate
    iQ SYBR Green Supermix
    2 5 ml 2 x 1 25 ml 2x qPCR mix contains dNTPs iTaq DNA polymerase MgCl2 SYBR Green I enhancers stabilizers fluorescein for 100 x 50 µl reactions education use only
    https://www.bioz.com/result/pcr plate/product/Bio-Rad
    Average 92 stars, based on 5644 article reviews
    Price from $9.99 to $1999.99
    pcr plate - by Bioz Stars, 2020-08
    92/100 stars

    Images

    1) Product Images from "Miniaturisation of high-throughput plasmid DNA library preparation for next-generation sequencing using multifactorial optimisation"

    Article Title: Miniaturisation of high-throughput plasmid DNA library preparation for next-generation sequencing using multifactorial optimisation

    Journal: Synthetic and Systems Biotechnology

    doi: 10.1016/j.synbio.2019.01.002

    High-throughput workflow for the preparation of plasmid DNA libraries for NGS. Plasmid DNA samples are isolated from bacteria cells using a high-throughput plasmid isolation method on the CyBio ® FeliX robot. All steps performed using the FeliX platform are highlighted with a grey outline. The isolated plasmid samples are tested for the presence of genomic DNA (gDNA), prior to library preparation, using the Labcyte Echo ® . All steps performed using the Labcyte Echo ® are highlighted with a shaded grey box. If samples are free from gDNA, they are diluted to 0.4 ng/μl in H 2 O. If gDNA is detected, the samples are sonicated prior to re-testing in the gDNA QC assay. Using reagents from the Nextera XT kit, a tagmentation reaction is performed on all samples under the optimised conditions, followed by neutralization of the reaction. Unique combinations of index primers are added to all samples via 12 PCR cycles, followed by magnetic bead purification of the PCR products. The concentration of the purified dsDNA is then determined using the PicoGreen ® reagent assay and the libraries are pooled to give a final concentration of 4–10 nM, in a minimum volume of 15 μl. The average fragment size of the pooled libraries is measured using the Fragment Analyzer before being sequenced on the Illumina ® MiSeq system.
    Figure Legend Snippet: High-throughput workflow for the preparation of plasmid DNA libraries for NGS. Plasmid DNA samples are isolated from bacteria cells using a high-throughput plasmid isolation method on the CyBio ® FeliX robot. All steps performed using the FeliX platform are highlighted with a grey outline. The isolated plasmid samples are tested for the presence of genomic DNA (gDNA), prior to library preparation, using the Labcyte Echo ® . All steps performed using the Labcyte Echo ® are highlighted with a shaded grey box. If samples are free from gDNA, they are diluted to 0.4 ng/μl in H 2 O. If gDNA is detected, the samples are sonicated prior to re-testing in the gDNA QC assay. Using reagents from the Nextera XT kit, a tagmentation reaction is performed on all samples under the optimised conditions, followed by neutralization of the reaction. Unique combinations of index primers are added to all samples via 12 PCR cycles, followed by magnetic bead purification of the PCR products. The concentration of the purified dsDNA is then determined using the PicoGreen ® reagent assay and the libraries are pooled to give a final concentration of 4–10 nM, in a minimum volume of 15 μl. The average fragment size of the pooled libraries is measured using the Fragment Analyzer before being sequenced on the Illumina ® MiSeq system.

    Techniques Used: High Throughput Screening Assay, Plasmid Preparation, Next-Generation Sequencing, Isolation, Sonication, Neutralization, Polymerase Chain Reaction, Purification, Concentration Assay

    2) Product Images from "Complexes of Oligoribonucleotides with d-Mannitol Modulate the Innate Immune Response to Influenza A Virus H1N1 (A/FM/1/47) In Vivo"

    Article Title: Complexes of Oligoribonucleotides with d-Mannitol Modulate the Innate Immune Response to Influenza A Virus H1N1 (A/FM/1/47) In Vivo

    Journal: Pharmaceuticals

    doi: 10.3390/ph11030073

    Impaired up-regulation of the cytokines ifnε , ifnk , ifna2 , ifnb1 , and ifnγ induced by the influenza virus A/Fort Monmouth/1/1947-mouse adapted (H1N1) owing to the ORNs- d -М in vivo. Before and after infection with the influenza virus FM147 (4.0 lg LD 50 ), the BALB/c mice were treated with the ORNs- d -М. Total RNAs from the mice lungs were isolated and RT-qPCR was performed. The investigated mRNA levels were normalized to gapdh as a control. RUE: relative units of expression. ORNs- d -М control—ORNs- d -М injection into healthy mice, influenza control—infection of mice with influenza virus, ORNs- d -М + influenza—ORNs- d -М injection 24 h before influenza virus infection as prevention with ORNs- d -М, and influenza + ORNs- d -М—ORNs- d -М injection 24 h after influenza virus infection as treatment with ORNs- d -М. Data are shown as the mean ± SD for three independent experiments.
    Figure Legend Snippet: Impaired up-regulation of the cytokines ifnε , ifnk , ifna2 , ifnb1 , and ifnγ induced by the influenza virus A/Fort Monmouth/1/1947-mouse adapted (H1N1) owing to the ORNs- d -М in vivo. Before and after infection with the influenza virus FM147 (4.0 lg LD 50 ), the BALB/c mice were treated with the ORNs- d -М. Total RNAs from the mice lungs were isolated and RT-qPCR was performed. The investigated mRNA levels were normalized to gapdh as a control. RUE: relative units of expression. ORNs- d -М control—ORNs- d -М injection into healthy mice, influenza control—infection of mice with influenza virus, ORNs- d -М + influenza—ORNs- d -М injection 24 h before influenza virus infection as prevention with ORNs- d -М, and influenza + ORNs- d -М—ORNs- d -М injection 24 h after influenza virus infection as treatment with ORNs- d -М. Data are shown as the mean ± SD for three independent experiments.

    Techniques Used: In Vivo, Infection, Mouse Assay, Isolation, Quantitative RT-PCR, Expressing, Injection

    3) Product Images from "Human Adipose-Derived Stromal/Stem Cells Induce Functional CD4+CD25+FoxP3+CD127− Regulatory T Cells Under Low Oxygen Culture Conditions"

    Article Title: Human Adipose-Derived Stromal/Stem Cells Induce Functional CD4+CD25+FoxP3+CD127− Regulatory T Cells Under Low Oxygen Culture Conditions

    Journal: Stem Cells and Development

    doi: 10.1089/scd.2013.0152

    FoxP3 and transforming growth factor beta (TGF-β) gene expression in T cells following coculture with ASCs. IFN-γ-treated ASCs were cocultured with naive CD4 + T cells for 3 days under low or ambient O 2 culture conditions at ratios of 1:10 (10,000 ASCs:100,000 T cells) and 1:1 (100,000 ASCs:100,000 T cells). T cells were collected, RNA was isolated, and one-step quantitative real-time polymerase chain reaction (qRT-PCR) was performed following coculture of ASCs with T cells using forward and reverse primers and probes for human (a) FoxP3 and (b) TGF-β. Three independent sets of experiments were performed for each treatment. Data are reported as mean (μ)±SE. *** P
    Figure Legend Snippet: FoxP3 and transforming growth factor beta (TGF-β) gene expression in T cells following coculture with ASCs. IFN-γ-treated ASCs were cocultured with naive CD4 + T cells for 3 days under low or ambient O 2 culture conditions at ratios of 1:10 (10,000 ASCs:100,000 T cells) and 1:1 (100,000 ASCs:100,000 T cells). T cells were collected, RNA was isolated, and one-step quantitative real-time polymerase chain reaction (qRT-PCR) was performed following coculture of ASCs with T cells using forward and reverse primers and probes for human (a) FoxP3 and (b) TGF-β. Three independent sets of experiments were performed for each treatment. Data are reported as mean (μ)±SE. *** P

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    4) Product Images from "Two Dynamin-2 Genes Are Required for Normal Zebrafish Development"

    Article Title: Two Dynamin-2 Genes Are Required for Normal Zebrafish Development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0055888

    Human DNM2 RNA rescues dnm2 and dnm2-like morphant phenotypes. Rescue of dnm2 and dnm2-like morphants at 2 dpf. (A) Co-injection of human DNM2 RNA can rescue morphological abnormalities in both morphants. (B) RT-PCR of human DNM2 expression in dnm2 or dnm2-like morphants at 3 dpf. (C) The percentage of normal appearing larvae is significantly increased in both dnm2 and dnm2-like rescue conditions, but not in control larvae ( dnm2 p
    Figure Legend Snippet: Human DNM2 RNA rescues dnm2 and dnm2-like morphant phenotypes. Rescue of dnm2 and dnm2-like morphants at 2 dpf. (A) Co-injection of human DNM2 RNA can rescue morphological abnormalities in both morphants. (B) RT-PCR of human DNM2 expression in dnm2 or dnm2-like morphants at 3 dpf. (C) The percentage of normal appearing larvae is significantly increased in both dnm2 and dnm2-like rescue conditions, but not in control larvae ( dnm2 p

    Techniques Used: Injection, Reverse Transcription Polymerase Chain Reaction, Expressing

    5) Product Images from "NeuroD1 regulation of migration accompanies the differential sensitivity of neuroendocrine carcinomas to TrkB inhibition"

    Article Title: NeuroD1 regulation of migration accompanies the differential sensitivity of neuroendocrine carcinomas to TrkB inhibition

    Journal: Oncogenesis

    doi: 10.1038/oncsis.2013.24

    NeuroD1 and TrkB regulates viability and migration of prostate and melanoma. ( a ) NeuroD1 was transiently knocked down in melanoma or prostate in 96-well formats. Cells were assayed for viability using Cell-Titer Blue. Graph represents fold mean±s.d. of three independent experiments in triplicate (** P
    Figure Legend Snippet: NeuroD1 and TrkB regulates viability and migration of prostate and melanoma. ( a ) NeuroD1 was transiently knocked down in melanoma or prostate in 96-well formats. Cells were assayed for viability using Cell-Titer Blue. Graph represents fold mean±s.d. of three independent experiments in triplicate (** P

    Techniques Used: Migration

    Working model. Model of NeuroD1 induction and mechanism of action in neuroendocrine and non-neuroendocrine cancers.
    Figure Legend Snippet: Working model. Model of NeuroD1 induction and mechanism of action in neuroendocrine and non-neuroendocrine cancers.

    Techniques Used:

    NeuroD1 is expressed in aggressive neuroendocrine lung cancers. ( a ) Expression of NeuroD1 mRNA compared across diverse normal ( N =3879; black dots) and malignant tissues ( N =1605; red dots) using the Affymetrix HGU133 Plus v2 GeneChip. ( b , d ) Melanoma and prostate cancer cell lines were lysed, and 25 μg total protein was loaded and then immunoblotted for NeuroD1, TrkB, NCAM, synaptophysin and tubulin or GAPDH (as loading controls). Melanoma cell lines were loaded by increasing pigmentation. ( c ) Lung cancer cell lines were lysed and 25 μg of total protein was immunoblotted for synaptophysin and tubulin (as loading controls).
    Figure Legend Snippet: NeuroD1 is expressed in aggressive neuroendocrine lung cancers. ( a ) Expression of NeuroD1 mRNA compared across diverse normal ( N =3879; black dots) and malignant tissues ( N =1605; red dots) using the Affymetrix HGU133 Plus v2 GeneChip. ( b , d ) Melanoma and prostate cancer cell lines were lysed, and 25 μg total protein was loaded and then immunoblotted for NeuroD1, TrkB, NCAM, synaptophysin and tubulin or GAPDH (as loading controls). Melanoma cell lines were loaded by increasing pigmentation. ( c ) Lung cancer cell lines were lysed and 25 μg of total protein was immunoblotted for synaptophysin and tubulin (as loading controls).

    Techniques Used: Expressing

    Loss of p53 is permissive for expression of NeuroD1. ( a ) NeuroD1, p53 and GAPDH (loading control) were immunoblotted in lysates of HBEC3KT, HBEC3KT53 and Clone 5. ( b ) qRT–PCR analysis of NeuroD1 in Clone 5 cells transfected as indicated. A representative p53 immunoblot is shown from one of three independent experiments. ( c ) HBEC3KT53 and Clone 5 were transfected with pGL3-NeuroD1-luciferase with and without p53. p53 was immunoblotted and luciferase activity was measured; one of six experiments shown. ( d ) Melanoma, prostate and lung cancer cell lines were lysed; 50 μg total protein was immunoblotted for p53, NeuroD1 and GAPDH (as loading control). The dashed line indicates discontinuity in gel. The asterisk represents a loss-of-function mutation in p53. 43 ( e ) Cell lines with loss of or mutation in p53 were transfected with control vector or vector encoding p53. Cells were lysed and immunoblotted for p53. Overexpression was quantified using Odyssey software.
    Figure Legend Snippet: Loss of p53 is permissive for expression of NeuroD1. ( a ) NeuroD1, p53 and GAPDH (loading control) were immunoblotted in lysates of HBEC3KT, HBEC3KT53 and Clone 5. ( b ) qRT–PCR analysis of NeuroD1 in Clone 5 cells transfected as indicated. A representative p53 immunoblot is shown from one of three independent experiments. ( c ) HBEC3KT53 and Clone 5 were transfected with pGL3-NeuroD1-luciferase with and without p53. p53 was immunoblotted and luciferase activity was measured; one of six experiments shown. ( d ) Melanoma, prostate and lung cancer cell lines were lysed; 50 μg total protein was immunoblotted for p53, NeuroD1 and GAPDH (as loading control). The dashed line indicates discontinuity in gel. The asterisk represents a loss-of-function mutation in p53. 43 ( e ) Cell lines with loss of or mutation in p53 were transfected with control vector or vector encoding p53. Cells were lysed and immunoblotted for p53. Overexpression was quantified using Odyssey software.

    Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Luciferase, Activity Assay, Mutagenesis, Plasmid Preparation, Over Expression, Software

    6) Product Images from "Repeated Sense of Hunger Leads to the Development of Visceral Obesity and Metabolic Syndrome in a Mouse Model"

    Article Title: Repeated Sense of Hunger Leads to the Development of Visceral Obesity and Metabolic Syndrome in a Mouse Model

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0098276

    Gene expression levels in the liver. The mRNA levels of sterol regulatory element-binding protein-1c (SREBP-1c), fatty acid synthase (FAS), proliferator-activated receptor gamma (PPARγ), stearoyl-CoA desaturase-1 (SCD-1), proliferator-activated receptor alpha (PPARα) and AMP-activated protein kinase (AMPK) were determined using qRT-PCR. Data are expressed as means ± SD (n = 10, fold change relative to the AL group). * p
    Figure Legend Snippet: Gene expression levels in the liver. The mRNA levels of sterol regulatory element-binding protein-1c (SREBP-1c), fatty acid synthase (FAS), proliferator-activated receptor gamma (PPARγ), stearoyl-CoA desaturase-1 (SCD-1), proliferator-activated receptor alpha (PPARα) and AMP-activated protein kinase (AMPK) were determined using qRT-PCR. Data are expressed as means ± SD (n = 10, fold change relative to the AL group). * p

    Techniques Used: Expressing, Binding Assay, Quantitative RT-PCR

    7) Product Images from "Telomere length measurement by a novel monochrome multiplex quantitative PCR method"

    Article Title: Telomere length measurement by a novel monochrome multiplex quantitative PCR method

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn1027

    MMQPCR of 20 ng of each of three reference human DNA samples previously shown to have long telomeres (orange curves), middle-length telomeres (green curves) or short telomeres (blue curves). No template control amplification curves are in black. Top panel: semi-log plot and bottom panel: linear plot. Here, special care was taken to input essentially identical amounts of DNA into the reactions (based on OD 260 UV spectrophotometer readings), so that the differences in C t observed at 74°C would reflect only differences in telomere length (without influence from variation in the amounts of input DNA). (In normal practice, there is no need to precisely match experimental samples for input DNA, since the procedure of normalizing the T signal to the S signal addresses this issue. A wide range of input DNA amounts are acceptable, as long as both T and S signals fall within the range of the T and S standard curves; see Figure 4.) The nearly perfect overlap of the three amplification curves acquired at 88°C is expected, since only the single copy gene (albumin gene) signal is collected at this temperature. The bottom panel shows that the cycle thresholds for the telomere signals can be collected at 74°C when the albumin signal is still at baseline. (We have confirmed, in reactions without the telomere primers, that the single copy gene signal rises above baseline at essentially the same cycle number whether collected at 74°C or 88°C. Also, we have confirmed, in reactions without the single copy gene primers, that the telomere amplification signal is completely flat and at zero throughout the PCR run when read at 88°C, as would be expected based on the melting profiles shown in Figure 2.) Since the Bio-Rad MyiQ software can display only one temperature's amplification curves at a time, here we have superimposed the displays for the 74°C and 88°C reads.
    Figure Legend Snippet: MMQPCR of 20 ng of each of three reference human DNA samples previously shown to have long telomeres (orange curves), middle-length telomeres (green curves) or short telomeres (blue curves). No template control amplification curves are in black. Top panel: semi-log plot and bottom panel: linear plot. Here, special care was taken to input essentially identical amounts of DNA into the reactions (based on OD 260 UV spectrophotometer readings), so that the differences in C t observed at 74°C would reflect only differences in telomere length (without influence from variation in the amounts of input DNA). (In normal practice, there is no need to precisely match experimental samples for input DNA, since the procedure of normalizing the T signal to the S signal addresses this issue. A wide range of input DNA amounts are acceptable, as long as both T and S signals fall within the range of the T and S standard curves; see Figure 4.) The nearly perfect overlap of the three amplification curves acquired at 88°C is expected, since only the single copy gene (albumin gene) signal is collected at this temperature. The bottom panel shows that the cycle thresholds for the telomere signals can be collected at 74°C when the albumin signal is still at baseline. (We have confirmed, in reactions without the telomere primers, that the single copy gene signal rises above baseline at essentially the same cycle number whether collected at 74°C or 88°C. Also, we have confirmed, in reactions without the single copy gene primers, that the telomere amplification signal is completely flat and at zero throughout the PCR run when read at 88°C, as would be expected based on the melting profiles shown in Figure 2.) Since the Bio-Rad MyiQ software can display only one temperature's amplification curves at a time, here we have superimposed the displays for the 74°C and 88°C reads.

