polymerase chain reaction pcr primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher polymerase chain reaction pcr primers
    JNA fibroblasts express <t>FGFR</t> and VEGF. (A) <t>RT-PCR</t> of RNA samples from normal cancer free oral fibroblasts of 2 patients and JNA fibroblast from 3 patients. (B) Immunoblot of FGFR protein levels demonstrate expression in JNA and normal fibroblast lines. (C) The graph depicts cumulative results of densitometry analyses of FGFR levels. Target protein levels were normalized to β -tubulin. Fold-change in FGFR levels in JNA fibroblasts relative to normal control fibroblasts are depicted. FGFR = fibroblast growth factor receptor; JNA = juvenile nasopharyngeal angiofibroma; RT-PCR = Reverse transcriptase polymerase chain reaction; VEGF = vascular endothelial growth factor; NFP = normal fibroblasts pediatric.
    Polymerase Chain Reaction Pcr Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr primers/product/Thermo Fisher
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr primers - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Inhibition of fibroblast growth factor receptor with AZD4547 mitigates juvenile nasopharyngeal angiofibroma"

    Article Title: Inhibition of fibroblast growth factor receptor with AZD4547 mitigates juvenile nasopharyngeal angiofibroma

    Journal: International forum of allergy & rhinology

    doi: 10.1002/alr.21987

    JNA fibroblasts express FGFR and VEGF. (A) RT-PCR of RNA samples from normal cancer free oral fibroblasts of 2 patients and JNA fibroblast from 3 patients. (B) Immunoblot of FGFR protein levels demonstrate expression in JNA and normal fibroblast lines. (C) The graph depicts cumulative results of densitometry analyses of FGFR levels. Target protein levels were normalized to β -tubulin. Fold-change in FGFR levels in JNA fibroblasts relative to normal control fibroblasts are depicted. FGFR = fibroblast growth factor receptor; JNA = juvenile nasopharyngeal angiofibroma; RT-PCR = Reverse transcriptase polymerase chain reaction; VEGF = vascular endothelial growth factor; NFP = normal fibroblasts pediatric.
    Figure Legend Snippet: JNA fibroblasts express FGFR and VEGF. (A) RT-PCR of RNA samples from normal cancer free oral fibroblasts of 2 patients and JNA fibroblast from 3 patients. (B) Immunoblot of FGFR protein levels demonstrate expression in JNA and normal fibroblast lines. (C) The graph depicts cumulative results of densitometry analyses of FGFR levels. Target protein levels were normalized to β -tubulin. Fold-change in FGFR levels in JNA fibroblasts relative to normal control fibroblasts are depicted. FGFR = fibroblast growth factor receptor; JNA = juvenile nasopharyngeal angiofibroma; RT-PCR = Reverse transcriptase polymerase chain reaction; VEGF = vascular endothelial growth factor; NFP = normal fibroblasts pediatric.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction

    2) Product Images from "Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia"

    Article Title: Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia

    Journal: Blood

    doi: 10.1182/blood-2012-12-472183

    miR-30c is downregulated in normal karyotype AML patient samples with CEBPA mutations. (A) Q-RT-PCR for miR-30c was carried out using bone marrow cells derived from AML patient samples (n = 30) and healthy donors (n = 3). Values were normalized to U6
    Figure Legend Snippet: miR-30c is downregulated in normal karyotype AML patient samples with CEBPA mutations. (A) Q-RT-PCR for miR-30c was carried out using bone marrow cells derived from AML patient samples (n = 30) and healthy donors (n = 3). Values were normalized to U6

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Derivative Assay

    Regulation of miR-30c in inducible C/EBPα-knockout mice. (A) Q-RT-PCR for miR-30c in sorted mouse bone marrow cell populations. Values were normalized with snoRNA-135. Total data are represented as mean ± SD from 3 independent mice. *
    Figure Legend Snippet: Regulation of miR-30c in inducible C/EBPα-knockout mice. (A) Q-RT-PCR for miR-30c in sorted mouse bone marrow cell populations. Values were normalized with snoRNA-135. Total data are represented as mean ± SD from 3 independent mice. *

    Techniques Used: Knock-Out, Mouse Assay, Reverse Transcription Polymerase Chain Reaction

    C/EBPα-p42 regulates miR-30c during granulopoiesis. (A) Lentiviral overexpression of C/EBPα in K562 cells. Total RNA was isolated at day 7 and analyzed by Q-RT-PCR with oligos for miR-30c and miR-223. Values were normalized to U6. Data
    Figure Legend Snippet: C/EBPα-p42 regulates miR-30c during granulopoiesis. (A) Lentiviral overexpression of C/EBPα in K562 cells. Total RNA was isolated at day 7 and analyzed by Q-RT-PCR with oligos for miR-30c and miR-223. Values were normalized to U6. Data

    Techniques Used: Over Expression, Isolation, Reverse Transcription Polymerase Chain Reaction

    3) Product Images from "Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia"

    Article Title: Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia

    Journal: Blood

    doi: 10.1182/blood-2009-08-240101

    miR-223 functions as a tumor suppressor in acute myeloid leukemia . (A) Quantitative real-time RT-PCR for miR-223 was carried out using bone marrow cells derived from AML patients. Values were normalized with U6. Cord blood (CB) and peripheral blood (PB)
    Figure Legend Snippet: miR-223 functions as a tumor suppressor in acute myeloid leukemia . (A) Quantitative real-time RT-PCR for miR-223 was carried out using bone marrow cells derived from AML patients. Values were normalized with U6. Cord blood (CB) and peripheral blood (PB)

    Techniques Used: Quantitative RT-PCR, Derivative Assay

    Related Articles

    Clone Assay:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Paragraph title: Molecular Cloning, Cell Transfection, and Selection of Clones ... Polymerase chain reaction (PCR) primers were purchased from Life Technologies.

