polymerase chain reaction pcr purification kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MinElute PCR Purification Kit
    Description:
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    Catalog Number:
    28004
    Price:
    134
    Category:
    MinElute PCR Purification Kit
    Buy from Supplier


    Structured Review

    Qiagen polymerase chain reaction pcr purification kit
    MinElute PCR Purification Kit
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/polymerase chain reaction pcr purification kit/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr purification kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    TA Cloning:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Purification:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension
    Article Snippet: .. Chromatin was treated with RNase A, proteinase K, and the DNA was column purified (PCR Purification kit, Qiagen). .. Purified DNA was PCR amplified using primers ( ) targeting the Anf , Renin and Apob promoter regions, and Hbb used as a negative control.

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies
    Article Snippet: .. DNA was purified using a PCR purification kit (Qiagen). .. Alternatively, immunoprecipitated complexes were boiled in sodium dodecyl sulphate (SDS) loading buffer and subjected to western blot using a mouse monoclonal antibody specific for the AR NTD (A441, Santa Cruz).

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Article Title: X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body
    Article Snippet: .. Samples were then boiled at 95°C for 10 min and DNA fragments were purified with PCR purification kit (Quiagen). .. PCR was performed as described previously for cDNA.

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A
    Article Snippet: .. Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions. .. Purified immunoprecipitated DNA and input DNA (1:100) were analysed using real-time PCR in triplicate, as described above.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Real-time Polymerase Chain Reaction:

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Polymerase Chain Reaction:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension
    Article Snippet: .. Chromatin was treated with RNase A, proteinase K, and the DNA was column purified (PCR Purification kit, Qiagen). .. Purified DNA was PCR amplified using primers ( ) targeting the Anf , Renin and Apob promoter regions, and Hbb used as a negative control.

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies
    Article Snippet: .. DNA was purified using a PCR purification kit (Qiagen). .. Alternatively, immunoprecipitated complexes were boiled in sodium dodecyl sulphate (SDS) loading buffer and subjected to western blot using a mouse monoclonal antibody specific for the AR NTD (A441, Santa Cruz).

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Article Title: X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body
    Article Snippet: .. Samples were then boiled at 95°C for 10 min and DNA fragments were purified with PCR purification kit (Quiagen). .. PCR was performed as described previously for cDNA.

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A
    Article Snippet: .. Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions. .. Purified immunoprecipitated DNA and input DNA (1:100) were analysed using real-time PCR in triplicate, as described above.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    DNA Sequencing:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Sequencing:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Plasmid Preparation:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    Qiagen qiaquick pcr purificationtm kit
    Qiaquick Pcr Purificationtm Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick pcr purificationtm kit/product/Qiagen
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purificationtm kit - by Bioz Stars, 2020-07
    84/100 stars
      Buy from Supplier

    99
    Qiagen qiaquick pcr purificatin kit
    Qiaquick Pcr Purificatin Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick pcr purificatin kit/product/Qiagen
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purificatin kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results