    Techniques Used: Amplification, Spectrophotometry, Polymerase Chain Reaction, Software

    Reproducibility of relative T/S ratios in independent runs of the MMQPCR assay. The same 95 DNA samples assayed in Figure 5 were assayed again the next day, taking care that the specific MyiQ PCR machine and reaction well positions occupied by each DNA sample were different from the previous day. The linear regression equation and correlation coefficient were determined using Microsoft Excel.
    Figure Legend Snippet: Reproducibility of relative T/S ratios in independent runs of the MMQPCR assay. The same 95 DNA samples assayed in Figure 5 were assayed again the next day, taking care that the specific MyiQ PCR machine and reaction well positions occupied by each DNA sample were different from the previous day. The linear regression equation and correlation coefficient were determined using Microsoft Excel.

    Techniques Used: Polymerase Chain Reaction

    8) Product Images from "Rapid Treponema pallidum Clearance from Blood and Ulcer Samples following Single Dose Benzathine Penicillin Treatment of Early Syphilis"

    Article Title: Rapid Treponema pallidum Clearance from Blood and Ulcer Samples following Single Dose Benzathine Penicillin Treatment of Early Syphilis

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0003492

    A patient presenting with a DGM positive penile ulcer (primary syphilis) was administered a 2.4 megaunit dose of benzathine penicillin at time zero. Ulcer samples for T. pallidum DNA and RNA quantification were collected pre-treatment and then four hourly for 56 hours. Panel A . presents DNA ( tpp047 ) decay and Panel B . shows 16S rRNA decay.
    Figure Legend Snippet: A patient presenting with a DGM positive penile ulcer (primary syphilis) was administered a 2.4 megaunit dose of benzathine penicillin at time zero. Ulcer samples for T. pallidum DNA and RNA quantification were collected pre-treatment and then four hourly for 56 hours. Panel A . presents DNA ( tpp047 ) decay and Panel B . shows 16S rRNA decay.

    Techniques Used:

    9) Product Images from "Epigenetic regulation of cathepsin L expression in chronic myeloid leukaemia"

    Article Title: Epigenetic regulation of cathepsin L expression in chronic myeloid leukaemia

    Journal: Journal of Cellular and Molecular Medicine

    doi: 10.1111/j.1582-4934.2010.01203.x

    Expression of VEGF and cystatin C in CML. (A) Relative abundance of VEGF mRNA in CML patients and controls. (a) Signifi-cantly higher compared to CML AP/BC; (b) significantly higher compared to PCs; (c) significantly higher compared to NC ( P ≤ 0.001, Mann-Whitney U -test). (B) Correlation of VEGF with CTSL mRNA in the CML cohort. (Pearson correlation analysis) (C) Increase in CTSL activity by exogenous VEGF. PBMCs isolated from CML CP and NCs were seeded (80% confluent) in six-well plates followed by serum starvation for 12 hrs. Then 40 ng/ml of recombinant VEGF 165 was added to these cells in fresh serum free RPMI 1640 containing 0.1% bovine serum albumin. After 48 hrs of VEGF treatment, cells were lysed and CTSL activity in the lysates was measured as described in ‘Materials and methods’. PBMCs treated with PBS were processed identically and served as controls. Values presented are mean ± S.E. from four independent estimations. Results were analysed by Student’s t-test and values significantly different from respective controls have been marked by ‘a’. (D) Relative abundance of cystatin C mRNA in CML patients and controls; (a) significantly lower compared to PCs; (b) significantly lower compared to NC ( P ≤ 0.001, Mann-Whitney U -test). (E) Correlation of cystatin C mRNA with CTSL activity in the CML cohort (Pearson correlation analysis).
    Figure Legend Snippet: Expression of VEGF and cystatin C in CML. (A) Relative abundance of VEGF mRNA in CML patients and controls. (a) Signifi-cantly higher compared to CML AP/BC; (b) significantly higher compared to PCs; (c) significantly higher compared to NC ( P ≤ 0.001, Mann-Whitney U -test). (B) Correlation of VEGF with CTSL mRNA in the CML cohort. (Pearson correlation analysis) (C) Increase in CTSL activity by exogenous VEGF. PBMCs isolated from CML CP and NCs were seeded (80% confluent) in six-well plates followed by serum starvation for 12 hrs. Then 40 ng/ml of recombinant VEGF 165 was added to these cells in fresh serum free RPMI 1640 containing 0.1% bovine serum albumin. After 48 hrs of VEGF treatment, cells were lysed and CTSL activity in the lysates was measured as described in ‘Materials and methods’. PBMCs treated with PBS were processed identically and served as controls. Values presented are mean ± S.E. from four independent estimations. Results were analysed by Student’s t-test and values significantly different from respective controls have been marked by ‘a’. (D) Relative abundance of cystatin C mRNA in CML patients and controls; (a) significantly lower compared to PCs; (b) significantly lower compared to NC ( P ≤ 0.001, Mann-Whitney U -test). (E) Correlation of cystatin C mRNA with CTSL activity in the CML cohort (Pearson correlation analysis).

    Techniques Used: Expressing, MANN-WHITNEY, Activity Assay, Isolation, Recombinant

    Quantitative analysis of CTSL in 5′-aza-cytidine treated K562 cells. (A) Effect of demethylating agent 5′-aza-cytidine on mRNA levels of CTSL and cystatin C. Total cellular RNA isolated from K562 cells grown in the presence of 5′-aza-cytidine for different time periods was reverse transcribed and subjected to PCR using primers specific for CTSL, cystatin C or 18S RNA. The amplified products were resolved on 1.2% agarose gel and visualized under UV after staining with ethidium bromide. (B) K562 cells were grown in the presence or absence of 5′-aza-cytidine for different time periods. Cell lysates containing equal amount of protein were immuno-blotted for CTSL protein using monoclonal antibodies against it. Immuno-blotting for α-tubulin served as loading control. Lane 1: Vehicle treated K562 cells at 72 hrs; lane 2: vehicle treated K562 cells at 0 hrs; lane 3: 5′-aza-cytidine treated K562 cells at 72 hrs; lane 4: 5′-aza-cytidine treated K562 cells at 48 hrs; lane 5: 5′-aza-cytidine treated K562 cells at 24 hrs; lane 6: 5′-aza-cytidine treated K562 cells at 12 hrs; lane 7: untreated K562 cells. (C) Total RNA isolated from untreated K562 cells or after treatment with 5 μM 5′-aza-cytidine for 72 hrs was reverse transcribed and subjected to real-time PCR using amplimers specific for CTSL mRNA. a – significantly higher compared to untreated K562 cells ( P ≤ 0.05, Student’s test). (D) Cell lysates were prepared from untreated or 5 μM 5′-aza-cytidine treated K562 cells. CTSL-specific assay was performed with equal amount of total protein. a – significantly higher compared to untreated K562 cells ( P ≤ 0.05, Student’s test). (E) 5′-aza-cytidine treatment increases CTSL expression in CML AP/BC. A total of 3 × 10 7 PBMCs isolated from CML AP/BC patients were plated in each well of a six-well dish and treated with 5 μM 5′-aza-cytidine or vehicle control. After 72 hrs the PBMCs were lysed and CTSL in the cell lysate was assessed by Western blotting and compared with its expression in untreated PBMCs isolated from CML CP patients. Immuno-blotting for α-tubulin served as loading control.
    Figure Legend Snippet: Quantitative analysis of CTSL in 5′-aza-cytidine treated K562 cells. (A) Effect of demethylating agent 5′-aza-cytidine on mRNA levels of CTSL and cystatin C. Total cellular RNA isolated from K562 cells grown in the presence of 5′-aza-cytidine for different time periods was reverse transcribed and subjected to PCR using primers specific for CTSL, cystatin C or 18S RNA. The amplified products were resolved on 1.2% agarose gel and visualized under UV after staining with ethidium bromide. (B) K562 cells were grown in the presence or absence of 5′-aza-cytidine for different time periods. Cell lysates containing equal amount of protein were immuno-blotted for CTSL protein using monoclonal antibodies against it. Immuno-blotting for α-tubulin served as loading control. Lane 1: Vehicle treated K562 cells at 72 hrs; lane 2: vehicle treated K562 cells at 0 hrs; lane 3: 5′-aza-cytidine treated K562 cells at 72 hrs; lane 4: 5′-aza-cytidine treated K562 cells at 48 hrs; lane 5: 5′-aza-cytidine treated K562 cells at 24 hrs; lane 6: 5′-aza-cytidine treated K562 cells at 12 hrs; lane 7: untreated K562 cells. (C) Total RNA isolated from untreated K562 cells or after treatment with 5 μM 5′-aza-cytidine for 72 hrs was reverse transcribed and subjected to real-time PCR using amplimers specific for CTSL mRNA. a – significantly higher compared to untreated K562 cells ( P ≤ 0.05, Student’s test). (D) Cell lysates were prepared from untreated or 5 μM 5′-aza-cytidine treated K562 cells. CTSL-specific assay was performed with equal amount of total protein. a – significantly higher compared to untreated K562 cells ( P ≤ 0.05, Student’s test). (E) 5′-aza-cytidine treatment increases CTSL expression in CML AP/BC. A total of 3 × 10 7 PBMCs isolated from CML AP/BC patients were plated in each well of a six-well dish and treated with 5 μM 5′-aza-cytidine or vehicle control. After 72 hrs the PBMCs were lysed and CTSL in the cell lysate was assessed by Western blotting and compared with its expression in untreated PBMCs isolated from CML CP patients. Immuno-blotting for α-tubulin served as loading control.

    Techniques Used: Isolation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Real-time Polymerase Chain Reaction, Expressing, Western Blot

    10) Product Images from "NaoXinTong Inhibits the Development of Diabetic Retinopathy in db/db Mice"

    Article Title: NaoXinTong Inhibits the Development of Diabetic Retinopathy in db/db Mice

    Journal: Evidence-based Complementary and Alternative Medicine : eCAM

    doi: 10.1155/2015/242517

    NXT inhibits diabetes-induced CAS-3 expression. (a) The frozen sections of mouse eyeballs from each group were prepared and CAS-3 protein expression was determined by immunofluorescent staining as described in Section 2 . Bars: 50 μ m. (b) CAS-3 mRNA expression in the retinas was determined by real time RT-PCR analysis. (c) TNF- α , MMP-2 and MMP-9 mRNA expression in the retinas was determined by real time RT-PCR analysis. ∗ P
    Figure Legend Snippet: NXT inhibits diabetes-induced CAS-3 expression. (a) The frozen sections of mouse eyeballs from each group were prepared and CAS-3 protein expression was determined by immunofluorescent staining as described in Section 2 . Bars: 50 μ m. (b) CAS-3 mRNA expression in the retinas was determined by real time RT-PCR analysis. (c) TNF- α , MMP-2 and MMP-9 mRNA expression in the retinas was determined by real time RT-PCR analysis. ∗ P

    Techniques Used: Expressing, Staining, Quantitative RT-PCR

    11) Product Images from "Dynamic metabolic reprogramming in dendritic cells: an early response to influenza infection that is essential for effector function"

    Article Title: Dynamic metabolic reprogramming in dendritic cells: an early response to influenza infection that is essential for effector function

    Journal: bioRxiv

    doi: 10.1101/2020.01.14.906826

    Unsupervised multivariant principal component analysis (PCA) of Tip DC and volcano plot of transcripts. At zero or nine days following intranasal infection of mice with IAV at (EID50: 2000) the lungs were homogenized and cells extracted. Cells were antibody stained for TipDC surface markers CD11b, Ly6c, GR-1, and MHCII. TipDC controls (Ctl) from day 0 were sorted based on high levels of CD11b, Ly6c, and GR-1. TipDC from day 9 of the IAV infection (IAV) were sorted based on high levels of CD11b, Ly6c, GR-1, and MHCII. cDNA libraries were generated from RNA, sequenced, and narrowed to confidentially identified transcripts. (A) Unsupervised multivariant principal component analysis (PCA) resulting in F1 and F2 with a cumulative percent variability of 78.56% Each circle represents a TipDC transcriptome, the open circles are control and the solid black IAV. (B) Differential expression differences were determined using Tukey HSD test for multiple comparisons with a Benjamini-Hochberg post-hoc false discover rate correction. 6642 transcripts were removed with nonspecific filtering to remove transcripts that were not modulated by IAV (i.e. 50% standard deviation threshold). Log10 p- values are plotted against the Log2 ratio
    Figure Legend Snippet: Unsupervised multivariant principal component analysis (PCA) of Tip DC and volcano plot of transcripts. At zero or nine days following intranasal infection of mice with IAV at (EID50: 2000) the lungs were homogenized and cells extracted. Cells were antibody stained for TipDC surface markers CD11b, Ly6c, GR-1, and MHCII. TipDC controls (Ctl) from day 0 were sorted based on high levels of CD11b, Ly6c, and GR-1. TipDC from day 9 of the IAV infection (IAV) were sorted based on high levels of CD11b, Ly6c, GR-1, and MHCII. cDNA libraries were generated from RNA, sequenced, and narrowed to confidentially identified transcripts. (A) Unsupervised multivariant principal component analysis (PCA) resulting in F1 and F2 with a cumulative percent variability of 78.56% Each circle represents a TipDC transcriptome, the open circles are control and the solid black IAV. (B) Differential expression differences were determined using Tukey HSD test for multiple comparisons with a Benjamini-Hochberg post-hoc false discover rate correction. 6642 transcripts were removed with nonspecific filtering to remove transcripts that were not modulated by IAV (i.e. 50% standard deviation threshold). Log10 p- values are plotted against the Log2 ratio

    Techniques Used: Infection, Mouse Assay, Staining, Generated, Expressing, Standard Deviation

    TipDC reprogram metabolism after accumulating in the lungs of IAV infected mice. At zero or nine days following intranasal infection of mice with IAV (PR8) lungs were homogenized and cells extracted. Cells were antibody stained for TipDC surface markers CD11b, Ly6c, GR-1, and MHCII. TipDC controls (Ctl) from day 0 were sorted based on high levels of CD11b, Ly6c, and GR-1. TipDC from day 9 of the IAV infection (IAV) were sorted based on high levels of CD11b, Ly6c, GR-1, and MHCII. cDNA libraries were generated from RNA and sequenced. (A) Confidentially identified transcripts were k-means clustered followed by ascendant hierarchical clustering and genes with standard deviation threshold
    Figure Legend Snippet: TipDC reprogram metabolism after accumulating in the lungs of IAV infected mice. At zero or nine days following intranasal infection of mice with IAV (PR8) lungs were homogenized and cells extracted. Cells were antibody stained for TipDC surface markers CD11b, Ly6c, GR-1, and MHCII. TipDC controls (Ctl) from day 0 were sorted based on high levels of CD11b, Ly6c, and GR-1. TipDC from day 9 of the IAV infection (IAV) were sorted based on high levels of CD11b, Ly6c, GR-1, and MHCII. cDNA libraries were generated from RNA and sequenced. (A) Confidentially identified transcripts were k-means clustered followed by ascendant hierarchical clustering and genes with standard deviation threshold

    Techniques Used: Infection, Mouse Assay, Staining, Generated, Standard Deviation

    12) Product Images from "RNase L amplifies Interferon signaling by inducing PKR-mediated antiviral stress granules"

    Article Title: RNase L amplifies Interferon signaling by inducing PKR-mediated antiviral stress granules

    Journal: bioRxiv

    doi: 10.1101/2020.02.07.939645

    Antiviral roles of RNase L and G3BP1 during SeV infection. WT cells were infected with SeV (40 HAU/ml) for 24h and (A) cells were fixed and stained with G3BP1 and antibody against SeV, (B) avSG was purified as described in methods. The avSG core proteins were immunoprecipitated with G3BP1 antibody and immune complex analyzed for presence of PKR, Rig-I, OAS and RNase L by immunoblot analysis. Pellet and SG core fractions were probed for expression of G3BP1 and PKR, Rig-I, OAS and RNase L. Nonspecific lanes were cropped to generate the image and the boundaries are indicated. Data are representative of results from two experiments. WT, G3BP1 KO or RNase L KO cells were infected with SeV (40HAU/ml) for indicated times and (C, D) viral titers were estimated by determining copy numbers of SeV genomic RNA strands in supernatants by qRT-PCR, (E) Expression of SeV antigens were detected using anti-Sendai-virus antibody, and (F, G) IFN-β mRNA levels were measured by qRT-PCR and normalized to GAPDH mRNA levels. Data represent mean ± S.E. for three independent experiments. **p
    Figure Legend Snippet: Antiviral roles of RNase L and G3BP1 during SeV infection. WT cells were infected with SeV (40 HAU/ml) for 24h and (A) cells were fixed and stained with G3BP1 and antibody against SeV, (B) avSG was purified as described in methods. The avSG core proteins were immunoprecipitated with G3BP1 antibody and immune complex analyzed for presence of PKR, Rig-I, OAS and RNase L by immunoblot analysis. Pellet and SG core fractions were probed for expression of G3BP1 and PKR, Rig-I, OAS and RNase L. Nonspecific lanes were cropped to generate the image and the boundaries are indicated. Data are representative of results from two experiments. WT, G3BP1 KO or RNase L KO cells were infected with SeV (40HAU/ml) for indicated times and (C, D) viral titers were estimated by determining copy numbers of SeV genomic RNA strands in supernatants by qRT-PCR, (E) Expression of SeV antigens were detected using anti-Sendai-virus antibody, and (F, G) IFN-β mRNA levels were measured by qRT-PCR and normalized to GAPDH mRNA levels. Data represent mean ± S.E. for three independent experiments. **p

    Techniques Used: Infection, Staining, Purification, Immunoprecipitation, Expressing, Quantitative RT-PCR

    Effect of avSG formation on IFN signaling. HT1080 WT and G3BP1 KO cells were (A) treated with IFN-β (1000 U/ml) for 24h and mRNA levels of ISG15 and ISG56 were measured and normalized to GAPDH by qRT-PCR, (B) transfected with ISG15-luc or ISG56-luc reporter constructs along with β-galactosidase plasmids and 24h later treated with IFN-β (1000 U/ml) and luciferase activity were measured and normalized to β-galactosidase levels. (C) WT, G3BP1 KO and RNase L KO cells were treated with IFN-β (1000 U/ml) for indicated times and cell lysates were analyzed for phosphorylation of STAT1 and induction of OAS2, OAS3 and ISG56 in immunoblots. β-actin was used to normalize loading. (D) WT, G3BP1 KO and RNase L KO cells were treated with IFN-β (1000 U/ml) for 16h and nuclear translocation of p-STAT1 was determined by immunofluorescence and nucleus was stained with DAPI, (right) quantification of p-STAT1 nuclear translocation from five random fields. Data represent mean ± S.E. for three independent experiments. n.s: not significant, WT: Wild-Type.
    Figure Legend Snippet: Effect of avSG formation on IFN signaling. HT1080 WT and G3BP1 KO cells were (A) treated with IFN-β (1000 U/ml) for 24h and mRNA levels of ISG15 and ISG56 were measured and normalized to GAPDH by qRT-PCR, (B) transfected with ISG15-luc or ISG56-luc reporter constructs along with β-galactosidase plasmids and 24h later treated with IFN-β (1000 U/ml) and luciferase activity were measured and normalized to β-galactosidase levels. (C) WT, G3BP1 KO and RNase L KO cells were treated with IFN-β (1000 U/ml) for indicated times and cell lysates were analyzed for phosphorylation of STAT1 and induction of OAS2, OAS3 and ISG56 in immunoblots. β-actin was used to normalize loading. (D) WT, G3BP1 KO and RNase L KO cells were treated with IFN-β (1000 U/ml) for 16h and nuclear translocation of p-STAT1 was determined by immunofluorescence and nucleus was stained with DAPI, (right) quantification of p-STAT1 nuclear translocation from five random fields. Data represent mean ± S.E. for three independent experiments. n.s: not significant, WT: Wild-Type.