    Amplification:

    Article Title: Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia
    Article Snippet: .. Corresponding reverse transcription (RT) and polymerase chain reaction (PCR) primers for RNUB6, snoRNA-202, snoRNA-135, miRNA-30c, and miR-223 were obtained from Applied Biosystems. mRNA amplification was performed as previously described by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression for normalization. .. All PCR reactions were performed in triplicate in a Rotor-Gene RG-3000 cycler (Corbett Research Australia).

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems). .. Each sample was amplified in duplicate, and the Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used for normalization.

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. The amplification reaction was set in a total volume of 20 µ l containing the PrimeSTAR Max DNA polymerase and PCR buffer (TaKaRa Biotechnology Co. Ltd., Dalian, China) and specific primers.

    Article Title: Pitfalls in the Denaturing High-Performance Liquid Chromatography Analysis of Mitochondrial DNA Mutation
    Article Snippet: .. Polymerase chain reaction (PCR) primers (Invitrogen, Carlsbad, CA) and conditions used for the amplification of the region of interest in the mitochondrial genome, restriction enzyme digestion of the amplicons with Dde I, heteroduplex formation, and DHPLC analysis of the samples have been described previously. .. In DHPLC purification of heteroduplex species, the measurement of heteroduplex proportion in a DNA sample was obtained during DHPLC analysis of the reannealed PCR amplicon as the ratio of heteroduplex peak area to total peak area (%).

    Glucose Assay:

    Article Title: Anti-human fibroblast growth factor-21 monoclonal antibody preparation, characterization and analysis of in vitro bioactivity
    Article Snippet: Glucose Assay Kit (0105102), which utilzizes the GOD-PAP method was purchased from Sichuan Maccura Biotechnology Co., Ltd (Chengdu, China). .. All polymerase chain reaction (PCR) primers ( and ) were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.).

    Synthesized:

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: .. Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen. .. SYBR® Safe DNA gel stain was purchased from Invitrogen (Invitrogen Canada Inc., Burlington, Canada).

    Article Title: Anti-human fibroblast growth factor-21 monoclonal antibody preparation, characterization and analysis of in vitro bioactivity
    Article Snippet: .. All polymerase chain reaction (PCR) primers ( and ) were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.). .. Sp2/0 lymphocytes, 3T3-L1 adipocytes and DH5α Escherichia coli were lab stocks.

    Article Title: Ex Vivo Induction of mRNA in Human Whole Blood as a New Platform of Drug and Dietary Supplement Development
    Article Snippet: Primers and Probes Polymerase chain reaction (PCR) primers and TaqMan probes were designed by Primer Express (Applied Biosystem, Foster City, CA, USA) and HYBsimulator (RNAture, Irvine, CA, USA) ( , ) (Supplemental Table 1). .. Oligonucleotides were synthesized by IDT (Coralville, IA, USA), Tsukuba Oligo Service (Tsukuba, Japan), Nippon EGT (Toyama, Japan), and Hokkaido System Science (Sapporo, Japan).

    Real-time Polymerase Chain Reaction:

    Article Title: Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia
    Article Snippet: Paragraph title: miRNA and mRNA detection by quantitative real-time PCR ... Corresponding reverse transcription (RT) and polymerase chain reaction (PCR) primers for RNUB6, snoRNA-202, snoRNA-135, miRNA-30c, and miR-223 were obtained from Applied Biosystems. mRNA amplification was performed as previously described by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression for normalization.

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: .. Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems). .. Briefly, 1 ug of total RNAs were reverse-transcribed using the RT-PCR kit (Applied Biosystems), following the manufacturer's instructions.

    Random Hexamer Labeling:

    Article Title: S-Adenosylmethionine Prevents Mallory Denk Body Formation in Drug-Primed Mice by Inhibiting the Epigenetic Memory
    Article Snippet: Synthesis of cDNAs was performed with 5 μ g of total RNA and 50 ng of random hexamer primers with SuperScript III RNase H− reverse transcriptase (Invitrogen). .. Polymerase chain reaction (PCR) primers were designed with the assistance of Primer Express software (Applied Biosystems, Foster City, CA).

    Expressing:

    Article Title: Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia
    Article Snippet: .. Corresponding reverse transcription (RT) and polymerase chain reaction (PCR) primers for RNUB6, snoRNA-202, snoRNA-135, miRNA-30c, and miR-223 were obtained from Applied Biosystems. mRNA amplification was performed as previously described by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression for normalization. .. All PCR reactions were performed in triplicate in a Rotor-Gene RG-3000 cycler (Corbett Research Australia).