    Techniques Used: Quantitative RT-PCR, Transfection, Construct, Luciferase, Activity Assay, Western Blot, Translocation Assay, Immunofluorescence, Staining

    Antiviral SGs are required for IRF3-mediated IFN induction. (A) HT1080 WT and G3BP1 KO cells (1×10 5 ) were transfected with IFN-β-luc, ISG15-luc or ISG56-luc reporter constructs along with β-galactosidase plasmids. After 24h, cells were treated with 10µM of 2-5A, 2µg/ml of RNase L-cleaved small RNAs or control small RNAs and 8h later luciferase activity was measured and normalized to β-galactosidase levels. (B) HT1080 WT and G3BP1 KO cells were treated with 10µM of 2-5A, 2µg/ml of RNase L-cleaved small RNAs or control small RNAs and 8h later mRNA levels of IFN-β, ISG15 and ISG56 was measured by qRT-PCR and normalized to GAPDH mRNA levels. (C) WT and G3BP1 KO cells were transfected with empty vector or HA-MAVS(IPS-1), IFN-β-luc and β-galactosidase plasmids and after 24h, promoter activity was normalized to β-galactosidase levels. Effect of HA-MAVS on IFN-β mRNA levels were determined by qRT-PCR and HA-MAVS expression was confirmed in immunoblots. HA-MAVS expressing cells were stained with G3BP1 to determine SG formation. (D) WT and G3BP1 KO cells were transfected with IRF3-GFP and 24h later cells were treated with 10µM of 2-5A or mock treated and imaged after 8h. The percentage of cells with nuclear GFP-IRF3 were calculated in random fields from a minimum of 100 cells and representative images are shown. WT and G3BP1 KO cells were transfected with IRF3-GAL4 and UAS-luciferase plasmids and treated with (E) 10µM of 2-5A for 8h or (F) HA-MAVS. Cells were lysed and luciferase activity was measured. (G) WT, G3BP1 KO or RNase L KO cells were transfected with 10µM of 2-5A for indicated times and p-IRF3, p-PKR and p-STAT1 levels were determined in immunoblot and compared to unphosphorylated levels, β-actin was used to normalize loading. (H) WT and G3BP1 KO cells were transfected with 1mM H 2 O 2 for 3h and levels of p-PKR, p-eIF2α, p-IRF3 were compared to unphosphorylated levels and induction of ISG56 were determined in immunoblots. Data represent mean ± S.E. for three independent experiments. *p
    Figure Legend Snippet: Antiviral SGs are required for IRF3-mediated IFN induction. (A) HT1080 WT and G3BP1 KO cells (1×10 5 ) were transfected with IFN-β-luc, ISG15-luc or ISG56-luc reporter constructs along with β-galactosidase plasmids. After 24h, cells were treated with 10µM of 2-5A, 2µg/ml of RNase L-cleaved small RNAs or control small RNAs and 8h later luciferase activity was measured and normalized to β-galactosidase levels. (B) HT1080 WT and G3BP1 KO cells were treated with 10µM of 2-5A, 2µg/ml of RNase L-cleaved small RNAs or control small RNAs and 8h later mRNA levels of IFN-β, ISG15 and ISG56 was measured by qRT-PCR and normalized to GAPDH mRNA levels. (C) WT and G3BP1 KO cells were transfected with empty vector or HA-MAVS(IPS-1), IFN-β-luc and β-galactosidase plasmids and after 24h, promoter activity was normalized to β-galactosidase levels. Effect of HA-MAVS on IFN-β mRNA levels were determined by qRT-PCR and HA-MAVS expression was confirmed in immunoblots. HA-MAVS expressing cells were stained with G3BP1 to determine SG formation. (D) WT and G3BP1 KO cells were transfected with IRF3-GFP and 24h later cells were treated with 10µM of 2-5A or mock treated and imaged after 8h. The percentage of cells with nuclear GFP-IRF3 were calculated in random fields from a minimum of 100 cells and representative images are shown. WT and G3BP1 KO cells were transfected with IRF3-GAL4 and UAS-luciferase plasmids and treated with (E) 10µM of 2-5A for 8h or (F) HA-MAVS. Cells were lysed and luciferase activity was measured. (G) WT, G3BP1 KO or RNase L KO cells were transfected with 10µM of 2-5A for indicated times and p-IRF3, p-PKR and p-STAT1 levels were determined in immunoblot and compared to unphosphorylated levels, β-actin was used to normalize loading. (H) WT and G3BP1 KO cells were transfected with 1mM H 2 O 2 for 3h and levels of p-PKR, p-eIF2α, p-IRF3 were compared to unphosphorylated levels and induction of ISG56 were determined in immunoblots. Data represent mean ± S.E. for three independent experiments. *p

    Techniques Used: Transfection, Construct, Luciferase, Activity Assay, Quantitative RT-PCR, Plasmid Preparation, Expressing, Western Blot, Staining

    Induction of proinflammatory cytokines by RNase L is independent of avSG assembly. WT and G3BP1 KO cells were transfected with CCL5-luc, IL-8-luc or IP-10-luc and β-galactosidase plasmids and 24h later treated with (A) 2-5A (10µM), (B) RNase L-cleaved small RNAs or control small RNAs and luciferase activity normalized to β-galactosidase levels. WT and G3BP1 KO cells were transfected with (C) 2-5A (10µM), (D) RNase L-cleaved small RNAs or control small RNAs and mRNA levels of CCL5, IL-8, IP-10 and CXCL1 was measured by qRT-PCR and normalized to GAPDH mRNA levels, (E) WT and G3BP1 KO cells were transfected with CCL5-luc, IL-8-luc or IP-10-luc and β-galactosidase plasmids and 24h later treated with 100ng/ml of TNFα and luciferase activity normalized to β-galactosidase levels. Data represent mean ± S.E. for three independent experiments. n.s: not significant, WT: Wild-Type.
    Figure Legend Snippet: Induction of proinflammatory cytokines by RNase L is independent of avSG assembly. WT and G3BP1 KO cells were transfected with CCL5-luc, IL-8-luc or IP-10-luc and β-galactosidase plasmids and 24h later treated with (A) 2-5A (10µM), (B) RNase L-cleaved small RNAs or control small RNAs and luciferase activity normalized to β-galactosidase levels. WT and G3BP1 KO cells were transfected with (C) 2-5A (10µM), (D) RNase L-cleaved small RNAs or control small RNAs and mRNA levels of CCL5, IL-8, IP-10 and CXCL1 was measured by qRT-PCR and normalized to GAPDH mRNA levels, (E) WT and G3BP1 KO cells were transfected with CCL5-luc, IL-8-luc or IP-10-luc and β-galactosidase plasmids and 24h later treated with 100ng/ml of TNFα and luciferase activity normalized to β-galactosidase levels. Data represent mean ± S.E. for three independent experiments. n.s: not significant, WT: Wild-Type.

    Techniques Used: Transfection, Luciferase, Activity Assay, Quantitative RT-PCR

    13) Product Images from "DNA methylation of claudin-6 promotes breast cancer cell migration and invasion by recruiting MeCP2 and deacetylating H3Ac and H4Ac"

    Article Title: DNA methylation of claudin-6 promotes breast cancer cell migration and invasion by recruiting MeCP2 and deacetylating H3Ac and H4Ac

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-016-0396-x

    5-aza-dC may alter the chromatin structure of CLDN6 for transcription in MCF-7 cells. a MCF-7 cells were treated with micrococcal S7 nuclease to produce mononucleosomal genomic DNA fragments (100 ∼ 200 bp). b Primer pairs were designed between -400- + 400 bp of CLDN6 proximal promoter. Micrococcal S7 nuclease preferentially digested DNA that was not organized in nucleosomes. Hence, DNA organized in nucleosomes would be less prone to nuclease digestion and amplified to the qPCR threshold at a lower Ct compared to the less organized DNA. c Purified mononucleosomal DNA was amplified using primer pairs (depicted in ( b )) and the resulting product was quantified using SYBR green dye in a quantitative PCR. The difference in Ct between 5-aza-dC treating MCF-7 and DMSO treating MCF-7 cells (as control) for each primer pair was plotted. The positive numbers suggested that in 5-aza-dC treating MCF-7 cells this part of the DNA was less organized into nucleosomes and more prone to nuclease digestion compared to control cells. CLDN6, Claudin-6; 5-aza-dC, 5-Aza-2’-deoxycytidine
    Figure Legend Snippet: 5-aza-dC may alter the chromatin structure of CLDN6 for transcription in MCF-7 cells. a MCF-7 cells were treated with micrococcal S7 nuclease to produce mononucleosomal genomic DNA fragments (100 ∼ 200 bp). b Primer pairs were designed between -400- + 400 bp of CLDN6 proximal promoter. Micrococcal S7 nuclease preferentially digested DNA that was not organized in nucleosomes. Hence, DNA organized in nucleosomes would be less prone to nuclease digestion and amplified to the qPCR threshold at a lower Ct compared to the less organized DNA. c Purified mononucleosomal DNA was amplified using primer pairs (depicted in ( b )) and the resulting product was quantified using SYBR green dye in a quantitative PCR. The difference in Ct between 5-aza-dC treating MCF-7 and DMSO treating MCF-7 cells (as control) for each primer pair was plotted. The positive numbers suggested that in 5-aza-dC treating MCF-7 cells this part of the DNA was less organized into nucleosomes and more prone to nuclease digestion compared to control cells. CLDN6, Claudin-6; 5-aza-dC, 5-Aza-2’-deoxycytidine

    Techniques Used: Amplification, Real-time Polymerase Chain Reaction, Purification, SYBR Green Assay

    14) Product Images from "Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans"

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki705

    ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.
    Figure Legend Snippet: ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Mutagenesis, Diagnostic Assay, Quantitative RT-PCR, Amplification, SYBR Green Assay

    15) Product Images from "Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo"

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo

    Journal: Nutrition & Metabolism

    doi: 10.1186/1743-7075-11-54

    ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P
    Figure Legend Snippet: ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight

    16) Product Images from "Impact of oxygen status on 10B-BPA uptake into human glioblastoma cells, referring to significance in boron neutron capture therapy"

    Article Title: Impact of oxygen status on 10B-BPA uptake into human glioblastoma cells, referring to significance in boron neutron capture therapy

    Journal: Journal of Radiation Research

    doi: 10.1093/jrr/rrx080

    Reduced oxygen conditions decrease mRNA expression levels of LAT1. Cells were incubated at oxygen concentrations of 20.8% (normoxia), 10% or 1% oxygen (hypoxia) for 72 h, followed by total RNA extraction and qRT-PCR. (A) In T98G, relative expression of LAT1 was significantly lower than in cells incubated under normoxia. (B) In A172, similar results were obtained as for the T98G cell line. Values are expressed as the mean ± standard error.
    Figure Legend Snippet: Reduced oxygen conditions decrease mRNA expression levels of LAT1. Cells were incubated at oxygen concentrations of 20.8% (normoxia), 10% or 1% oxygen (hypoxia) for 72 h, followed by total RNA extraction and qRT-PCR. (A) In T98G, relative expression of LAT1 was significantly lower than in cells incubated under normoxia. (B) In A172, similar results were obtained as for the T98G cell line. Values are expressed as the mean ± standard error.

    Techniques Used: Expressing, Incubation, RNA Extraction, Quantitative RT-PCR

    17) Product Images from "The Y137H mutation of VvCYP51 gene confers the reduced sensitivity to tebuconazole in Villosiclava virens"

    Article Title: The Y137H mutation of VvCYP51 gene confers the reduced sensitivity to tebuconazole in Villosiclava virens

    Journal: Scientific Reports

    doi: 10.1038/srep17575

    Sensitivity (EC 50 values) of pB-Vv51wt and pB-Vv51mut transformants to tebuconazole. The isolates are separated by the number. The EC 50 values were significant different between pB-Vv51wt and pB-Vv51mut transformants.
    Figure Legend Snippet: Sensitivity (EC 50 values) of pB-Vv51wt and pB-Vv51mut transformants to tebuconazole. The isolates are separated by the number. The EC 50 values were significant different between pB-Vv51wt and pB-Vv51mut transformants.

    Techniques Used:

    Molecule docking for the VvCYP51-tebuconazole complex. ( a ) Tebuconazole formed hydrogen bond (dotted line) with amino acid Lys148 in VvCYP51. ( b ) Tebuconazole formed hydrogen bond (dotted lines) with amino acids Arg379 and His137 in VvCYP51 with Y137H. ( c ) The hydrophobic and electrostatic environment of binding between Lys148 and VvCYP51. ( d ) The hydrophobic and electrostatic environment of binding between Arg379, His137 and VvCYP51 with Y137H. The color range for hydrophobicity potential ranges from brown (highest lipophilic area of the molecule) to blue (highest hydrophilic area). Electrostatic potential ranges from red (most positive) to purple (most negative). The colors of the environment in ( c,d ) did not change significantly from green and beige to blue or brown, indicating that the point mutation did not significantly change the hydrophobic and electrostatic environment of binding.
    Figure Legend Snippet: Molecule docking for the VvCYP51-tebuconazole complex. ( a ) Tebuconazole formed hydrogen bond (dotted line) with amino acid Lys148 in VvCYP51. ( b ) Tebuconazole formed hydrogen bond (dotted lines) with amino acids Arg379 and His137 in VvCYP51 with Y137H. ( c ) The hydrophobic and electrostatic environment of binding between Lys148 and VvCYP51. ( d ) The hydrophobic and electrostatic environment of binding between Arg379, His137 and VvCYP51 with Y137H. The color range for hydrophobicity potential ranges from brown (highest lipophilic area of the molecule) to blue (highest hydrophilic area). Electrostatic potential ranges from red (most positive) to purple (most negative). The colors of the environment in ( c,d ) did not change significantly from green and beige to blue or brown, indicating that the point mutation did not significantly change the hydrophobic and electrostatic environment of binding.

    Techniques Used: Binding Assay, Mutagenesis

    Relationships between relative expression of VvCYP51 and sensitivity (EC 50 values) to tebuconazole in tranformants. Linear regression analyses and coefficients of determination (R 2 ) are shown no correlation. The circle denotes FJ4-1b and squares denote pBHt2-Vv51wt transformants.
    Figure Legend Snippet: Relationships between relative expression of VvCYP51 and sensitivity (EC 50 values) to tebuconazole in tranformants. Linear regression analyses and coefficients of determination (R 2 ) are shown no correlation. The circle denotes FJ4-1b and squares denote pBHt2-Vv51wt transformants.

    Techniques Used: Expressing

    The absorption spectra of tebuconazole binding to 28aa truncated VvCYP51. ( a ) Truncated protein from FJ4-1b, ( b ) truncated protein from UV10th.
    Figure Legend Snippet: The absorption spectra of tebuconazole binding to 28aa truncated VvCYP51. ( a ) Truncated protein from FJ4-1b, ( b ) truncated protein from UV10th.

    Techniques Used: Binding Assay

    18) Product Images from "Enhanced Tolerance of Transgenic Potato Plants Over-Expressing Non-specific Lipid Transfer Protein-1 (StnsLTP1) against Multiple Abiotic Stresses"

    Article Title: Enhanced Tolerance of Transgenic Potato Plants Over-Expressing Non-specific Lipid Transfer Protein-1 (StnsLTP1) against Multiple Abiotic Stresses

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2016.01228

    Molecular analysis of putative transgenic potato lines over-expressing StnsLTP1 . (A) PCR amplification of StnsLTP1 gene using gene specific primers. (B) PCR amplification using hygromycin phosphotransferase ( hpt ) gene. (C) Southern blot analysis of different independent potato control (Untransformed-UT), putative StnsLTP1 transgenic lines (L1, L2, and L3). (D) The relative StnsLTP1 expression levels in UT and transgenic lines (L1, L2, and L3) under non-stress as well as heat, drought and salinity stress conditions. M: 1000 bp DNA Ladder (+): positive control PCR from pMDC32 plasmid and B- water blank. Means of three independent samples and standard errors are presented. The same letters above the columns indicate no significant difference at P
    Figure Legend Snippet: Molecular analysis of putative transgenic potato lines over-expressing StnsLTP1 . (A) PCR amplification of StnsLTP1 gene using gene specific primers. (B) PCR amplification using hygromycin phosphotransferase ( hpt ) gene. (C) Southern blot analysis of different independent potato control (Untransformed-UT), putative StnsLTP1 transgenic lines (L1, L2, and L3). (D) The relative StnsLTP1 expression levels in UT and transgenic lines (L1, L2, and L3) under non-stress as well as heat, drought and salinity stress conditions. M: 1000 bp DNA Ladder (+): positive control PCR from pMDC32 plasmid and B- water blank. Means of three independent samples and standard errors are presented. The same letters above the columns indicate no significant difference at P

    Techniques Used: Transgenic Assay, Expressing, Polymerase Chain Reaction, Amplification, Southern Blot, Positive Control, Plasmid Preparation

    StnsLTP1 sequence analysis and stress specific expression in wild-type potato plants. (A) Alignment of the deduced StnsLTP1 sequence with other known plant nsLTP sequences. The amino acid sequences used in the alignment were from Arabidopsis thaliana (NP_181388.1), Oryza sativa (AAP92127), Brassica oleracea (AAA73948), Castanea sativa (ADK60918), Betula platyphylla (AFR31532), Beta vulgaris (Q43748), Triticum aestivum (P24296), Spinacia oleracea (AAA34032), Solanum lycopersicum (CAA39512), and Zea mays (P19656). The probable signal peptide sequence and lipid binding motifs (DRQ and CGV) in StnsLTP1 are indicated by flower bracket. The eight strictly conserved cysteine residues are boxed in black. (B) A 3D model of putative StnsLTP1 protein is shown as a ribbon model. The N-terminal and C-terminal are marked and the four α-helices are labeled α1–α4. The cysteine side chains forming the four disulfide bridges are showed as stick models. (C) Tissue-specific expression pattern of the StnsLTP1 gene in control potato plants under heat, drought and salinity stress and non-stress using qRT-PCR.
    Figure Legend Snippet: StnsLTP1 sequence analysis and stress specific expression in wild-type potato plants. (A) Alignment of the deduced StnsLTP1 sequence with other known plant nsLTP sequences. The amino acid sequences used in the alignment were from Arabidopsis thaliana (NP_181388.1), Oryza sativa (AAP92127), Brassica oleracea (AAA73948), Castanea sativa (ADK60918), Betula platyphylla (AFR31532), Beta vulgaris (Q43748), Triticum aestivum (P24296), Spinacia oleracea (AAA34032), Solanum lycopersicum (CAA39512), and Zea mays (P19656). The probable signal peptide sequence and lipid binding motifs (DRQ and CGV) in StnsLTP1 are indicated by flower bracket. The eight strictly conserved cysteine residues are boxed in black. (B) A 3D model of putative StnsLTP1 protein is shown as a ribbon model. The N-terminal and C-terminal are marked and the four α-helices are labeled α1–α4. The cysteine side chains forming the four disulfide bridges are showed as stick models. (C) Tissue-specific expression pattern of the StnsLTP1 gene in control potato plants under heat, drought and salinity stress and non-stress using qRT-PCR.

    Techniques Used: Sequencing, Expressing, Binding Assay, Labeling, Quantitative RT-PCR

    Enhanced cellular adjustments in StnsLTP1 transgenic lines (A) Percent membrane damage and (B) percent cell viability indicated by TTC reduction in StnsLTP1 transgenic lines (L1, L2, and L3) and UT potato plants under, non-stress, heat, drought and salinity stress conditions. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P
    Figure Legend Snippet: Enhanced cellular adjustments in StnsLTP1 transgenic lines (A) Percent membrane damage and (B) percent cell viability indicated by TTC reduction in StnsLTP1 transgenic lines (L1, L2, and L3) and UT potato plants under, non-stress, heat, drought and salinity stress conditions. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P

    Techniques Used: Transgenic Assay

    Enhanced performance of StnsLTP1 transgenic lines in scavenging ROS (A) H 2 O 2 accumulation, (B) MDA contents and antioxidant enzyme activity of (C) APX, (D) CAT, (E) SOD and (F) GR in StnsLTP1 transgenic lines (L1, L2, and L3) and untransformed (UT) potato plants under, non-stress, heat, drought and salinity stress conditions. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P
    Figure Legend Snippet: Enhanced performance of StnsLTP1 transgenic lines in scavenging ROS (A) H 2 O 2 accumulation, (B) MDA contents and antioxidant enzyme activity of (C) APX, (D) CAT, (E) SOD and (F) GR in StnsLTP1 transgenic lines (L1, L2, and L3) and untransformed (UT) potato plants under, non-stress, heat, drought and salinity stress conditions. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P

    Techniques Used: Transgenic Assay, Multiple Displacement Amplification, Activity Assay

    Relative expression of antioxidant and genes encoding different stress-responsive proteins in StnsLTP1 transgenic lines (L1, L2, and L3) and untransformed (UT) potato plants under, non-stress, heat, drought and salinity stress conditions. (A) StAPX , (B) StCAT , (C) StSOD , (D) StGR , (E) StHSFA3 , (F) StHSP70 , (G) StHSP90 , and (H) StsHSP20. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P
    Figure Legend Snippet: Relative expression of antioxidant and genes encoding different stress-responsive proteins in StnsLTP1 transgenic lines (L1, L2, and L3) and untransformed (UT) potato plants under, non-stress, heat, drought and salinity stress conditions. (A) StAPX , (B) StCAT , (C) StSOD , (D) StGR , (E) StHSFA3 , (F) StHSP70 , (G) StHSP90 , and (H) StsHSP20. Means of three independent samples and standard errors are presented. The same letter above the column indicates no significant difference at P

    Techniques Used: Expressing, Transgenic Assay

    19) Product Images from "Digital Droplet PCR for the Absolute Quantification of Exon Skipping Induced by Antisense Oligonucleotides in (Pre-)Clinical Development for Duchenne Muscular Dystrophy"

    Article Title: Digital Droplet PCR for the Absolute Quantification of Exon Skipping Induced by Antisense Oligonucleotides in (Pre-)Clinical Development for Duchenne Muscular Dystrophy

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0162467

    Comparison different PCR methods and impact on quantification. Graphic representation of the quantification of dystrophin cDNA construct templates lacking or containing exon 51 mixed in different ratios ranging from 0% to 100% using nested PCR (40, 50 and 60 cycles), qPCR (LinRegPCR and Pfaffl methods) and ddPCR. The dashed red line indicates the theoretical template ratios. The solid black ddPCR line is almost indistinguishable from the theoretical line and both lines are superimposed. Data is based on one experiment using 2 replicates for ddPCR and 3 replicates for qPCR.
    Figure Legend Snippet: Comparison different PCR methods and impact on quantification. Graphic representation of the quantification of dystrophin cDNA construct templates lacking or containing exon 51 mixed in different ratios ranging from 0% to 100% using nested PCR (40, 50 and 60 cycles), qPCR (LinRegPCR and Pfaffl methods) and ddPCR. The dashed red line indicates the theoretical template ratios. The solid black ddPCR line is almost indistinguishable from the theoretical line and both lines are superimposed. Data is based on one experiment using 2 replicates for ddPCR and 3 replicates for qPCR.

    Techniques Used: Polymerase Chain Reaction, Construct, Nested PCR, Real-time Polymerase Chain Reaction

    20) Product Images from "Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms"

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms

    Journal: BMC Plant Biology

    doi: 10.1186/1471-2229-10-150

    Correlation of qRT-PCR expression data and microarray signal ratios . Data show means (SE) for qRT-PCR expression ratios and for signal ratios of microarray data for P. euphratica/P . × canescens . Transcripts with probe set SDs in the upper 5% quantile are indicated by open symbols, those with lower probe set SDs by black symbols. Star: outlier. The outlier has an SD in the 9% range, which is close to the chosen threshold of 5%. The following genes were included (putative function, Affymetrix probe set ID, JGI gene model for analyzed genes): 1, Gibberellin regulated protein, Ptp.6252.1.S1_a_at, estExt_Genewise1_v1.C_LG_V1745; 2, MADS-Box protein, Ptp.5993.1.S1_a_at, eugene3.00150771; 3, Mitochondrial carrier protein, Ptp.5103.1.S1_at, grail3.0008039502; 4, Lil3 protein, Ptp.4571.1.S1_at, eugene3.01180096; 5, Aquaporin, Ptp.5700.1.S1_s_at, eugene3.00280238; 6, GTP-binding protein, PtpAffx.25286.1.S1_at, estExt_fgenesh4_pg.C_LG_I1368; 7, Nitrogen fixation protein, PtpAffx.1459.1.A1_s_at, estExt_fgenesh4_pm.C_LG_XII0286; 8, Ubiquitin-like protein, PtpAffx.157059.1.S1_s_at, estExt_fgenesh4_pg.C_LG_XIV1291; 9, 1-Aminocyclopropane-1-carboxylate oxidase, Ptp.5158.1.S1_at, estExt_Genewise1_v1.C_1660131; 10, Glycine dehydrogenase, PtpAffx.19705.1.A1_at, estExt_fgenesh4_pm.C_LG_VI0678.
    Figure Legend Snippet: Correlation of qRT-PCR expression data and microarray signal ratios . Data show means (SE) for qRT-PCR expression ratios and for signal ratios of microarray data for P. euphratica/P . × canescens . Transcripts with probe set SDs in the upper 5% quantile are indicated by open symbols, those with lower probe set SDs by black symbols. Star: outlier. The outlier has an SD in the 9% range, which is close to the chosen threshold of 5%. The following genes were included (putative function, Affymetrix probe set ID, JGI gene model for analyzed genes): 1, Gibberellin regulated protein, Ptp.6252.1.S1_a_at, estExt_Genewise1_v1.C_LG_V1745; 2, MADS-Box protein, Ptp.5993.1.S1_a_at, eugene3.00150771; 3, Mitochondrial carrier protein, Ptp.5103.1.S1_at, grail3.0008039502; 4, Lil3 protein, Ptp.4571.1.S1_at, eugene3.01180096; 5, Aquaporin, Ptp.5700.1.S1_s_at, eugene3.00280238; 6, GTP-binding protein, PtpAffx.25286.1.S1_at, estExt_fgenesh4_pg.C_LG_I1368; 7, Nitrogen fixation protein, PtpAffx.1459.1.A1_s_at, estExt_fgenesh4_pm.C_LG_XII0286; 8, Ubiquitin-like protein, PtpAffx.157059.1.S1_s_at, estExt_fgenesh4_pg.C_LG_XIV1291; 9, 1-Aminocyclopropane-1-carboxylate oxidase, Ptp.5158.1.S1_at, estExt_Genewise1_v1.C_1660131; 10, Glycine dehydrogenase, PtpAffx.19705.1.A1_at, estExt_fgenesh4_pm.C_LG_VI0678.

    Techniques Used: Quantitative RT-PCR, Expressing, Microarray, Binding Assay

    21) Product Images from "Tumor Microenvironmental Changes Induced by the Sulfamate Carbonic Anhydrase IX Inhibitor S4 in a Laryngeal Tumor Model"

    Article Title: Tumor Microenvironmental Changes Induced by the Sulfamate Carbonic Anhydrase IX Inhibitor S4 in a Laryngeal Tumor Model

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0108068

    Metabolism and CAIX inhibition in SCCNij202. S4 does not influence the expression of several metabolic transporters and enzymes on the mRNA level. Abbreviations: ATP6V1C1, plasma membrane proton pump vacuolar ATPase (V-ATPase); CAIX, carbonic anhydrase IX; GLUT1, glucose transporter 1; MCT, monocarboxylate transporter; NHE1, sodium-hydrogen exchanger 1; NS, not significant; 1× S4, 8 h, one i.p. injection S4, harvest after 8 hours; 1× S4, 24 h, one i.p. injection S4, harvest after 24 hours; 3× S4, one i.p. injection S4 a day for 3 days, harvest 8 hours after the last injection; 5× S4, one i.p. injection S4 a day for 5 days, harvest 8 hours after the last injection.
    Figure Legend Snippet: Metabolism and CAIX inhibition in SCCNij202. S4 does not influence the expression of several metabolic transporters and enzymes on the mRNA level. Abbreviations: ATP6V1C1, plasma membrane proton pump vacuolar ATPase (V-ATPase); CAIX, carbonic anhydrase IX; GLUT1, glucose transporter 1; MCT, monocarboxylate transporter; NHE1, sodium-hydrogen exchanger 1; NS, not significant; 1× S4, 8 h, one i.p. injection S4, harvest after 8 hours; 1× S4, 24 h, one i.p. injection S4, harvest after 24 hours; 3× S4, one i.p. injection S4 a day for 3 days, harvest 8 hours after the last injection; 5× S4, one i.p. injection S4 a day for 5 days, harvest 8 hours after the last injection.

    Techniques Used: Inhibition, Expressing, Injection

    22) Product Images from "Lysyl oxidase secreted by tumour endothelial cells promotes angiogenesis and metastasis"

    Article Title: Lysyl oxidase secreted by tumour endothelial cells promotes angiogenesis and metastasis

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2013.535

    LOX expression in mTECs. ( A ) Characterisation of mTECs and mNECs. FACS analysis of BS1-B4 lectin binding and CD31, CD105 and CD144 expression (white areas). Isotype controls are shown as black areas. All ECs were negative for the monocyte marker CD11b and the hematopoietic marker CD45. Human HB-EGF mRNA expression was found in human tumour cells but not in mouse ECs. ( B ) LOX mRNA is upregulated in mTECs, as determined by qPCR. ** P
    Figure Legend Snippet: LOX expression in mTECs. ( A ) Characterisation of mTECs and mNECs. FACS analysis of BS1-B4 lectin binding and CD31, CD105 and CD144 expression (white areas). Isotype controls are shown as black areas. All ECs were negative for the monocyte marker CD11b and the hematopoietic marker CD45. Human HB-EGF mRNA expression was found in human tumour cells but not in mouse ECs. ( B ) LOX mRNA is upregulated in mTECs, as determined by qPCR. ** P

    Techniques Used: Expressing, FACS, Binding Assay, Marker, Real-time Polymerase Chain Reaction

    23) Product Images from "Transcriptional Analysis of the MrpJ Network: Modulation of Diverse Virulence-Associated Genes and Direct Regulation of mrp Fimbrial and flhDC Flagellar Operons in Proteus mirabilis"

    Article Title: Transcriptional Analysis of the MrpJ Network: Modulation of Diverse Virulence-Associated Genes and Direct Regulation of mrp Fimbrial and flhDC Flagellar Operons in Proteus mirabilis

    Journal: Infection and Immunity

    doi: 10.1128/IAI.02978-14

    qRT-PCR validation of selected microarray data. (A) Gene expression by the mrpJ in vivo mimic strain compared to the vector control. (B) Gene expression by a ucaJ overexpression strain. Data are the results of three independent experiments, normalized
    Figure Legend Snippet: qRT-PCR validation of selected microarray data. (A) Gene expression by the mrpJ in vivo mimic strain compared to the vector control. (B) Gene expression by a ucaJ overexpression strain. Data are the results of three independent experiments, normalized

    Techniques Used: Quantitative RT-PCR, Microarray, Expressing, In Vivo, Plasmid Preparation, Over Expression

    24) Product Images from "FOXD3 Regulates CSC Marker, DCLK1-S, and Invasive Potential: Prognostic Implications in Colon Cancer"

    Article Title: FOXD3 Regulates CSC Marker, DCLK1-S, and Invasive Potential: Prognostic Implications in Colon Cancer

    Journal: Molecular cancer research : MCR

    doi: 10.1158/1541-7786.MCR-17-0287

    Downregulation of FOXD3 in normal HEK293 cells results in upregulation of DCLK1-S (but not DCLK1-L) expression in the cells. HEK293 cells were treated with either control (con) or FOXD3-siRNA for 48 hours and processed for measuring relative levels of DCLK1-S ( A–D ), FOXD3 ( B ) and DCLK1-L ( C and D ), by either qRT-PCR ( A ), Western blot ( B , i and ii ), or RT-PCR ( C and D ). Representative Western blot data are presented in B ( i ), and data from all three experiments are presented as bar graphs in B ( ii ), after normalizing the data to corresponding β-actin levels in the samples. HEK293 cells were also transiently transfected with either control of DCLK1-S-Luc1 vectors in the presence or absence of control or FOXD3-siRNA, as indicated in E . Relative transcriptional/luciferase activity (RLU) of HEK293 cells, thus treated for 48 hours, is presented in E . Each bar graph in A , B ( ii ), D–F = mean ± SEM of duplicates from three experiments.*, P
    Figure Legend Snippet: Downregulation of FOXD3 in normal HEK293 cells results in upregulation of DCLK1-S (but not DCLK1-L) expression in the cells. HEK293 cells were treated with either control (con) or FOXD3-siRNA for 48 hours and processed for measuring relative levels of DCLK1-S ( A–D ), FOXD3 ( B ) and DCLK1-L ( C and D ), by either qRT-PCR ( A ), Western blot ( B , i and ii ), or RT-PCR ( C and D ). Representative Western blot data are presented in B ( i ), and data from all three experiments are presented as bar graphs in B ( ii ), after normalizing the data to corresponding β-actin levels in the samples. HEK293 cells were also transiently transfected with either control of DCLK1-S-Luc1 vectors in the presence or absence of control or FOXD3-siRNA, as indicated in E . Relative transcriptional/luciferase activity (RLU) of HEK293 cells, thus treated for 48 hours, is presented in E . Each bar graph in A , B ( ii ), D–F = mean ± SEM of duplicates from three experiments.*, P

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Reverse Transcription Polymerase Chain Reaction, Transfection, Luciferase, Activity Assay

    Overexpression of FOXD3-cDNA, inhibits expression of DCLK1-S, at the transcriptional level. HCT116 cells, transiently transfected with either the EMPTY vector (control) or FOXD3-cDNA plasmids for 48 hours, were processed for measuring relative levels of DCLK1-S/FOXD3 by either qRT-PCR ( A ) or Western blot ( B , i and ii ). Representative Western blot data are shown in B ( i ), and data from all three experiments is presented as bar graphs B ( ii ), after normalizing the data to corresponding β-actin levels in the samples. β-Actin was measured as an internal control. The promoter–reporter construct (DCLK1-S-Luc1), containing both the FOXD3 binding sites, is diagrammatically presented, in relation to the β-promoter map ( C ). HCT116 cells were transiently transfected with either the control or DCLK1-S-Luc1 vector in the presence of either control or FOXD3-cDNA plasmid, as shown in D , for 48 hours. Relative transcriptional/luciferase activity (RLU) of cells transfected with the indicated plasmids is presented in D . Each bar graph in A , B ( ii ), D = mean ± SEM of duplicates from three experiments.*, P
    Figure Legend Snippet: Overexpression of FOXD3-cDNA, inhibits expression of DCLK1-S, at the transcriptional level. HCT116 cells, transiently transfected with either the EMPTY vector (control) or FOXD3-cDNA plasmids for 48 hours, were processed for measuring relative levels of DCLK1-S/FOXD3 by either qRT-PCR ( A ) or Western blot ( B , i and ii ). Representative Western blot data are shown in B ( i ), and data from all three experiments is presented as bar graphs B ( ii ), after normalizing the data to corresponding β-actin levels in the samples. β-Actin was measured as an internal control. The promoter–reporter construct (DCLK1-S-Luc1), containing both the FOXD3 binding sites, is diagrammatically presented, in relation to the β-promoter map ( C ). HCT116 cells were transiently transfected with either the control or DCLK1-S-Luc1 vector in the presence of either control or FOXD3-cDNA plasmid, as shown in D , for 48 hours. Relative transcriptional/luciferase activity (RLU) of cells transfected with the indicated plasmids is presented in D . Each bar graph in A , B ( ii ), D = mean ± SEM of duplicates from three experiments.*, P

    Techniques Used: Over Expression, Expressing, Transfection, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Construct, Binding Assay, Luciferase, Activity Assay

    Overall survival of patients with CRC in relation to low or high expression of DCLK1-S/L and FOXD3. A, Kaplan–Meier overall survival curves of CRC patients with stage I–IV disease, in relation to relative expression levels of DCLK1-S, measured by qRT-PCR; n = 92 patients. B, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of FOXD3. C, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of DCLK1-S and FOXD3 expression. D, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of DCLK1-L. The cutoff threshold values were defined by using the median values in each case.
    Figure Legend Snippet: Overall survival of patients with CRC in relation to low or high expression of DCLK1-S/L and FOXD3. A, Kaplan–Meier overall survival curves of CRC patients with stage I–IV disease, in relation to relative expression levels of DCLK1-S, measured by qRT-PCR; n = 92 patients. B, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of FOXD3. C, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of DCLK1-S and FOXD3 expression. D, Kaplan–Meier overall survival curves of CRC patients, in relation to relative expression levels of DCLK1-L. The cutoff threshold values were defined by using the median values in each case.