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Polymerase chain reaction (PCR) primers were purchased from Life Technologies. .. A 519-bp product (3TSR), a 282-bp product (TSR2 + KRFK), and a 273-bp product (TSR2 − KRFK) were isolated and cloned into the pSecTag2A expression vector (Invitrogen, Carlsbad, CA) using the Kpn I and Asc I restriction sites built into the PCR primers.

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: .. Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems). .. Briefly, 1 ug of total RNAs were reverse-transcribed using the RT-PCR kit (Applied Biosystems), following the manufacturer's instructions.

    Article Title: Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia
    Article Snippet: The miRNA quantification was done with the TaqMan miRNA Detection Kit (Applied Biosystems) using 100 ng of RNA in a Rotor-Gene RG-3000 cycler (Corbett Research Australia) by the comparative threshold cycle method using U6 expression for normalization. .. Corresponding reverse-transcription (RT) and polymerase chain reaction (PCR) primers for miRNA-223 and U6 were obtained from Applied Biosystems.

    Modification:

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: All reagents for cell culture (Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), trypsin-EDTA, non-essential amino acids, glutamine and Trizol Reagent were purchased from Invitrogen (Burlington, ON). .. Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen.

    Transfection:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Paragraph title: Molecular Cloning, Cell Transfection, and Selection of Clones ... Polymerase chain reaction (PCR) primers were purchased from Life Technologies.

    Cell Culture:

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: All reagents for cell culture (Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), trypsin-EDTA, non-essential amino acids, glutamine and Trizol Reagent were purchased from Invitrogen (Burlington, ON). .. Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen.

    Article Title: Inhibition of fibroblast growth factor receptor with AZD4547 mitigates juvenile nasopharyngeal angiofibroma
    Article Snippet: Human umbilical vein endothelial cells (HUVECs) were purchased from American Type Culture Collection (ATCC, Manassas, VA), and were cultured in endothelial basal medium 2 (EBM-2) with supplement kit (Lonza, Basel Switzerland). .. Polymerase chain reaction (PCR) primers to: FGFR-1 (F: AGAGGACAATGTGATGAAGATA; R: GGTCAAATAATGCCTCGGGT); FGFR-2 (F: AACGGGAAGGAGTTTAAGCA; R: CTTGTCAGATGGGACCACAC); FGFR-3 (F: AGGCCATCGGCATTGACA; R: GCATCGTCTTTCAGCATCTTCAC); FGFR-4 (F: CGCGGCGTCCACCACATT; R: GTGTGTACACCCGGTCAAAC); VEGFA (F: ATCTGCATGGTGATGTTGGA; R: GGGCAGAATCATCACGAAGT); and β -actin (F: AGGGGCCGGACTCGTCATACT; R: GGCGGCACCACCATGTACCCT) were obtained from Thermo-Fisher.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems). .. Briefly, 1 ug of total RNAs were reverse-transcribed using the RT-PCR kit (Applied Biosystems), following the manufacturer's instructions.

    Article Title: S-Adenosylmethionine Prevents Mallory Denk Body Formation in Drug-Primed Mice by Inhibiting the Epigenetic Memory
    Article Snippet: Paragraph title: Quantitative Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR) Assay ... Polymerase chain reaction (PCR) primers were designed with the assistance of Primer Express software (Applied Biosystems, Foster City, CA).

    Generated:

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Sequencing:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: .. The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. The amplification reaction was set in a total volume of 20 µ l containing the PrimeSTAR Max DNA polymerase and PCR buffer (TaKaRa Biotechnology Co. Ltd., Dalian, China) and specific primers.

    DNA Extraction:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. Following amplification, the PCR products were subjected to agarose gel electrophoresis and purified using MiniBest Agarose Gel DNA Extraction kit Ver4.0 (TaKaRa Biotechnology Co. Ltd.).

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: The DNA extraction procedure and genotyping protocol have been previously described ( ). .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA).

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: The DNA extraction procedure and genotyping protocol have been previously described [ ]. .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA).

    Molecular Cloning:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Paragraph title: Molecular Cloning, Cell Transfection, and Selection of Clones ... Polymerase chain reaction (PCR) primers were purchased from Life Technologies.

    Mutagenesis:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: Analysis of genetic mutations The probands and their healthy brother, sister or relatives were selected as the subject of mutation analysis. .. The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ).

    Article Title: Pitfalls in the Denaturing High-Performance Liquid Chromatography Analysis of Mitochondrial DNA Mutation
    Article Snippet: Polymerase chain reaction (PCR) primers (Invitrogen, Carlsbad, CA) and conditions used for the amplification of the region of interest in the mitochondrial genome, restriction enzyme digestion of the amplicons with Dde I, heteroduplex formation, and DHPLC analysis of the samples have been described previously. .. In DHPLC profiling, each mutation was analyzed at temperatures of 50°C, 57°C, 58°C, 59°C, 60°C, and 61°C to determine the optimum temperature for the separation of heteroduplex from homoduplex.

    Isolation:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Polymerase chain reaction (PCR) primers were purchased from Life Technologies. .. A 519-bp product (3TSR), a 282-bp product (TSR2 + KRFK), and a 273-bp product (TSR2 − KRFK) were isolated and cloned into the pSecTag2A expression vector (Invitrogen, Carlsbad, CA) using the Kpn I and Asc I restriction sites built into the PCR primers.