    Techniques Used: Expressing, Quantitative RT-PCR

    25) Product Images from "Intracellular Poly(I:C) Initiated Gastric Adenocarcinoma Cell Apoptosis and Subsequently Ameliorated NK Cell Functions"

    Article Title: Intracellular Poly(I:C) Initiated Gastric Adenocarcinoma Cell Apoptosis and Subsequently Ameliorated NK Cell Functions

    Journal: Journal of Interferon & Cytokine Research

    doi: 10.1089/jir.2012.0118

    Type I interferon (IFN) did not contribute to poly(I:C)-induced apoptosis of gastric adenocarcinoma cells. (A) BGC-823 cells were transfected with 1 μg/mL poly(I:C) for 4 h. qRT-PCR was performed to analyze type I IFN pathway-associated
    Figure Legend Snippet: Type I interferon (IFN) did not contribute to poly(I:C)-induced apoptosis of gastric adenocarcinoma cells. (A) BGC-823 cells were transfected with 1 μg/mL poly(I:C) for 4 h. qRT-PCR was performed to analyze type I IFN pathway-associated

    Techniques Used: Transfection, Quantitative RT-PCR

    26) Product Images from "Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis"

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006514

    H . pylori core heptose mutants are able to induce the hummingbird phenotype in human gastric AGS cells (wild type and CRISPR/Cas9 TIFA k/o) independently of IL-8 and TIFA. A ) mock-coincubated AGS wild type (wt) cells; B ) AGS wt cells coincubated with strain N6 wt bacteria; C ) AGS wt cells coincubated with strain N6 HP0858 ( hldE ) mutant bacteria; D ) AGS wt cells coincubated with N6 HP0858 complemented strain; E ) mock-coincubated AGS TIFA CRISPR/Cas9 k/o cells; F ) AGS TIFA k/o cells coincubated with N6 wt. Bacteria were coincubated with the cells for 4 h after centrifugation, fixed and microscopic images acquired. Black arrowheads designate some hummingbird phenotype cells for clarity. Size bars (white) represent 50 μm. G ), H ) Quantitation of hummingbird phenotype in bacteria-coincubated AGS wt cells ( G ) or AGS TIFA k/o cells ( H ) as shown in panels A ) through F ). 1,000 cells for each condition were quantitated for cell length using ImageJ (as detailed in Methods ). Mutants (of strain N6) coincubated with the cells shown in panels G) and H) are indicated by the respective gene numbers. Statistically significant differences between mock-coincubated and bacteria-coincubated cells are shown above the graphs (*p
    Figure Legend Snippet: H . pylori core heptose mutants are able to induce the hummingbird phenotype in human gastric AGS cells (wild type and CRISPR/Cas9 TIFA k/o) independently of IL-8 and TIFA. A ) mock-coincubated AGS wild type (wt) cells; B ) AGS wt cells coincubated with strain N6 wt bacteria; C ) AGS wt cells coincubated with strain N6 HP0858 ( hldE ) mutant bacteria; D ) AGS wt cells coincubated with N6 HP0858 complemented strain; E ) mock-coincubated AGS TIFA CRISPR/Cas9 k/o cells; F ) AGS TIFA k/o cells coincubated with N6 wt. Bacteria were coincubated with the cells for 4 h after centrifugation, fixed and microscopic images acquired. Black arrowheads designate some hummingbird phenotype cells for clarity. Size bars (white) represent 50 μm. G ), H ) Quantitation of hummingbird phenotype in bacteria-coincubated AGS wt cells ( G ) or AGS TIFA k/o cells ( H ) as shown in panels A ) through F ). 1,000 cells for each condition were quantitated for cell length using ImageJ (as detailed in Methods ). Mutants (of strain N6) coincubated with the cells shown in panels G) and H) are indicated by the respective gene numbers. Statistically significant differences between mock-coincubated and bacteria-coincubated cells are shown above the graphs (*p

    Techniques Used: CRISPR, Mutagenesis, Centrifugation, Quantitation Assay

    Results of coincubation of parental, TIFA k/o and TIFA-complemented cell lines with H . pylori and its core heptose LPS biosynthesis mutants and detection of downstream signaling. A) AGS B) HEK293T parental and CRISPR-Cas9 TIFA k/o cells (pool) were transiently transfected with either an empty vector or a vector expressing human TIFA, by lipofectamine 2000 (HEK) or nucleofection (AGS). On the next day, parental, TIFA k/o and TIFA-complemented cells were coincubated with H . pylori of indicated genotypes (mutants indicated by respective gene numbers) at an MOI of 25 for 4 h. Cell supernatants were analyzed for IL-8 secretion by ELISA. Statistical significance of differences was determined using two-tailed, non-paired Student's t -test ( **p
    Figure Legend Snippet: Results of coincubation of parental, TIFA k/o and TIFA-complemented cell lines with H . pylori and its core heptose LPS biosynthesis mutants and detection of downstream signaling. A) AGS B) HEK293T parental and CRISPR-Cas9 TIFA k/o cells (pool) were transiently transfected with either an empty vector or a vector expressing human TIFA, by lipofectamine 2000 (HEK) or nucleofection (AGS). On the next day, parental, TIFA k/o and TIFA-complemented cells were coincubated with H . pylori of indicated genotypes (mutants indicated by respective gene numbers) at an MOI of 25 for 4 h. Cell supernatants were analyzed for IL-8 secretion by ELISA. Statistical significance of differences was determined using two-tailed, non-paired Student's t -test ( **p

    Techniques Used: CRISPR, Transfection, Plasmid Preparation, Expressing, Enzyme-linked Immunosorbent Assay, Two Tailed Test

    H . pylori IL-8 activation is abolished in AGS TIFA k/o cells, while H . pylori CagA translocation is independent of TIFA expression, IL-8 induction, and core heptose biosynthesis pathway intermediates. A) qRT-PCR detection of TIFA transcript in AGS wt and AGS TIFA k/o (KO) cells. Cells were mock-incubated or cocultured for 2 h with H . pylori strain N6 wild type (wt), isogenic cagY mutant (HP0527) and heptose pathway hldE (HP0858) or rfaD (HP0859) mutants as indicated. The TIFA transcript amounts are given in % of the mock-coincubated AGS parental cell, which was set to 100%. B) IL-8 induction in AGS CRISPR-Cas9 TIFA knock-out (KO) cells. Indicated H . pylori strains (N6 wt and isogenic core heptose mutants) were coincubated for 4 h at an MOI of 25 bacteria per cell with AGS parental cells, TIFA k/o cell single clone and TIFA k/o cell pool. HP0858 comp. is the complemented strain. Significance of differences (p) between N6 wt coincubated wild type and k/o cells were calculated by Student‘s t -test. C) CagA translocation by H . pylori N6 and isogenic cagY (HP0527; CagT4SS functional negative control) and LPS core heptose biosynthesis mutants in AGS cells and AGS TIFA KO cells. AGS cells were coincubated with H . pylori strain N6 wt or isogenic mutant bacteria for 4 h. 20 μg soluble protein (cleared cell lysates) per lane was separated on an SDS gel and blotted to nitrocellulose membrane. Western blots were incubated with antibodies as indicated. HP signifies the antiserum detection of heat-stable H . pylori surface antigens (Dako Cytomation, for antibodies see S6 Table ) and was used as a universal control for amounts of invariable H . pylori proteins in the preparations. Actin detection was used as a loading control for amounts of AGS cell proteins. D ) densitometric quantitation of CagA and p-CagA (CagA translocation) of Western blot results shown in panel C (see Methods ). The intensity values were normalized to human actin and to HP invariable protein for each condition and are depicted in % of the positive control (AGS cells coincubated with H . pylori N6 wild type bacteria), which was set to 100%.
    Figure Legend Snippet: H . pylori IL-8 activation is abolished in AGS TIFA k/o cells, while H . pylori CagA translocation is independent of TIFA expression, IL-8 induction, and core heptose biosynthesis pathway intermediates. A) qRT-PCR detection of TIFA transcript in AGS wt and AGS TIFA k/o (KO) cells. Cells were mock-incubated or cocultured for 2 h with H . pylori strain N6 wild type (wt), isogenic cagY mutant (HP0527) and heptose pathway hldE (HP0858) or rfaD (HP0859) mutants as indicated. The TIFA transcript amounts are given in % of the mock-coincubated AGS parental cell, which was set to 100%. B) IL-8 induction in AGS CRISPR-Cas9 TIFA knock-out (KO) cells. Indicated H . pylori strains (N6 wt and isogenic core heptose mutants) were coincubated for 4 h at an MOI of 25 bacteria per cell with AGS parental cells, TIFA k/o cell single clone and TIFA k/o cell pool. HP0858 comp. is the complemented strain. Significance of differences (p) between N6 wt coincubated wild type and k/o cells were calculated by Student‘s t -test. C) CagA translocation by H . pylori N6 and isogenic cagY (HP0527; CagT4SS functional negative control) and LPS core heptose biosynthesis mutants in AGS cells and AGS TIFA KO cells. AGS cells were coincubated with H . pylori strain N6 wt or isogenic mutant bacteria for 4 h. 20 μg soluble protein (cleared cell lysates) per lane was separated on an SDS gel and blotted to nitrocellulose membrane. Western blots were incubated with antibodies as indicated. HP signifies the antiserum detection of heat-stable H . pylori surface antigens (Dako Cytomation, for antibodies see S6 Table ) and was used as a universal control for amounts of invariable H . pylori proteins in the preparations. Actin detection was used as a loading control for amounts of AGS cell proteins. D ) densitometric quantitation of CagA and p-CagA (CagA translocation) of Western blot results shown in panel C (see Methods ). The intensity values were normalized to human actin and to HP invariable protein for each condition and are depicted in % of the positive control (AGS cells coincubated with H . pylori N6 wild type bacteria), which was set to 100%.

    Techniques Used: Activation Assay, Translocation Assay, Expressing, Quantitative RT-PCR, Incubation, Mutagenesis, CRISPR, Knock-Out, Functional Assay, Negative Control, SDS-Gel, Western Blot, Quantitation Assay, Positive Control

    27) Product Images from "OspA-CD40 dyad: ligand-receptor interaction in the translocation of neuroinvasive Borrelia across the blood-brain barrier"

    Article Title: OspA-CD40 dyad: ligand-receptor interaction in the translocation of neuroinvasive Borrelia across the blood-brain barrier

    Journal: Scientific Reports

    doi: 10.1038/srep00086

    Presence of Borrelia and expression of OspA by SKT-7.1 and SKT-2 strains in rat tissues assessed by PCR. Panel a depicts detection based on PCR amplification of fla gene. Panel b depicts detection based on amplification of OspA gene. Detection of borreliae in the brain microvasculature of infected rats with SKT-7.1 (lane 1) or SKT-2 (lane 2); in the brain tissues (SKT-7.1 - lane 3; SKT-2 - lane 4); in the ear punch (SKT-7.1 - lane 5; SKT-2 -lane 6). Panel c - Expression of mRNA of OspA in borreliae was assessed by quantitative RT-PCR. fla served as housekeeping gene. + and ++ indicate expression levels of the gene, - depicts no expression.
    Figure Legend Snippet: Presence of Borrelia and expression of OspA by SKT-7.1 and SKT-2 strains in rat tissues assessed by PCR. Panel a depicts detection based on PCR amplification of fla gene. Panel b depicts detection based on amplification of OspA gene. Detection of borreliae in the brain microvasculature of infected rats with SKT-7.1 (lane 1) or SKT-2 (lane 2); in the brain tissues (SKT-7.1 - lane 3; SKT-2 - lane 4); in the ear punch (SKT-7.1 - lane 5; SKT-2 -lane 6). Panel c - Expression of mRNA of OspA in borreliae was assessed by quantitative RT-PCR. fla served as housekeeping gene. + and ++ indicate expression levels of the gene, - depicts no expression.

    Techniques Used: Expressing, Polymerase Chain Reaction, Amplification, Infection, Quantitative RT-PCR

    28) Product Images from "Anti-inflammatory effect of fullerene C60 in a mice model of atopic dermatitis"

    Article Title: Anti-inflammatory effect of fullerene C60 in a mice model of atopic dermatitis

    Journal: Journal of Nanobiotechnology

    doi: 10.1186/s12951-016-0159-z

    FLG expression. The specific mRNA in OVA-stimulated mouse splenocytes (incubated with OVA for 72 h) were quantified by real-time PCR. The results are presented as mean mRNA expression (mean ± SE, n = 8 for each). The relative levels of FLG expression were calculated by referring to the HPRT (hypoxanthine guanine phosphoribosyltransferase) in each sample. AD: AD mouse model; nC 60 EC: OVA-sensitized mice treated with nC 60 EC; nC 60 SC: OVA-sensitized mice treated with nC 60 SC (*p
    Figure Legend Snippet: FLG expression. The specific mRNA in OVA-stimulated mouse splenocytes (incubated with OVA for 72 h) were quantified by real-time PCR. The results are presented as mean mRNA expression (mean ± SE, n = 8 for each). The relative levels of FLG expression were calculated by referring to the HPRT (hypoxanthine guanine phosphoribosyltransferase) in each sample. AD: AD mouse model; nC 60 EC: OVA-sensitized mice treated with nC 60 EC; nC 60 SC: OVA-sensitized mice treated with nC 60 SC (*p

    Techniques Used: Expressing, Incubation, Real-time Polymerase Chain Reaction, Mouse Assay

    Foxp3 expression. The specific mRNA in OVA-stimulated mouse splenocytes (incubated with OVA for 72 h) were quantified by real-time PCR. The results are presented as mean mRNA expression (mean ± SE, n = 8 for each). The relative levels of Foxp3 expression were calculated by referring to the HPRT (hypoxanthine guanine phosphoribosyltransferase) in each sample. AD: AD mouse model; nC 60 EC: OVA-sensitized mice treated with nC 60 EC; nC 60 SC: OVA-sensitized mice treated with nC 60 SC; placebo: PBS-sensitized mice (*p
    Figure Legend Snippet: Foxp3 expression. The specific mRNA in OVA-stimulated mouse splenocytes (incubated with OVA for 72 h) were quantified by real-time PCR. The results are presented as mean mRNA expression (mean ± SE, n = 8 for each). The relative levels of Foxp3 expression were calculated by referring to the HPRT (hypoxanthine guanine phosphoribosyltransferase) in each sample. AD: AD mouse model; nC 60 EC: OVA-sensitized mice treated with nC 60 EC; nC 60 SC: OVA-sensitized mice treated with nC 60 SC; placebo: PBS-sensitized mice (*p

    Techniques Used: Expressing, Incubation, Real-time Polymerase Chain Reaction, Mouse Assay

    29) Product Images from "An In Vitro Estimation of the Cytotoxicity and Genotoxicity of Root Extract from Leonurus sibiricus L. Overexpressing AtPAP1 against Different Cancer Cell Lines"

    Article Title: An In Vitro Estimation of the Cytotoxicity and Genotoxicity of Root Extract from Leonurus sibiricus L. Overexpressing AtPAP1 against Different Cancer Cell Lines

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    doi: 10.3390/molecules23082049

    The effect of TR and AtPAP1 TR root extracts of L. sibiricus on mitochondrial DNA (mtDNA) lesion frequency per 10 kb DNA in ( A ) ND1 and ( B ) ND5 genes, estimated by SLR-qRT-PCR amplification of total DNA from CCRF-CEM, K562 and A549. The data represent means ± SD. *: p
    Figure Legend Snippet: The effect of TR and AtPAP1 TR root extracts of L. sibiricus on mitochondrial DNA (mtDNA) lesion frequency per 10 kb DNA in ( A ) ND1 and ( B ) ND5 genes, estimated by SLR-qRT-PCR amplification of total DNA from CCRF-CEM, K562 and A549. The data represent means ± SD. *: p

    Techniques Used: Quantitative RT-PCR, Amplification

    The effect of TR and AtPAP1 TR root extracts of L. sibiricus on nucelar DNA (nDNA) lesion frequency per 10 kb DNA in ( A ) HPRT1 and ( B ) TP53 genes, estimated by SLR-qRT-PCR amplification of total DNA from CCRF-CEM, K562 and A549. The data represent means ± SD. *: p
    Figure Legend Snippet: The effect of TR and AtPAP1 TR root extracts of L. sibiricus on nucelar DNA (nDNA) lesion frequency per 10 kb DNA in ( A ) HPRT1 and ( B ) TP53 genes, estimated by SLR-qRT-PCR amplification of total DNA from CCRF-CEM, K562 and A549. The data represent means ± SD. *: p

    Techniques Used: Quantitative RT-PCR, Amplification

    30) Product Images from "Shelf Life Evaluation of Clinical Grade Chondrogenic Induced Aged Adult Stem Cells for Cartilage Regeneration"

    Article Title: Shelf Life Evaluation of Clinical Grade Chondrogenic Induced Aged Adult Stem Cells for Cartilage Regeneration

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-22748-1

    Immunohistochemistry of revived chondrogenic induced cell samples in serum (day 5). ( a ) BMSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 5 after cultures ( b ) ADSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 5 after cultures.
    Figure Legend Snippet: Immunohistochemistry of revived chondrogenic induced cell samples in serum (day 5). ( a ) BMSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 5 after cultures ( b ) ADSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 5 after cultures.

    Techniques Used: Immunohistochemistry, Expressing

    Immunohistochemistry of revived chondrogenic induced cell samples in serum (day 1). ( a ) BMSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 1 after cultures ( b ) ADSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced ADSCs in serum, on day 1 after cultures.
    Figure Legend Snippet: Immunohistochemistry of revived chondrogenic induced cell samples in serum (day 1). ( a ) BMSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced BMSCs in serum, on day 1 after cultures ( b ) ADSCs. The positive expression of collagen type I alpha 1, collagen type II alpha 1, aggrecan, and collagen type X alpha 1, evaluated on stored chondrogenic induced ADSCs in serum, on day 1 after cultures.

    Techniques Used: Immunohistochemistry, Expressing

    31) Product Images from "Liquid biopsy in colon cancer: comparison of different circulating DNA extraction systems following absolute quantification of KRAS mutations using Intplex allele-specific PCR"

    Article Title: Liquid biopsy in colon cancer: comparison of different circulating DNA extraction systems following absolute quantification of KRAS mutations using Intplex allele-specific PCR

    Journal: Oncotarget

    doi: 10.18632/oncotarget.21134

    Intplex PCR indicates increased KRAS allelic frequency in serum of metastasized CRC patients (A) and (B) Scatter plot analysis indicated higher cfDNA concentrations and allelic frequencies in metastasized CRC compared to patients with local and lymph node positive healthy patients. Allelic frequencies ranging from 0.02% to 2.65% with the highest median value (0.46 %) in metastasized patients with a second diagnosed metastasis. (C) Spearman correlation of KRAS wild type allele copies revealed a strong association between ddPCR and independent Intplex PCR. (D) Measured KRAS G12D mutated allele copies were similar between Intplex and ddPCR.
    Figure Legend Snippet: Intplex PCR indicates increased KRAS allelic frequency in serum of metastasized CRC patients (A) and (B) Scatter plot analysis indicated higher cfDNA concentrations and allelic frequencies in metastasized CRC compared to patients with local and lymph node positive healthy patients. Allelic frequencies ranging from 0.02% to 2.65% with the highest median value (0.46 %) in metastasized patients with a second diagnosed metastasis. (C) Spearman correlation of KRAS wild type allele copies revealed a strong association between ddPCR and independent Intplex PCR. (D) Measured KRAS G12D mutated allele copies were similar between Intplex and ddPCR.

    Techniques Used: Polymerase Chain Reaction

    Intplex PCR shows abundant cfDNA levels in advanced colon cancer patients (A) Spearman correlation of serum cfDNA amount in eight healthy and 50 serum samples from CRC patients revealed a strong association between Qubit and independent Intplex PCR measurement. (B) Box plot analysis indicated significant higher cfDNA concentrations in CRC patients compared to healthy individuals. (C) and (D) In patients with advanced cancer and additional distant metastasis six months (patient #29 and #38) and 13 months (patient #37) after primary cancer diagnosis cfDNA concentrations were higher at the time point of second distant metastasis. In case of patient #37 the first blood sample was drawn before surgery of the liver metastasis (serum 1) and the second 24 days later before surgery of the colorectal tumor (serum 2). Serum 3 was drawn at diagnosis of the liver metastasis 13 months later. Statistical analysis was performed using 1way ANOVA Kruskal-Wallis test to compare all groups where; *P
    Figure Legend Snippet: Intplex PCR shows abundant cfDNA levels in advanced colon cancer patients (A) Spearman correlation of serum cfDNA amount in eight healthy and 50 serum samples from CRC patients revealed a strong association between Qubit and independent Intplex PCR measurement. (B) Box plot analysis indicated significant higher cfDNA concentrations in CRC patients compared to healthy individuals. (C) and (D) In patients with advanced cancer and additional distant metastasis six months (patient #29 and #38) and 13 months (patient #37) after primary cancer diagnosis cfDNA concentrations were higher at the time point of second distant metastasis. In case of patient #37 the first blood sample was drawn before surgery of the liver metastasis (serum 1) and the second 24 days later before surgery of the colorectal tumor (serum 2). Serum 3 was drawn at diagnosis of the liver metastasis 13 months later. Statistical analysis was performed using 1way ANOVA Kruskal-Wallis test to compare all groups where; *P

    Techniques Used: Polymerase Chain Reaction

    Higher cfDNA yields in serum may result in a lower allelic frequency of KRAS mutations compared to plasma Median KRAS G12D and G12S ctDNA concentrations measured in serum (A) were slightly higher as the expected concentrations, while absolute ctDNA quantification in plasma (B) represents the amounts of spike-in DNA with better accuracy showing the best suitable quantities for the magnetic beads system (red dotted line: expected ctDNA yield). (C) Allelic frequencies were much lower than expected in serum samples compared to plasma using Intplex PCR (red dotted line: expected allele frequency). Expected ctDNA yield calculated concerning the spike-in DNA concentrations 50 ng/μL – 10 ng/μL – 5 ng/μL – 2.5 ng/μL eluted in 60 μL elution buffer and 50% allele frequency. Statistical analysis was performed using a paired Student’s t-test where; *P
    Figure Legend Snippet: Higher cfDNA yields in serum may result in a lower allelic frequency of KRAS mutations compared to plasma Median KRAS G12D and G12S ctDNA concentrations measured in serum (A) were slightly higher as the expected concentrations, while absolute ctDNA quantification in plasma (B) represents the amounts of spike-in DNA with better accuracy showing the best suitable quantities for the magnetic beads system (red dotted line: expected ctDNA yield). (C) Allelic frequencies were much lower than expected in serum samples compared to plasma using Intplex PCR (red dotted line: expected allele frequency). Expected ctDNA yield calculated concerning the spike-in DNA concentrations 50 ng/μL – 10 ng/μL – 5 ng/μL – 2.5 ng/μL eluted in 60 μL elution buffer and 50% allele frequency. Statistical analysis was performed using a paired Student’s t-test where; *P

    Techniques Used: Magnetic Beads, Polymerase Chain Reaction

    32) Product Images from "Induction of cathelicidin in normal and CF bronchial epithelial cells by 1,25-dihydroxyvitamin D3"

    Article Title: Induction of cathelicidin in normal and CF bronchial epithelial cells by 1,25-dihydroxyvitamin D3

    Journal:

    doi: 10.1016/j.jcf.2007.03.003

    Induction of cathelicidin gene expression in NHBE cells. NHBE cells were treated with 10 −8 M 1,25(OH) 2 D 3 for times indicated. (A) Total RNA was extracted, and RTQ-PCR was conducted to quantify hBD1, 2, 3, and cathelicidin mRNA levels. (B) Kinetics
    Figure Legend Snippet: Induction of cathelicidin gene expression in NHBE cells. NHBE cells were treated with 10 −8 M 1,25(OH) 2 D 3 for times indicated. (A) Total RNA was extracted, and RTQ-PCR was conducted to quantify hBD1, 2, 3, and cathelicidin mRNA levels. (B) Kinetics

    Techniques Used: Expressing, Polymerase Chain Reaction

    Induction of LL-37 mRNA in normal and CF cell lines. AA and KK cell lines were grown to confluence and exposed to 10 −8 M 1,25(OH) 2 D 3 for 0, 3, 6, 12, 24, and 48 h. Total RNA was extracted, and RTQ-PCR was performed to determine cathelicidin mRNA
    Figure Legend Snippet: Induction of LL-37 mRNA in normal and CF cell lines. AA and KK cell lines were grown to confluence and exposed to 10 −8 M 1,25(OH) 2 D 3 for 0, 3, 6, 12, 24, and 48 h. Total RNA was extracted, and RTQ-PCR was performed to determine cathelicidin mRNA

    Techniques Used: Polymerase Chain Reaction

    33) Product Images from "Comparison of Droplet Digital PCR and Seminested Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA"

    Article Title: Comparison of Droplet Digital PCR and Seminested Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085999

    Quantification of serially diluted synthetic RNA standards by ddPCR and seminested qPCR. Panels (A) – (C) show usRNA data, and panels (D) – (F) show msRNA data. (A, D) Quantification of standards by ddPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding log 10 -transformed cDNA copy numbers determined by ddPCR and fitted with a linear regression model. (B, E) Quantification of standards by seminested qPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale and fitted with a linear regression model. (C, F) Pearson correlation between ddPCR and seminested qPCR output values for the serially diluted standards. The log 10 -transformed cDNA copy numbers determined by ddPCR were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale. For every dilution, an average value of two independent measurements is shown.
    Figure Legend Snippet: Quantification of serially diluted synthetic RNA standards by ddPCR and seminested qPCR. Panels (A) – (C) show usRNA data, and panels (D) – (F) show msRNA data. (A, D) Quantification of standards by ddPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding log 10 -transformed cDNA copy numbers determined by ddPCR and fitted with a linear regression model. (B, E) Quantification of standards by seminested qPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale and fitted with a linear regression model. (C, F) Pearson correlation between ddPCR and seminested qPCR output values for the serially diluted standards. The log 10 -transformed cDNA copy numbers determined by ddPCR were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale. For every dilution, an average value of two independent measurements is shown.

    Techniques Used: Real-time Polymerase Chain Reaction, Transformation Assay

    Quantification of usRNA and msRNA in patient samples. (A, B) Correlations between ddPCR and seminested qPCR measurements of usRNA (A) and msRNA (B) in patient samples are shown. The units of measurement are log 10 copies RNA per input unit (4 µl of input cDNA) for both ddPCR and qPCR. Samples that were undetectable with both methods (n = 1 for usRNA and n = 8 for msRNA) are not shown. (C, D) Bland-Altman plots comparing the ddPCR and seminested qPCR measurements of usRNA (C) and msRNA (D) in patient samples. Mean differences and 95% Limits of Agreement are shown on the graphs.
    Figure Legend Snippet: Quantification of usRNA and msRNA in patient samples. (A, B) Correlations between ddPCR and seminested qPCR measurements of usRNA (A) and msRNA (B) in patient samples are shown. The units of measurement are log 10 copies RNA per input unit (4 µl of input cDNA) for both ddPCR and qPCR. Samples that were undetectable with both methods (n = 1 for usRNA and n = 8 for msRNA) are not shown. (C, D) Bland-Altman plots comparing the ddPCR and seminested qPCR measurements of usRNA (C) and msRNA (D) in patient samples. Mean differences and 95% Limits of Agreement are shown on the graphs.

    Techniques Used: Real-time Polymerase Chain Reaction

    34) Product Images from "Comparison of Droplet Digital PCR and Seminested Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA"

    Article Title: Comparison of Droplet Digital PCR and Seminested Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085999

    Quantification of serially diluted synthetic RNA standards by ddPCR and seminested qPCR. Panels (A) – (C) show usRNA data, and panels (D) – (F) show msRNA data. (A, D) Quantification of standards by ddPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding log 10 -transformed cDNA copy numbers determined by ddPCR and fitted with a linear regression model. (B, E) Quantification of standards by seminested qPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale and fitted with a linear regression model. (C, F) Pearson correlation between ddPCR and seminested qPCR output values for the serially diluted standards. The log 10 -transformed cDNA copy numbers determined by ddPCR were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale. For every dilution, an average value of two independent measurements is shown.
    Figure Legend Snippet: Quantification of serially diluted synthetic RNA standards by ddPCR and seminested qPCR. Panels (A) – (C) show usRNA data, and panels (D) – (F) show msRNA data. (A, D) Quantification of standards by ddPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding log 10 -transformed cDNA copy numbers determined by ddPCR and fitted with a linear regression model. (B, E) Quantification of standards by seminested qPCR. The log 10 -transfomed RNA copy numbers of serially diluted synthetic RNA standards were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale and fitted with a linear regression model. (C, F) Pearson correlation between ddPCR and seminested qPCR output values for the serially diluted standards. The log 10 -transformed cDNA copy numbers determined by ddPCR were plotted against the corresponding quantification cycle (Cq) values of seminested qPCR on a semi-log scale. For every dilution, an average value of two independent measurements is shown.

    Techniques Used: Real-time Polymerase Chain Reaction, Transformation Assay

    Quantification of usRNA and msRNA in patient samples. (A, B) Correlations between ddPCR and seminested qPCR measurements of usRNA (A) and msRNA (B) in patient samples are shown. The units of measurement are log 10 copies RNA per input unit (4 µl of input cDNA) for both ddPCR and qPCR. Samples that were undetectable with both methods (n = 1 for usRNA and n = 8 for msRNA) are not shown. (C, D) Bland-Altman plots comparing the ddPCR and seminested qPCR measurements of usRNA (C) and msRNA (D) in patient samples. Mean differences and 95% Limits of Agreement are shown on the graphs.
    Figure Legend Snippet: Quantification of usRNA and msRNA in patient samples. (A, B) Correlations between ddPCR and seminested qPCR measurements of usRNA (A) and msRNA (B) in patient samples are shown. The units of measurement are log 10 copies RNA per input unit (4 µl of input cDNA) for both ddPCR and qPCR. Samples that were undetectable with both methods (n = 1 for usRNA and n = 8 for msRNA) are not shown. (C, D) Bland-Altman plots comparing the ddPCR and seminested qPCR measurements of usRNA (C) and msRNA (D) in patient samples. Mean differences and 95% Limits of Agreement are shown on the graphs.

    Techniques Used: Real-time Polymerase Chain Reaction

    35) Product Images from "Knockdown Indian Hedgehog (Ihh) does not delay Fibular Fracture Healing in genetic deleted Ihh mice and pharmaceutical inhibited Ihh Mice"

    Article Title: Knockdown Indian Hedgehog (Ihh) does not delay Fibular Fracture Healing in genetic deleted Ihh mice and pharmaceutical inhibited Ihh Mice

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-28657-7

    Deletion and inhibition of Ihh signaling was demonstrated by IHC, RT-PCR analysis and X-ray. The fibulas of 2-month-old Ihh deletion mice ( Col2a1-CreER T2 ; Ihh fl / fl ), Cyclopamine treatment in wild type (WT) C57/B6 mice, and controls were fractured and the expression of Ihh from the calluses harvested at 1-week ( A ), and 2 weeks ( B ) post fracture was detected by IHC staining. Strong staining of Ihh was observed in the control group compared with TM and Cyclopamine treated group. ( C ) RNA from the fracture calluses was analyzed for transcript levels of the Ihh mRNA. Ihh mRNA was decreased 5-fold at 1-week and 6-fold at 2-weeks post fracture from the calluses in TM group and 3-fold at 2-weeks post fracture from the calluses in Cyclopamine treated group when compared to the normal control samples. ( D ) Growth plate was investigated by radiographic analysis in Ihh deletion mice at 3 weeks post administration of TM, Cyclopamine and controls. Closure of growth plate has been observed at 3-weeks post fracture in TM and Cyclopamine treated group.
    Figure Legend Snippet: Deletion and inhibition of Ihh signaling was demonstrated by IHC, RT-PCR analysis and X-ray. The fibulas of 2-month-old Ihh deletion mice ( Col2a1-CreER T2 ; Ihh fl / fl ), Cyclopamine treatment in wild type (WT) C57/B6 mice, and controls were fractured and the expression of Ihh from the calluses harvested at 1-week ( A ), and 2 weeks ( B ) post fracture was detected by IHC staining. Strong staining of Ihh was observed in the control group compared with TM and Cyclopamine treated group. ( C ) RNA from the fracture calluses was analyzed for transcript levels of the Ihh mRNA. Ihh mRNA was decreased 5-fold at 1-week and 6-fold at 2-weeks post fracture from the calluses in TM group and 3-fold at 2-weeks post fracture from the calluses in Cyclopamine treated group when compared to the normal control samples. ( D ) Growth plate was investigated by radiographic analysis in Ihh deletion mice at 3 weeks post administration of TM, Cyclopamine and controls. Closure of growth plate has been observed at 3-weeks post fracture in TM and Cyclopamine treated group.

    Techniques Used: Inhibition, Immunohistochemistry, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Expressing, Staining

    Inhibition of Ihh signaling in chondrocytes decreased chondrocyte-related gene expression but did not affect osteoblast-related gene expression. RNA from the calluses at 1- ( a ) and 2-week ( b ) post fracture was analyzed for transcript levels of Gli1, Runx2, Collagen II, BMP-2, VEGF, Collagen I and Osteocalcin from the control and the deleted Ihh mice. Levels of Gli1, Runx2 and Collagen II mRNA were high in the control group compared with TM group. While the mRNA levels of BMP-2, VEGF, Collagen I, and Osteocalcin showed no significant difference between the control and TM group. Bar graph showing a relative fold change of mRNA expression using means and error bars represent 95% confidence intervals.
    Figure Legend Snippet: Inhibition of Ihh signaling in chondrocytes decreased chondrocyte-related gene expression but did not affect osteoblast-related gene expression. RNA from the calluses at 1- ( a ) and 2-week ( b ) post fracture was analyzed for transcript levels of Gli1, Runx2, Collagen II, BMP-2, VEGF, Collagen I and Osteocalcin from the control and the deleted Ihh mice. Levels of Gli1, Runx2 and Collagen II mRNA were high in the control group compared with TM group. While the mRNA levels of BMP-2, VEGF, Collagen I, and Osteocalcin showed no significant difference between the control and TM group. Bar graph showing a relative fold change of mRNA expression using means and error bars represent 95% confidence intervals.