    Article Title: Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia
    Article Snippet: Paragraph title: RNA isolation and miRNA detection ... Corresponding reverse-transcription (RT) and polymerase chain reaction (PCR) primers for miRNA-223 and U6 were obtained from Applied Biosystems.

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Antibody Labeling:

    Article Title: Anti-human fibroblast growth factor-21 monoclonal antibody preparation, characterization and analysis of in vitro bioactivity
    Article Snippet: Fluorescein isothiocyanate (FITC) Antibody Labeling Kit (53027) was purchased from Thermo Fisher Scientific, Inc., (Waltham, MA, USA). .. All polymerase chain reaction (PCR) primers ( and ) were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.).

    Size-exclusion Chromatography:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. The reaction was then performed for 30 cycles under 95°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec on an ABI 9700 thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Labeling:

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Developmental and Degenerative Features in a Complicated Spastic Paraplegia
    Article Snippet: .. Fluorescently labeled polymerase chain reaction (PCR) primers (Applied Biosystems, Foster City, CA) were used to amplify DNA samples using standard conditions, and PCR products were resolved on an Applied Biosystems 3130xl Genetic analyzer. .. SPG20 Sequencing Analysis Sequencing of SPG20 (NM_015087; NM_001142294-6) coding region was performed by SeqWright (Houston, TX) on PCR products after amplification of genomic DNA.

    Article Title: Inhibition of fibroblast growth factor receptor with AZD4547 mitigates juvenile nasopharyngeal angiofibroma
    Article Snippet: Normal fibroblasts from pediatric tonsils were labeled as NFP. .. Polymerase chain reaction (PCR) primers to: FGFR-1 (F: AGAGGACAATGTGATGAAGATA; R: GGTCAAATAATGCCTCGGGT); FGFR-2 (F: AACGGGAAGGAGTTTAAGCA; R: CTTGTCAGATGGGACCACAC); FGFR-3 (F: AGGCCATCGGCATTGACA; R: GCATCGTCTTTCAGCATCTTCAC); FGFR-4 (F: CGCGGCGTCCACCACATT; R: GTGTGTACACCCGGTCAAAC); VEGFA (F: ATCTGCATGGTGATGTTGGA; R: GGGCAGAATCATCACGAAGT); and β -actin (F: AGGGGCCGGACTCGTCATACT; R: GGCGGCACCACCATGTACCCT) were obtained from Thermo-Fisher.

    Purification:

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: Polymerase chain reaction (PCR) Purified PDCs from six aged and six young subjects were pooled, and RNA was extracted using Tri Reagent kit (Molecular Research Center Inc., Cincinnati, OH, USA), following the manufacturer's protocol. .. Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems).

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. Following amplification, the PCR products were subjected to agarose gel electrophoresis and purified using MiniBest Agarose Gel DNA Extraction kit Ver4.0 (TaKaRa Biotechnology Co. Ltd.).

    Article Title: Developmental and Degenerative Features in a Complicated Spastic Paraplegia
    Article Snippet: Linkage Analysis Genomic DNA was purified from lymphocytes separated from peripheral blood using commercial kits (Qiagen, Valencia, CA). .. Fluorescently labeled polymerase chain reaction (PCR) primers (Applied Biosystems, Foster City, CA) were used to amplify DNA samples using standard conditions, and PCR products were resolved on an Applied Biosystems 3130xl Genetic analyzer.

    Article Title: Pitfalls in the Denaturing High-Performance Liquid Chromatography Analysis of Mitochondrial DNA Mutation
    Article Snippet: Polymerase chain reaction (PCR) primers (Invitrogen, Carlsbad, CA) and conditions used for the amplification of the region of interest in the mitochondrial genome, restriction enzyme digestion of the amplicons with Dde I, heteroduplex formation, and DHPLC analysis of the samples have been described previously. .. In DHPLC purification of heteroduplex species, the measurement of heteroduplex proportion in a DNA sample was obtained during DHPLC analysis of the reannealed PCR amplicon as the ratio of heteroduplex peak area to total peak area (%).

    Article Title: S-Adenosylmethionine Prevents Mallory Denk Body Formation in Drug-Primed Mice by Inhibiting the Epigenetic Memory
    Article Snippet: Total liver RNAs were extracted with the Trizol plus RNA purification kit (Invitrogen, Carlsbad, CA). .. Polymerase chain reaction (PCR) primers were designed with the assistance of Primer Express software (Applied Biosystems, Foster City, CA).

    Polymerase Chain Reaction:

    Article Title: Transcription factor C/EBPα-induced microRNA-30c inactivates Notch1 during granulopoiesis and is downregulated in acute myeloid leukemia
    Article Snippet: .. Corresponding reverse transcription (RT) and polymerase chain reaction (PCR) primers for RNUB6, snoRNA-202, snoRNA-135, miRNA-30c, and miR-223 were obtained from Applied Biosystems. mRNA amplification was performed as previously described by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression for normalization. .. All PCR reactions were performed in triplicate in a Rotor-Gene RG-3000 cycler (Corbett Research Australia).

    Article Title: The Angiotensin II Type I Receptor-associated Protein, ATRAP, Is a Transmembrane Protein and a Modulator of Angiotensin II Signaling
    Article Snippet: .. DMEM restriction enzymes for molecular biology, and polymerase chain reaction (PCR) primers were purchased from Invitrogen (Carlsbad, CA). .. Fetal calf serum and l -glutamine were obtained from Invitrogen.

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: .. Polymerase chain reaction (PCR) primers were purchased from Life Technologies. .. The PCR primers listed in were used in standard PCR reactions that included human, full-length TSP-1 cDNA cloned in pBluescript, dNTPs, and TAQ polymerase (Life Technologies).

    Article Title: Age-associated impaired plasmacytoid dendritic cell functions lead to decreased CD4 and CD8 T cell immunity
    Article Snippet: .. Real time PCR was performed with the Mx3005P QPCR System instrument (Stratagene) using the TaqMan Gene expression assay with a FAM™ dye-labeled TaqMan® MGBprobe and two polymerase chain reaction PCR primers (Applied Biosystems). .. Briefly, 1 ug of total RNAs were reverse-transcribed using the RT-PCR kit (Applied Biosystems), following the manufacturer's instructions.

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: .. The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. The amplification reaction was set in a total volume of 20 µ l containing the PrimeSTAR Max DNA polymerase and PCR buffer (TaKaRa Biotechnology Co. Ltd., Dalian, China) and specific primers.

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: .. Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen. .. SYBR® Safe DNA gel stain was purchased from Invitrogen (Invitrogen Canada Inc., Burlington, Canada).

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: .. Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Developmental and Degenerative Features in a Complicated Spastic Paraplegia
    Article Snippet: .. Fluorescently labeled polymerase chain reaction (PCR) primers (Applied Biosystems, Foster City, CA) were used to amplify DNA samples using standard conditions, and PCR products were resolved on an Applied Biosystems 3130xl Genetic analyzer. .. SPG20 Sequencing Analysis Sequencing of SPG20 (NM_015087; NM_001142294-6) coding region was performed by SeqWright (Houston, TX) on PCR products after amplification of genomic DNA.

    Article Title: Pitfalls in the Denaturing High-Performance Liquid Chromatography Analysis of Mitochondrial DNA Mutation
    Article Snippet: .. Polymerase chain reaction (PCR) primers (Invitrogen, Carlsbad, CA) and conditions used for the amplification of the region of interest in the mitochondrial genome, restriction enzyme digestion of the amplicons with Dde I, heteroduplex formation, and DHPLC analysis of the samples have been described previously. .. In DHPLC purification of heteroduplex species, the measurement of heteroduplex proportion in a DNA sample was obtained during DHPLC analysis of the reannealed PCR amplicon as the ratio of heteroduplex peak area to total peak area (%).

    Article Title: Anti-human fibroblast growth factor-21 monoclonal antibody preparation, characterization and analysis of in vitro bioactivity
    Article Snippet: .. All polymerase chain reaction (PCR) primers ( and ) were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.). .. Sp2/0 lymphocytes, 3T3-L1 adipocytes and DH5α Escherichia coli were lab stocks.

    Article Title: Ex Vivo Induction of mRNA in Human Whole Blood as a New Platform of Drug and Dietary Supplement Development
    Article Snippet: .. Primers and Probes Polymerase chain reaction (PCR) primers and TaqMan probes were designed by Primer Express (Applied Biosystem, Foster City, CA, USA) and HYBsimulator (RNAture, Irvine, CA, USA) ( , ) (Supplemental Table 1). .. Oligonucleotides were synthesized by IDT (Coralville, IA, USA), Tsukuba Oligo Service (Tsukuba, Japan), Nippon EGT (Toyama, Japan), and Hokkaido System Science (Sapporo, Japan).

    Article Title: Inhibition of fibroblast growth factor receptor with AZD4547 mitigates juvenile nasopharyngeal angiofibroma
    Article Snippet: .. Polymerase chain reaction (PCR) primers to: FGFR-1 (F: AGAGGACAATGTGATGAAGATA; R: GGTCAAATAATGCCTCGGGT); FGFR-2 (F: AACGGGAAGGAGTTTAAGCA; R: CTTGTCAGATGGGACCACAC); FGFR-3 (F: AGGCCATCGGCATTGACA; R: GCATCGTCTTTCAGCATCTTCAC); FGFR-4 (F: CGCGGCGTCCACCACATT; R: GTGTGTACACCCGGTCAAAC); VEGFA (F: ATCTGCATGGTGATGTTGGA; R: GGGCAGAATCATCACGAAGT); and β -actin (F: AGGGGCCGGACTCGTCATACT; R: GGCGGCACCACCATGTACCCT) were obtained from Thermo-Fisher. .. Pan FGFR inhibitor AZD4547 was obtained from Chemietek (Indianapolis, IN), and VEGFR inhibitor SU5416 was obtained from Selleckchem (Houston, TX).

    Article Title: S-Adenosylmethionine Prevents Mallory Denk Body Formation in Drug-Primed Mice by Inhibiting the Epigenetic Memory
    Article Snippet: .. Polymerase chain reaction (PCR) primers were designed with the assistance of Primer Express software (Applied Biosystems, Foster City, CA). ..