    Techniques Used: Inhibition, Expressing, Mouse Assay

    36) Product Images from "Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia"

    Article Title: Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    Journal: Genes and immunity

    doi: 10.1038/gene.2012.40

    a. Combined bisulfite restriction analysis of LINE-1 in symptomatic BPH TURP samples, asymptomatic BPH, and donors. Lane 1 is a 100 base pair (bp) molecular weight marker (mwm), lane 2 is the calibrator, lanes 3–5 are symptomatic BPH TURP samples, lanes 6–8 are asymptomatic BPH, lanes 9–11 are donor and lane 12 is undigested PCR product. DNA samples were bisulfite treated, subjected to Line1 PCR and subsequent digestion with HinfI. The undigested top band at 450bp represents unmethylated DNA whereas the digestion products at 275bp and 180bp indicate methylated DNA. b. Quantification of the percent methylation compared to the calibrator of 11 symptomatic BPH from TURP, 10 asymptomatic BPH and 9 donors. Data is represented as a box and whisker plot. A statistically significant difference exists between symptomatic BPH and donors groups (p = 0.040, Mann Whitney), whereas there is no statistically significant difference between symptomatic BPH and asymptomatic BPH. c. APOBEC3G real time PCR results for symptomatic BPH, asymptomatic BPH, and donor samples. The Mann-Whitney rank-sum test was used to determine the statistically significant p value of 0.011 between symptomatic BPH and donors and the t-test was used to determine the statistically significant difference between symptomatic BPH and donors (p = 0.043).
    Figure Legend Snippet: a. Combined bisulfite restriction analysis of LINE-1 in symptomatic BPH TURP samples, asymptomatic BPH, and donors. Lane 1 is a 100 base pair (bp) molecular weight marker (mwm), lane 2 is the calibrator, lanes 3–5 are symptomatic BPH TURP samples, lanes 6–8 are asymptomatic BPH, lanes 9–11 are donor and lane 12 is undigested PCR product. DNA samples were bisulfite treated, subjected to Line1 PCR and subsequent digestion with HinfI. The undigested top band at 450bp represents unmethylated DNA whereas the digestion products at 275bp and 180bp indicate methylated DNA. b. Quantification of the percent methylation compared to the calibrator of 11 symptomatic BPH from TURP, 10 asymptomatic BPH and 9 donors. Data is represented as a box and whisker plot. A statistically significant difference exists between symptomatic BPH and donors groups (p = 0.040, Mann Whitney), whereas there is no statistically significant difference between symptomatic BPH and asymptomatic BPH. c. APOBEC3G real time PCR results for symptomatic BPH, asymptomatic BPH, and donor samples. The Mann-Whitney rank-sum test was used to determine the statistically significant p value of 0.011 between symptomatic BPH and donors and the t-test was used to determine the statistically significant difference between symptomatic BPH and donors (p = 0.043).

    Techniques Used: Molecular Weight, Marker, Polymerase Chain Reaction, Methylation, Whisker Assay, MANN-WHITNEY, Real-time Polymerase Chain Reaction

    a. LINE1ORF2 real time PCR for symptomatic BPH, asymptomatic BPH and normal prostate tissue from organ donors. The Mann-Whitney statistical test was performed, determining that a statistically significant difference exists between symptomatic BPH and donors (p = 0.015), however there is no statistically significant difference between symptomatic and asymptomatic BPH.
    Figure Legend Snippet: a. LINE1ORF2 real time PCR for symptomatic BPH, asymptomatic BPH and normal prostate tissue from organ donors. The Mann-Whitney statistical test was performed, determining that a statistically significant difference exists between symptomatic BPH and donors (p = 0.015), however there is no statistically significant difference between symptomatic and asymptomatic BPH.

    Techniques Used: Real-time Polymerase Chain Reaction, MANN-WHITNEY

    a. IFIT1 real time PCR with symptomatic and asymptomatic BPH samples. The Mann-Whitney statistical test was utilized for statistical analysis and determined that there was no statistically significant difference between the two groups. b. Real time PCR for IFIT1 in symptomatic BPH and asymptomatic BPH samples in which the prostate mass was less than 60g. Statistical analysis using the Mann-Whitney rank-sum test demonstrates a statistically significant difference between the two groups, p = 0.0118.
    Figure Legend Snippet: a. IFIT1 real time PCR with symptomatic and asymptomatic BPH samples. The Mann-Whitney statistical test was utilized for statistical analysis and determined that there was no statistically significant difference between the two groups. b. Real time PCR for IFIT1 in symptomatic BPH and asymptomatic BPH samples in which the prostate mass was less than 60g. Statistical analysis using the Mann-Whitney rank-sum test demonstrates a statistically significant difference between the two groups, p = 0.0118.

    Techniques Used: Real-time Polymerase Chain Reaction, MANN-WHITNEY

    a. Correlation between IFIT1 real time PCR results (IFIT1 relative gene expression – IFIT1/GAPDH) and mass in grams of the asymptomatic BPH samples. Statistical analysis was carried out using a Pearson’s correlation, with the Pearson’s r = 0.65 and p = 0.0172. b. Correlation between APOBEC3G and IFIT1 relative gene expression (normalized to GAPDH) in the symptomatic BPH samples. Pearson’s correlation statistical analysis resulted in a Pearson’s r = 0.65 and p = 0.0066.
    Figure Legend Snippet: a. Correlation between IFIT1 real time PCR results (IFIT1 relative gene expression – IFIT1/GAPDH) and mass in grams of the asymptomatic BPH samples. Statistical analysis was carried out using a Pearson’s correlation, with the Pearson’s r = 0.65 and p = 0.0172. b. Correlation between APOBEC3G and IFIT1 relative gene expression (normalized to GAPDH) in the symptomatic BPH samples. Pearson’s correlation statistical analysis resulted in a Pearson’s r = 0.65 and p = 0.0066.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    37) Product Images from "Xylan Utilization Regulon in Xanthomonas citri pv. citri Strain 306: Gene Expression and Utilization of Oligoxylosides"

    Article Title: Xylan Utilization Regulon in Xanthomonas citri pv. citri Strain 306: Gene Expression and Utilization of Oligoxylosides

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.03091-14

    qRT-PCR.
    Figure Legend Snippet: qRT-PCR.

    Techniques Used: Quantitative RT-PCR

    38) Product Images from "Validation of a digital PCR method for quantification of DNA copy number concentrations by using a certified reference material"

    Article Title: Validation of a digital PCR method for quantification of DNA copy number concentrations by using a certified reference material

    Journal: Biomolecular Detection and Quantification

    doi: 10.1016/j.bdq.2016.08.002

    Linearity of the BCR-ABL ddPCR method when measuring ERM-AD623 samples within a PCR copy number concentration range of 2.5 cp/μL to 5400 cp/μL. The data points represent the average result for eight replicate measurements, and the vertical error bars represent the associated STD. The horizontal error bars represent the standard uncertainty associated with the certified values of the ERM-AD623 samples.
    Figure Legend Snippet: Linearity of the BCR-ABL ddPCR method when measuring ERM-AD623 samples within a PCR copy number concentration range of 2.5 cp/μL to 5400 cp/μL. The data points represent the average result for eight replicate measurements, and the vertical error bars represent the associated STD. The horizontal error bars represent the standard uncertainty associated with the certified values of the ERM-AD623 samples.

    Techniques Used: Polymerase Chain Reaction, Concentration Assay

    A schematic overview of all factors which may contribute to the uncertainty of the measurement results obtained with BCR-ABL ddPCR method as performed in this validation study. C primers/probe : concentration primers and probe, Df sample : dilution factor of sample before addition to PCR mix, Df PCR : dilution factor of sample in the PCR mix, M dil : mass of diluent, M dil+sample : mass of diluent and sample, M premix : mass of pre sample mix, M mix : mass of the PCR mix with sample, V d : volume of the droplets
    Figure Legend Snippet: A schematic overview of all factors which may contribute to the uncertainty of the measurement results obtained with BCR-ABL ddPCR method as performed in this validation study. C primers/probe : concentration primers and probe, Df sample : dilution factor of sample before addition to PCR mix, Df PCR : dilution factor of sample in the PCR mix, M dil : mass of diluent, M dil+sample : mass of diluent and sample, M premix : mass of pre sample mix, M mix : mass of the PCR mix with sample, V d : volume of the droplets

    Techniques Used: Concentration Assay, Polymerase Chain Reaction

    The relative STD caused by stochastic effects in relation to the PCR copy number concentration for the ddPCR system. The relative STD resulting from stochastic effects ( s s t o c h a s t i c e f f e c t s , r e l ) consists of two components: the relative STD caused by the stochastic effects when sampling the DNA solution added to the PCR mix ( s s a m p l i n g , r e l ) and the relative standard deviation caused by the stochastic effects of the distribution of the target sequence over the analysed droplets ( s d i s t r i b u t i o n , r e l ). The estimation of the s s a m p l i n g , r e l is based on the Poisson distribution, and the estimation of s d i s t r i b u t i o n , r e l is based on the binominal distribution as described in [29] . T s a m p l e d : the expected number of target sequences sampled, T A : the expected number of target sequences in the analysed droplets, A: number of analysed droplets, P: number of positive droplets.
    Figure Legend Snippet: The relative STD caused by stochastic effects in relation to the PCR copy number concentration for the ddPCR system. The relative STD resulting from stochastic effects ( s s t o c h a s t i c e f f e c t s , r e l ) consists of two components: the relative STD caused by the stochastic effects when sampling the DNA solution added to the PCR mix ( s s a m p l i n g , r e l ) and the relative standard deviation caused by the stochastic effects of the distribution of the target sequence over the analysed droplets ( s d i s t r i b u t i o n , r e l ). The estimation of the s s a m p l i n g , r e l is based on the Poisson distribution, and the estimation of s d i s t r i b u t i o n , r e l is based on the binominal distribution as described in [29] . T s a m p l e d : the expected number of target sequences sampled, T A : the expected number of target sequences in the analysed droplets, A: number of analysed droplets, P: number of positive droplets.

    Techniques Used: Polymerase Chain Reaction, Concentration Assay, Sampling, Standard Deviation, Sequencing

    39) Product Images from "GADD45a Regulates Olaquindox-Induced DNA Damage and S-Phase Arrest in Human Hepatoma G2 Cells via JNK/p38 Pathways"

    Article Title: GADD45a Regulates Olaquindox-Induced DNA Damage and S-Phase Arrest in Human Hepatoma G2 Cells via JNK/p38 Pathways

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    doi: 10.3390/molecules22010124

    The protein and mRNA level of GADD45a was detected by western blot and qRT-PCR. β-actin mRNA amplification was used as a control for qRT-PCR. The data analysis results were exhibited in the right panels. All results were presented as mean ± SD, from three independent experiments. ** p
    Figure Legend Snippet: The protein and mRNA level of GADD45a was detected by western blot and qRT-PCR. β-actin mRNA amplification was used as a control for qRT-PCR. The data analysis results were exhibited in the right panels. All results were presented as mean ± SD, from three independent experiments. ** p

    Techniques Used: Western Blot, Quantitative RT-PCR, Amplification

    40) Product Images from "Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells"

    Article Title: Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0053933

    qRT-PCR analysis of CD90 fold change relative to a control capture containing no antibody after normalisation to a beta-actin control. Error bars represent 1 standard deviation from the mean, n = 3 (technical replicates).
    Figure Legend Snippet: qRT-PCR analysis of CD90 fold change relative to a control capture containing no antibody after normalisation to a beta-actin control. Error bars represent 1 standard deviation from the mean, n = 3 (technical replicates).

    Techniques Used: Quantitative RT-PCR, Standard Deviation

    Related Articles

    SYBR Green Assay:

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ]. .. QRT-PCR primers were designed by using Primer Express v2.0 software (Applied Biosystems, Foster City, CA, USA).

    Article Title: Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation
    Article Snippet: .. A total of 2 µL cDNA products were amplified in a 20-µL reaction system containing 10 µL iQ SYBR Green Supermix (Bio-Rad) and 400 nmol/L primer mixture. ..

    Article Title: The Use of Nanotrap Particles Technology in Capturing HIV-1 Virions and Viral Proteins from Infected Cells
    Article Snippet: .. PCR reaction mixtures were prepared using 2 µl of undiluted, 10−1 or 10−2 diluted cDNA, 300 nm of each primer: Gag1483-F ( 5′-AAGGGGAAGTGACATAGCAG-3′ ) and Gag1625-R: ( 5′-GCTGGTAGGGCTATACATTCTTAC-3′ ), and the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA), to amplify 143 nt fragments of HIV-1 gag gene. ..

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Article Title: Expression Analysis of the T-Cell-Targeting Chemokines CXCL9 and CXCL10 in Mice and Humans with Endothelial Infections Caused by Rickettsiae of the Spotted Fever Group
    Article Snippet: .. The primers used for real-time PCR with SYBRgreen (IQ SYBR green supermix; Bio-Rad, Hercules, CA) are presented in Table 1 . .. Optimal magnesium concentrations obtaining efficiencies close to 100% were determined experimentally.

    Amplification:

    Article Title: Klotho Depletion Contributes to Increased Inflammation in Kidney of the db/db Mouse Model of Diabetes via RelA (Serine)536 Phosphorylation
    Article Snippet: .. A total of 2 µL cDNA products were amplified in a 20-µL reaction system containing 10 µL iQ SYBR Green Supermix (Bio-Rad) and 400 nmol/L primer mixture. ..

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Synthesized:

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Mutagenesis:

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Quantitative RT-PCR:

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ]. .. QRT-PCR primers were designed by using Primer Express v2.0 software (Applied Biosystems, Foster City, CA, USA).

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Real-time Polymerase Chain Reaction:

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans
    Article Snippet: .. Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min. .. The specificity of the reactions was checked by melting curve profiles to monitor the presence of only one duplex DNA species and by agarose gel electrophoresis analysis of certain products to confirm the amplification of a single band of the expected size.

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Article Title: Expression Analysis of the T-Cell-Targeting Chemokines CXCL9 and CXCL10 in Mice and Humans with Endothelial Infections Caused by Rickettsiae of the Spotted Fever Group
    Article Snippet: .. The primers used for real-time PCR with SYBRgreen (IQ SYBR green supermix; Bio-Rad, Hercules, CA) are presented in Table 1 . .. Optimal magnesium concentrations obtaining efficiencies close to 100% were determined experimentally.

    Expressing:

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared. .. The real-time PCR program was set as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, and then 61 °C for 30 s. Finally, the melting curve program was performed at the end of each reaction.

    Polymerase Chain Reaction:

    Article Title: The Use of Nanotrap Particles Technology in Capturing HIV-1 Virions and Viral Proteins from Infected Cells
    Article Snippet: .. PCR reaction mixtures were prepared using 2 µl of undiluted, 10−1 or 10−2 diluted cDNA, 300 nm of each primer: Gag1483-F ( 5′-AAGGGGAAGTGACATAGCAG-3′ ) and Gag1625-R: ( 5′-GCTGGTAGGGCTATACATTCTTAC-3′ ), and the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA), to amplify 143 nt fragments of HIV-1 gag gene. ..

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo
    Article Snippet: .. Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA). ..

    Produced:

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Plasmid Preparation:

    Article Title: Comparative genomic analysis and characterization of incompatibility group FIB plasmid encoded virulence factors of Salmonella enterica isolated from food sources
    Article Snippet: .. The sitA primer was designed to detect only transcripts produced from plasmid encoded sitA and not from the chromosome. qRT-PCR was performed using iQ SYBR green super-mix and CFX touch real-time PCR detection system (Bio-Rad). .. The Salmonella gmk gene served as endogenous control, to normalize expression [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad iq sybr green master mix
    5-aza-dC may alter the chromatin structure of CLDN6 for transcription in MCF-7 cells. a MCF-7 cells were treated with micrococcal S7 nuclease to produce mononucleosomal genomic DNA fragments (100 ∼ 200 bp). b Primer pairs were designed between -400- + 400 bp of CLDN6 proximal promoter. Micrococcal S7 nuclease preferentially digested DNA that was not organized in nucleosomes. Hence, DNA organized in nucleosomes would be less prone to nuclease digestion and amplified to the qPCR threshold at a lower Ct compared to the less organized DNA. c Purified mononucleosomal DNA was amplified using primer pairs (depicted in ( b )) and the resulting product was quantified using <t>SYBR</t> green dye in a quantitative <t>PCR.</t> The difference in Ct between 5-aza-dC treating MCF-7 and DMSO treating MCF-7 cells (as control) for each primer pair was plotted. The positive numbers suggested that in 5-aza-dC treating MCF-7 cells this part of the DNA was less organized into nucleosomes and more prone to nuclease digestion compared to control cells. CLDN6, Claudin-6; 5-aza-dC, 5-Aza-2’-deoxycytidine
    Iq Sybr Green Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iq sybr green master mix/product/Bio-Rad
    Average 99 stars, based on 377 article reviews
    Price from $9.99 to $1999.99
    iq sybr green master mix - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    84
    Bio-Rad lpar1 targeting vector
    Deletion of <t>Lpar1</t> in neuronal lineages protects against PSNL induced neuropathic pain. (A) Targeted nestin-cre -mediated deletion of Lpar1 in all neural lineages protects against neuropathic pain in the PSNL mouse model. (B) Schwann cell specific deletion of Lpar1 through a P0-cre transgene protects mice from PSNL at later but not earlier time points. (C) Specific deletion of Lpar1 in neurons protects mice from PSNL induced neuropathic pain at early time points but not at later time points. (D) Schwann cell specific deletion of Lpar1 occurs at later time points and is long-lasting. The plotted data is the average paw withdrawal threshold time observed for Lpar1 conditional null mutants normalized to Lpar1 flox/flox control animal responses +/- SEM. For (A, B, and C), N=10 Lpar1 flox/flox , N=10 Lpar1 flox/flox - nestin-cre , N=9 Lpar1 flox/flox -P0 cre, and N=8 Lpar1 flox/flox - synapsin-cre animals. In (D), N=2 for all genotypes used. Statistical analysis was performed using a two-way Anova, followed by a Sidak’s multiple comparisons test, differences were considered significant when P≤0.05 (*=P≤0.05, **≤.001, ***≤0.001, ****P≤0.0001).
    Lpar1 Targeting Vector, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lpar1 targeting vector/product/Bio-Rad
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lpar1 targeting vector - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    Image Search Results


    5-aza-dC may alter the chromatin structure of CLDN6 for transcription in MCF-7 cells. a MCF-7 cells were treated with micrococcal S7 nuclease to produce mononucleosomal genomic DNA fragments (100 ∼ 200 bp). b Primer pairs were designed between -400- + 400 bp of CLDN6 proximal promoter. Micrococcal S7 nuclease preferentially digested DNA that was not organized in nucleosomes. Hence, DNA organized in nucleosomes would be less prone to nuclease digestion and amplified to the qPCR threshold at a lower Ct compared to the less organized DNA. c Purified mononucleosomal DNA was amplified using primer pairs (depicted in ( b )) and the resulting product was quantified using SYBR green dye in a quantitative PCR. The difference in Ct between 5-aza-dC treating MCF-7 and DMSO treating MCF-7 cells (as control) for each primer pair was plotted. The positive numbers suggested that in 5-aza-dC treating MCF-7 cells this part of the DNA was less organized into nucleosomes and more prone to nuclease digestion compared to control cells. CLDN6, Claudin-6; 5-aza-dC, 5-Aza-2’-deoxycytidine

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: DNA methylation of claudin-6 promotes breast cancer cell migration and invasion by recruiting MeCP2 and deacetylating H3Ac and H4Ac

    doi: 10.1186/s13046-016-0396-x

    Figure Lengend Snippet: 5-aza-dC may alter the chromatin structure of CLDN6 for transcription in MCF-7 cells. a MCF-7 cells were treated with micrococcal S7 nuclease to produce mononucleosomal genomic DNA fragments (100 ∼ 200 bp). b Primer pairs were designed between -400- + 400 bp of CLDN6 proximal promoter. Micrococcal S7 nuclease preferentially digested DNA that was not organized in nucleosomes. Hence, DNA organized in nucleosomes would be less prone to nuclease digestion and amplified to the qPCR threshold at a lower Ct compared to the less organized DNA. c Purified mononucleosomal DNA was amplified using primer pairs (depicted in ( b )) and the resulting product was quantified using SYBR green dye in a quantitative PCR. The difference in Ct between 5-aza-dC treating MCF-7 and DMSO treating MCF-7 cells (as control) for each primer pair was plotted. The positive numbers suggested that in 5-aza-dC treating MCF-7 cells this part of the DNA was less organized into nucleosomes and more prone to nuclease digestion compared to control cells. CLDN6, Claudin-6; 5-aza-dC, 5-Aza-2’-deoxycytidine

    Article Snippet: Quantitative RT-PCR To quantify amplified signals from the CLDN6 5’ flanking region and promoter in MCF-7 cells, quantitative PCR was undertaken by using the iCycleriQ real-time PCR detection system (Bio-Rad, Hercules, CA, USA) and an iQ SYBR green master mix (Bio-Rad, Hercules, CA, USA).