    IA:

    Article Title: Ex Vivo Induction of mRNA in Human Whole Blood as a New Platform of Drug and Dietary Supplement Development
    Article Snippet: Primers and Probes Polymerase chain reaction (PCR) primers and TaqMan probes were designed by Primer Express (Applied Biosystem, Foster City, CA, USA) and HYBsimulator (RNAture, Irvine, CA, USA) ( , ) (Supplemental Table 1). .. Oligonucleotides were synthesized by IDT (Coralville, IA, USA), Tsukuba Oligo Service (Tsukuba, Japan), Nippon EGT (Toyama, Japan), and Hokkaido System Science (Sapporo, Japan).

    Plasmid Preparation:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Polymerase chain reaction (PCR) primers were purchased from Life Technologies. .. A 519-bp product (3TSR), a 282-bp product (TSR2 + KRFK), and a 273-bp product (TSR2 − KRFK) were isolated and cloned into the pSecTag2A expression vector (Invitrogen, Carlsbad, CA) using the Kpn I and Asc I restriction sites built into the PCR primers.

    Software:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: .. The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. The amplification reaction was set in a total volume of 20 µ l containing the PrimeSTAR Max DNA polymerase and PCR buffer (TaKaRa Biotechnology Co. Ltd., Dalian, China) and specific primers.

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: .. Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen. .. SYBR® Safe DNA gel stain was purchased from Invitrogen (Invitrogen Canada Inc., Burlington, Canada).

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The sizes of marker amplimers were determined (blinded to pedigree structure and subject characteristics) from the electropherogram using the Genotyper software package (ABI).

    Article Title: Developmental and Degenerative Features in a Complicated Spastic Paraplegia
    Article Snippet: After removal of low-quality calls and of Mendelian and non-Mendelian errors using Merlin software, the single nucleotide polymorphism (SNP) data were analyzed using Allegro software under a fully penetrant autosomal recessive model. For microsatellite analysis, highly polymorphic microsatellite markers were chosen from the Marshfield database in the University of California at Santa Cruz Genome Browser. .. Fluorescently labeled polymerase chain reaction (PCR) primers (Applied Biosystems, Foster City, CA) were used to amplify DNA samples using standard conditions, and PCR products were resolved on an Applied Biosystems 3130xl Genetic analyzer.

    Article Title: S-Adenosylmethionine Prevents Mallory Denk Body Formation in Drug-Primed Mice by Inhibiting the Epigenetic Memory
    Article Snippet: .. Polymerase chain reaction (PCR) primers were designed with the assistance of Primer Express software (Applied Biosystems, Foster City, CA). ..

    SYBR Green Assay:

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen. .. The iScript™ cDNA Synthesis Kit and iQ™ SYBR® Green Supermix were purchased from Bio-Rad Laboratories (Canada) Ltd. (Mississauga, Ontario).

    Selection:

    Article Title: Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-?
    Article Snippet: Paragraph title: Molecular Cloning, Cell Transfection, and Selection of Clones ... Polymerase chain reaction (PCR) primers were purchased from Life Technologies.

    Agarose Gel Electrophoresis:

    Article Title: Clinical and genetic investigation of families with type II Waardenburg syndrome
    Article Snippet: The online primer design software Primer 3 ( http://primer3.ut.ee/ ) was used to design the polymerase chain reaction (PCR) primers to amplify all exons, and the PCR primers (Invitrogen; Thermo Fisher Scientific, Inc., Beijing, China) to amplify boundary sequence of exon/intron of the candidate gene ( – ). .. Following amplification, the PCR products were subjected to agarose gel electrophoresis and purified using MiniBest Agarose Gel DNA Extraction kit Ver4.0 (TaKaRa Biotechnology Co. Ltd.).

    Electrophoresis:

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The sizes of the PCR products for the markers were determined from electropherograms produced with an ABI 3700 (Applied Biosystems, Foster City, CA), a 96-channel capillary electrophoresis device.

    Produced:

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The sizes of the PCR products for the markers were determined from electropherograms produced with an ABI 3700 (Applied Biosystems, Foster City, CA), a 96-channel capillary electrophoresis device.

    Marker:

    Article Title: Linkage Scan of Nicotine Dependence in the UCSF Family Alcoholism Study
    Article Snippet: Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Linkage analyses of cannabis dependence, craving, and withdrawal in the San Francisco Family Study
    Article Snippet: Briefly, DNA was isolated from whole blood using a commercial kit (Gentra, Minneapolis, MN), and genotypes for a panel of microsatellite polymorphisms were generated using fluorescently labeled polymerase chain reaction (PCR) primers (HD5, version 2.0; Applied Biosystems, Foster City, CA). .. The HD5 panel set consisted of 811 markers with an average marker-to-marker distance of 4.6 cM (maximum, 14 cM) and an average heterozygosity of greater than 77%.

    Article Title: Anti-human fibroblast growth factor-21 monoclonal antibody preparation, characterization and analysis of in vitro bioactivity
    Article Snippet: DNA maker2000 , λEcoT14 DNA Marker, and prestained protein MW Marker were purchased from Fermentas (Thermo Fisher Scientific, Inc.). .. All polymerase chain reaction (PCR) primers ( and ) were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.).

    Staining:

    Article Title: Glycochenodeoxycholic Acid Does Not Increase Transforming Growth Factor-Beta Expression in Bile Duct Epithelial Cells or Collagen Synthesis in Myofibroblasts
    Article Snippet: Polymerase chain reaction (PCR) primers were designed by the Oligo 5 computer software and synthesized by Invitrogen. .. SYBR® Safe DNA gel stain was purchased from Invitrogen (Invitrogen Canada Inc., Burlington, Canada).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gene exp abcb1 hs00184500 m1
    Quantification of mRNA expression of CSC-LC property-related genes in sorted cell fractions by real-time PCR. In SAS, CD44v3 + /CD24 − cells show significantly higher mRNA expression of transporter-related genes <t>(ABCB1</t> and ABCG2), ALDH1A1, anti-apoptotic genes (BCL2) and self-replication genes (Oct-4 and Nanog) than the other fractions. The experiments were repeated at least three times for each cell line, and almost identical results were obtained ( * P
    Gene Exp Abcb1 Hs00184500 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp abcb1 hs00184500 m1/product/Thermo Fisher
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    gene exp abcb1 hs00184500 m1 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    84
    Thermo Fisher adar1 site directed mutagenesis
    Validation and quantification of RNA editing activity in primary bone marrow-derived hematopoietic stem and progenitor cells transduced with <t>lentiviral-ADAR1.</t> CD34-selected cells from normal bone marrow (BM) samples (n = 3, average donor age = 64.3 ± 2.9 years old) were transduced with lentiviral (lenti)-ADAR1 or vector (ORF) control. After 4 days of culture, cells were lysed and processed for qRT-PCR and RESSq-PCR analysis. (A,B) Relative expression of lentivirus-derived (a) and total (b) ADAR1 levels in transduced BM samples (n = 3) showing increased human ADAR1 expression in ADAR1-transduced samples, with higher levels of total ADAR1 overexpression achieved in samples BM-410 and BM-416. (C,D) Representative Sanger sequencing analysis of high-fidelity PCR products amplified with primers flanking the APOBEC3D editing site showing increased G(I) peak in lenti-ADAR1 transduced cells that displayed robust ADAR1 expression (BM-410, C). (E,F) Quantification of sequencing peak height ratios and corresponding RESSq-PCR analysis in lenti-ORF and lenti-ADAR1 transduced BM samples.
    Adar1 Site Directed Mutagenesis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adar1 site directed mutagenesis/product/Thermo Fisher
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    adar1 site directed mutagenesis - by Bioz Stars, 2020-03
    84/100 stars
      Buy from Supplier

    99
    Thermo Fisher oligonucleotide transfection
    Systematic identification and functional evaluation of HCC metastasis-related miR-612 . (A) Hierarchical clustering of 32 differentially expressed miRNAs. The scale bar at the bottom depicts the standard deviation from the mean. PT and MT represent primary tumor and metastatic tumor, respectively. (B) Pathway perturbation assays. The heat map highlights the highest coefficient of miRNA interference on the signal pathway (red bracket). (C) Association between endogenous levels of miR-612 and motility and invasiveness in HCC cells. (C, left) Real-time PCR analysis to quantify the endogenous levels of miR-612 in HCCLM3, MHCC97H, HepG2, and SMMC-7721 cells. U6 was included as a control and data were normalized to the level of HCCLM3 cells. n = 3. (C, right) Transwell analysis to determine motility and invasion abilities of HCC cells. (D and E) Cell proliferation of HCCLM3 and HepG2 after transient <t>transfections</t> with indicated oligonucleotides. n = 6. (F) Representative images of migration and invasion assays. Bars, 100 µm. (G and H) Motility and invasion assays of HCCLM3 and HepG2 cells with indicated treatment. n = 3. WT, Lipo2000, mock, miR-612-o, or miR-612-i were defined as nontransfected, Lipo2000-treated, negative control oligonucleotide transfected, miR-612 mimic transfected, or miR-612 inhibitor transfected, respectively. Data are mean ± SEM and are representative of three independent experiments.
    Oligonucleotide Transfection, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 103 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide transfection/product/Thermo Fisher
    Average 99 stars, based on 103 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide transfection - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher cry1ab ac specific primers
    Molecular biology characterizations of transgenic plants. PCR analysis of T 3 transformants, showing partial amplification of (A) 746 bp <t>cry1Ab/Ac</t> gene (B) 489 bp hpt gene. (C) Southern blot analysis of genomic DNA of T 4 plants digested with Nco I and probed with DIG labeled 746 bp of cry1Ab/Ac showing single copy integration. (D) RT-PCR analysis of T 3 and T 4 plants of a same transgenic line showing 83 bp amplification of cry1Ab/Ac gene in transgenic plants and 145 bp 26S rRNA gene (internal control) in all plants.
    Cry1ab Ac Specific Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cry1ab ac specific primers/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cry1ab ac specific primers - by Bioz Stars, 2020-03
    92/100 stars
      Buy from Supplier

    Image Search Results


    Quantification of mRNA expression of CSC-LC property-related genes in sorted cell fractions by real-time PCR. In SAS, CD44v3 + /CD24 − cells show significantly higher mRNA expression of transporter-related genes (ABCB1 and ABCG2), ALDH1A1, anti-apoptotic genes (BCL2) and self-replication genes (Oct-4 and Nanog) than the other fractions. The experiments were repeated at least three times for each cell line, and almost identical results were obtained ( * P