    Techniques: Amplification, Real-time Polymerase Chain Reaction, Purification, SYBR Green Assay

    ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.

    Journal: Nucleic Acids Research

    Article Title: Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans

    doi: 10.1093/nar/gki705

    Figure Lengend Snippet: ( A ) Allele-specific RT–PCR expression analysis of Ube3a-ATS, Ube3a and Atp10a . RNA is extracted from the cerebellum of B6, CAST and the reciprocal F1 crosses: B6 × CAST (B × C) and CAST × B6 (C × B). The mutant Ube3a (−) allele is carried on the B6 background. The samples are subjected to RT–PCR analysis using primers that span a restriction enzyme polymorphism. RT–PCR fragments are divided into two aliquots that are either untreated (lanes 1, 3, 5, 7, 9 and 11) or cleaved with the diagnostic restriction enzyme (lanes 2, 4, 6, 8, 10 and 12). RT–PCR analysis of Ube3a-ATS is performed with primers in Ube3a exon 8 and intron 8, while primers in exon 8 and exon 9 ( 8 ) are used for Ube3a expression analysis (see text for details). Allele-specific analysis of Atp10a is based on the previously described MspI polymorphism ( 20 ). The B6 and CAST Ube3a-ATS alleles are detected as 553 and 640 bp fragments, respectively, upon Tsp509I digestion ( 8 ). Only the paternal Ube3a-ATS allele is detected in the mutant (lanes 8 and 10) and normal (lanes 6 and 12) samples. For Ube3a analysis, the B6 (200 bp) and CAST (300 bp) alleles are resolved after treatment with Tsp509I. Ube3a expression is predominantly maternal (lanes 6, 8, 10 and 12) in cerebellum. The B6 and CAST Atp10a alleles, corresponding to the 217 and 288 bp products, respectively, appear to show near equal levels of expression (lanes 6, 8, 10 and 12) suggesting bi-allelic expression of Atp10a . The Gapdh control is shown in the bottom panel. ( B ) Quantitative RT–PCR analysis of the Ube3a-ATS expression in normal and mutant mouse samples. Real-time RT–PCR amplification of Ube3a-ATS is performed using RNA from total B6 brain and from B6 × CAST cerebellum. The analysis is carried out with the iQ™ SYBR® green Super mix and iCycler iQ real-time detection system using the mutant (m−/p+) and normal (m+/p+) samples. The experiment is performed at least two times in triplicate with independent cDNA preparations and normalized to the Gapdh control. The histograms represent the ratio of Ube3a-ATS expression in the m−/p+ mutant relative to the m+/p+ control.

    Article Snippet: Real-time PCR amplification ( ) of Ube3a-ATS in B6 and B6 × CAST maternal Ube3a mutation litters was carried out with the iQ™ SYBR® green Super mix using the iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with the following conditions: 95°C, 1 m; (94°C, 30 s; 60°C, 30 s; 72°C, 20 s) × 45; 72°C, 2 min.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Mutagenesis, Diagnostic Assay, Quantitative RT-PCR, Amplification, SYBR Green Assay

    ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P

    Journal: Nutrition & Metabolism

    Article Title: Inflammation rapidly modulates the expression of ALDH1A1 (RALDH1) and vimentin in the liver and hepatic macrophages of rats in vivo

    doi: 10.1186/1743-7075-11-54

    Figure Lengend Snippet: ALDH1A1 mRNA relative expression levels in 8-wk old rats fed chow diet (A and B) and in VAA and VAD rats (C). Total RNA was extracted from the liver samples of individual rats and quantified by real time PCR with SYBR Green for ALDH1A1 and 18S ribosomal RNA (rRNA) (A and C) . Upon completion, the PCR products from individual samples in Figure 1A were pooled in each group and subjected to ethidium bromide agarose gel electrophoresis, with DNA molecular weight markers (MWM) (B) . Values in A and C were individually normalized to 18S RNA and are expressed as the mean ± SEM of n = 4-6/group. Groups not sharing a common letter were significantly different, P

    Article Snippet: Quantitative reverse transcription PCR (qRT-PCR) Total RNA was extracted from liver tissue using methods previously described [ ] using TRIzol reagent (Life Technologies, Carlsbad, CA). cDNA was synthesized using M-MLV reverse transcriptase (Promega Co., Madison, WI) and qRT-PCR analysis was performed using 2× iQ™ SYBR® Green supermix PCR Master Mix (BioRad, Hercules, CA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight

    Deletion of Lpar1 in neuronal lineages protects against PSNL induced neuropathic pain. (A) Targeted nestin-cre -mediated deletion of Lpar1 in all neural lineages protects against neuropathic pain in the PSNL mouse model. (B) Schwann cell specific deletion of Lpar1 through a P0-cre transgene protects mice from PSNL at later but not earlier time points. (C) Specific deletion of Lpar1 in neurons protects mice from PSNL induced neuropathic pain at early time points but not at later time points. (D) Schwann cell specific deletion of Lpar1 occurs at later time points and is long-lasting. The plotted data is the average paw withdrawal threshold time observed for Lpar1 conditional null mutants normalized to Lpar1 flox/flox control animal responses +/- SEM. For (A, B, and C), N=10 Lpar1 flox/flox , N=10 Lpar1 flox/flox - nestin-cre , N=9 Lpar1 flox/flox -P0 cre, and N=8 Lpar1 flox/flox - synapsin-cre animals. In (D), N=2 for all genotypes used. Statistical analysis was performed using a two-way Anova, followed by a Sidak’s multiple comparisons test, differences were considered significant when P≤0.05 (*=P≤0.05, **≤.001, ***≤0.001, ****P≤0.0001).

    Journal: bioRxiv

    Article Title: Conditional Lpar1 gene targeting identifies cell types mediating neuropathic pain

    doi: 10.1101/2020.02.02.931212

    Figure Lengend Snippet: Deletion of Lpar1 in neuronal lineages protects against PSNL induced neuropathic pain. (A) Targeted nestin-cre -mediated deletion of Lpar1 in all neural lineages protects against neuropathic pain in the PSNL mouse model. (B) Schwann cell specific deletion of Lpar1 through a P0-cre transgene protects mice from PSNL at later but not earlier time points. (C) Specific deletion of Lpar1 in neurons protects mice from PSNL induced neuropathic pain at early time points but not at later time points. (D) Schwann cell specific deletion of Lpar1 occurs at later time points and is long-lasting. The plotted data is the average paw withdrawal threshold time observed for Lpar1 conditional null mutants normalized to Lpar1 flox/flox control animal responses +/- SEM. For (A, B, and C), N=10 Lpar1 flox/flox , N=10 Lpar1 flox/flox - nestin-cre , N=9 Lpar1 flox/flox -P0 cre, and N=8 Lpar1 flox/flox - synapsin-cre animals. In (D), N=2 for all genotypes used. Statistical analysis was performed using a two-way Anova, followed by a Sidak’s multiple comparisons test, differences were considered significant when P≤0.05 (*=P≤0.05, **≤.001, ***≤0.001, ****P≤0.0001).

    Article Snippet: Production of Lpar1flox/flox and Lpar1flox/flox -cell type specific null mutant mice To create the Lpar1flox/flox mice, 1 x 107 R1 ES cells were mixed with 50 μg of linearized Lpar1 targeting vector in a 0.4 cm electroporation cuvette and the cells were pulsed with a Bio-Rad Gene Pulser II (200 mVolts x 800 μF capacitance).

    Techniques: Mouse Assay

    Functional deletion of Lpar1 is cre-dependent. (A) PCR products of DNA isolated from Lpar1 flox/flox (F/F) and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) DRG shows genomic deletion of Lpar1 exon 3, DNA from the tail of a wildtype mouse is shown for comparison. (B) qPCR products of cDNA prepared from Lpar1 flox/flox (F/F) and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) DRG shows that Lpar1 transcripts are lost in neural tissues. (C) PCR of genomic DNA isolated from the tail of a wildtype mouse (Wt) and the sciatic nerve of Lpar1 flox/flox (F/F) and Lpar1 flox/flox - P0-cre (F/F P0) mice. (D) PCR amplification of genomic DNA isolated from the sciatic nerve (SN) and cortex (Ctx) of Lpar1 flox/flox and Lpar1 flox/flox - synapsin-cre mice. The PCR primers used for amplification of wildtype (316 bp), Lpar1 floxed alleles (354 bp), and Lpar1 deleted products (242 bp), are identical to those used in Fig. 2B . The 100, 200, 300, and 400 bp bands of the 1kb plus DNA ladder are indicated for reference. (E, F) Immunofluorescent labeling of peripheral myelinated axons identify wildtype LPA 1 immunolabeling in Lpar1 flox/flox mice (E) and its absence (F) in Lpar1 flox/flox -nestin-cre transgenic mice. LPA 1 labeling is in green and MBP (myelin) in red for individual samples. Scale bar = 100 μM

    Journal: bioRxiv

    Article Title: Conditional Lpar1 gene targeting identifies cell types mediating neuropathic pain

    doi: 10.1101/2020.02.02.931212

    Figure Lengend Snippet: Functional deletion of Lpar1 is cre-dependent. (A) PCR products of DNA isolated from Lpar1 flox/flox (F/F) and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) DRG shows genomic deletion of Lpar1 exon 3, DNA from the tail of a wildtype mouse is shown for comparison. (B) qPCR products of cDNA prepared from Lpar1 flox/flox (F/F) and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) DRG shows that Lpar1 transcripts are lost in neural tissues. (C) PCR of genomic DNA isolated from the tail of a wildtype mouse (Wt) and the sciatic nerve of Lpar1 flox/flox (F/F) and Lpar1 flox/flox - P0-cre (F/F P0) mice. (D) PCR amplification of genomic DNA isolated from the sciatic nerve (SN) and cortex (Ctx) of Lpar1 flox/flox and Lpar1 flox/flox - synapsin-cre mice. The PCR primers used for amplification of wildtype (316 bp), Lpar1 floxed alleles (354 bp), and Lpar1 deleted products (242 bp), are identical to those used in Fig. 2B . The 100, 200, 300, and 400 bp bands of the 1kb plus DNA ladder are indicated for reference. (E, F) Immunofluorescent labeling of peripheral myelinated axons identify wildtype LPA 1 immunolabeling in Lpar1 flox/flox mice (E) and its absence (F) in Lpar1 flox/flox -nestin-cre transgenic mice. LPA 1 labeling is in green and MBP (myelin) in red for individual samples. Scale bar = 100 μM

    Article Snippet: Production of Lpar1flox/flox and Lpar1flox/flox -cell type specific null mutant mice To create the Lpar1flox/flox mice, 1 x 107 R1 ES cells were mixed with 50 μg of linearized Lpar1 targeting vector in a 0.4 cm electroporation cuvette and the cells were pulsed with a Bio-Rad Gene Pulser II (200 mVolts x 800 μF capacitance).

    Techniques: Functional Assay, Polymerase Chain Reaction, Isolation, Transgenic Assay, Real-time Polymerase Chain Reaction, Mouse Assay, Amplification, Labeling, Immunolabeling

    Conditional gene targeting of the Lpar1 gene locus and identification of ES cells positive for homologous recombination. (A) Schematic of the Lpar1 genomic locus, the region used for gene targeting, and the Lpar1 targeting vector. In the targeting vector, loxP sites flank Lpar1 exon 3 and the neomycin cassette used for ES cell drug resistance selection screening, an introduced EcoRI site allows for identification of homologous recombination events with the indicated external probe. Asterisks represent artificial restriction enzyme sites used in the construction of the targeting vector. (B) Southern blot of EcoRI digested ES cell DNA hybridized with the radiolabeled probe shown in (A) identifies an ES cell clone positive (+) for homologous recombination, as indicated by the presence of a 4.2 kb band. An ES cell clone with an incorrect recombination event (-) is shown for comparison and shows only the wildtype 7.9 kb Lpar1 band. (C) Four identified ES cell clones ( 9 , 28 , 37 , and 65) were grown and homologous recombination was reconfirmed by Southern blotting. These clones were chosen for loxP site retention screening, clones 37 and 65 were used for used for blastocyst injections.

    Journal: bioRxiv

    Article Title: Conditional Lpar1 gene targeting identifies cell types mediating neuropathic pain

    doi: 10.1101/2020.02.02.931212

    Figure Lengend Snippet: Conditional gene targeting of the Lpar1 gene locus and identification of ES cells positive for homologous recombination. (A) Schematic of the Lpar1 genomic locus, the region used for gene targeting, and the Lpar1 targeting vector. In the targeting vector, loxP sites flank Lpar1 exon 3 and the neomycin cassette used for ES cell drug resistance selection screening, an introduced EcoRI site allows for identification of homologous recombination events with the indicated external probe. Asterisks represent artificial restriction enzyme sites used in the construction of the targeting vector. (B) Southern blot of EcoRI digested ES cell DNA hybridized with the radiolabeled probe shown in (A) identifies an ES cell clone positive (+) for homologous recombination, as indicated by the presence of a 4.2 kb band. An ES cell clone with an incorrect recombination event (-) is shown for comparison and shows only the wildtype 7.9 kb Lpar1 band. (C) Four identified ES cell clones ( 9 , 28 , 37 , and 65) were grown and homologous recombination was reconfirmed by Southern blotting. These clones were chosen for loxP site retention screening, clones 37 and 65 were used for used for blastocyst injections.

    Article Snippet: Production of Lpar1flox/flox and Lpar1flox/flox -cell type specific null mutant mice To create the Lpar1flox/flox mice, 1 x 107 R1 ES cells were mixed with 50 μg of linearized Lpar1 targeting vector in a 0.4 cm electroporation cuvette and the cells were pulsed with a Bio-Rad Gene Pulser II (200 mVolts x 800 μF capacitance).

    Techniques: Homologous Recombination, Plasmid Preparation, Selection, Southern Blot, Clone Assay

    Cre-mediated deletion in mice with a recombined Lpar1 allele. (A) Schematic showing PCR primer pairs used to screen for cre-mediated deletion of the floxed neomycin cassette. The primers shown assay for the presence of the 5’ loxP site and the presence or absence of the neomycin cassette. (B) Diagrams showing the finished Lpar1 targeted allele produced through in vivo cre-mediated deletion of the neomycin cassette (top) and cre-mediated targeted deletion of floxed Lpar1 exon 3 (bottom). The three-primer combination used for PCR genotyping is indicated. (C) PCR genotyping of tail DNA from wildtype (Wt), Lpar1 flox /+ (F/+), Lpar1 flox/flox (F/F), and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) mice. Primers shown in (B) were used for PCR. Wildtype Lpar1 produced bands of 316 bp, while floxed alleles produced bands 354 bp. The presence of a 242 bp band in the Lpar1 flox/flox - nestin-cre sample is indicative of cre-mediated deletion in neural tissue present in the mouse tail.

    Journal: bioRxiv

    Article Title: Conditional Lpar1 gene targeting identifies cell types mediating neuropathic pain

    doi: 10.1101/2020.02.02.931212

    Figure Lengend Snippet: Cre-mediated deletion in mice with a recombined Lpar1 allele. (A) Schematic showing PCR primer pairs used to screen for cre-mediated deletion of the floxed neomycin cassette. The primers shown assay for the presence of the 5’ loxP site and the presence or absence of the neomycin cassette. (B) Diagrams showing the finished Lpar1 targeted allele produced through in vivo cre-mediated deletion of the neomycin cassette (top) and cre-mediated targeted deletion of floxed Lpar1 exon 3 (bottom). The three-primer combination used for PCR genotyping is indicated. (C) PCR genotyping of tail DNA from wildtype (Wt), Lpar1 flox /+ (F/+), Lpar1 flox/flox (F/F), and Lpar1 flox/flox - nestin-cre transgenic (F/F NC Tg) mice. Primers shown in (B) were used for PCR. Wildtype Lpar1 produced bands of 316 bp, while floxed alleles produced bands 354 bp. The presence of a 242 bp band in the Lpar1 flox/flox - nestin-cre sample is indicative of cre-mediated deletion in neural tissue present in the mouse tail.

    Article Snippet: Production of Lpar1flox/flox and Lpar1flox/flox -cell type specific null mutant mice To create the Lpar1flox/flox mice, 1 x 107 R1 ES cells were mixed with 50 μg of linearized Lpar1 targeting vector in a 0.4 cm electroporation cuvette and the cells were pulsed with a Bio-Rad Gene Pulser II (200 mVolts x 800 μF capacitance).

    Techniques: Mouse Assay, Polymerase Chain Reaction, Produced, In Vivo, Transgenic Assay