    Journal: International Journal of Oncology

    Article Title: CD44v3+/CD24− cells possess cancer stem cell-like properties in human oral squamous cell carcinoma

    doi: 10.3892/ijo.2015.3261

    Figure Lengend Snippet: Quantification of mRNA expression of CSC-LC property-related genes in sorted cell fractions by real-time PCR. In SAS, CD44v3 + /CD24 − cells show significantly higher mRNA expression of transporter-related genes (ABCB1 and ABCG2), ALDH1A1, anti-apoptotic genes (BCL2) and self-replication genes (Oct-4 and Nanog) than the other fractions. The experiments were repeated at least three times for each cell line, and almost identical results were obtained ( * P

    Article Snippet: Gene expression assays and primer and probe mixes were used for ABCB1, ABCG2, ALDH1A1, BCL2, CFLAR, Oct4, Nanog, HIF1α, and β-actin [assay IDs (Hs 00184500_m1, Hs01053790_m1, Hs00946916_m1, Hs00608023_m1, Hs00153439_m1, Hs03666771, Hs04260366, Hs00153153_m1, and Hs99999903_m1, respectively; Applied Biosystems)], and thermal conditions were as follows: initial incubation at 95°C for 10 min, then 40 cycles alternating in turn with 95°C for 10 sec, 60°C for 20 sec, and 72°C for 15 sec, and then maintained at 72°C for 10 min.

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Validation and quantification of RNA editing activity in primary bone marrow-derived hematopoietic stem and progenitor cells transduced with lentiviral-ADAR1. CD34-selected cells from normal bone marrow (BM) samples (n = 3, average donor age = 64.3 ± 2.9 years old) were transduced with lentiviral (lenti)-ADAR1 or vector (ORF) control. After 4 days of culture, cells were lysed and processed for qRT-PCR and RESSq-PCR analysis. (A,B) Relative expression of lentivirus-derived (a) and total (b) ADAR1 levels in transduced BM samples (n = 3) showing increased human ADAR1 expression in ADAR1-transduced samples, with higher levels of total ADAR1 overexpression achieved in samples BM-410 and BM-416. (C,D) Representative Sanger sequencing analysis of high-fidelity PCR products amplified with primers flanking the APOBEC3D editing site showing increased G(I) peak in lenti-ADAR1 transduced cells that displayed robust ADAR1 expression (BM-410, C). (E,F) Quantification of sequencing peak height ratios and corresponding RESSq-PCR analysis in lenti-ORF and lenti-ADAR1 transduced BM samples.

    Journal: Journal of Translational Medicine

    Article Title: An RNA editing fingerprint of cancer stem cell reprogramming

    doi: 10.1186/s12967-014-0370-3

    Figure Lengend Snippet: Validation and quantification of RNA editing activity in primary bone marrow-derived hematopoietic stem and progenitor cells transduced with lentiviral-ADAR1. CD34-selected cells from normal bone marrow (BM) samples (n = 3, average donor age = 64.3 ± 2.9 years old) were transduced with lentiviral (lenti)-ADAR1 or vector (ORF) control. After 4 days of culture, cells were lysed and processed for qRT-PCR and RESSq-PCR analysis. (A,B) Relative expression of lentivirus-derived (a) and total (b) ADAR1 levels in transduced BM samples (n = 3) showing increased human ADAR1 expression in ADAR1-transduced samples, with higher levels of total ADAR1 overexpression achieved in samples BM-410 and BM-416. (C,D) Representative Sanger sequencing analysis of high-fidelity PCR products amplified with primers flanking the APOBEC3D editing site showing increased G(I) peak in lenti-ADAR1 transduced cells that displayed robust ADAR1 expression (BM-410, C). (E,F) Quantification of sequencing peak height ratios and corresponding RESSq-PCR analysis in lenti-ORF and lenti-ADAR1 transduced BM samples.

    Article Snippet: Lentiviral vector preparation and ADAR1 site-directed mutagenesis We have previously characterized lentiviral vectors (Thermo Scientific) for overexpression of human ADAR1 p150-IRES-GFP [ ].

    Techniques: Activity Assay, Derivative Assay, Transduction, Plasmid Preparation, Quantitative RT-PCR, Polymerase Chain Reaction, Expressing, Over Expression, Sequencing, Amplification

    In vitro humanized stromal co-culture model and RESSq-PCR analysis of primary CP CML cells transduced with lentiviral-ADAR1. (A) Schematic diagram of humanized bone marrow stromal co-culture assay. CD34-selected hematopoietic stem and progenitor cells (HSPC) isolated from patients with CP CML were transduced with lenti-ADAR1 or ORF control. After 3 days of culture, cells were transferred to SL/M2 mouse bone marrow stromal monolayers for co-culture and subsequent RESSq-PCR analysis. (B,C) Increased total ADAR1 (B) and lenti-ADAR1 (C) expression in transduced CP CML samples (n = 3). (D) RESSq-PCR analysis showing increased APOBEC3D RNA editing in lenti-ADAR1 transduced cells from patients with CP CML that harbored high ADAR1 expression after transduction. Horizontal dashed lines represent comparative RNA editing activity in K562-ADAR1 and K562-ORF cells.

    Journal: Journal of Translational Medicine

    Article Title: An RNA editing fingerprint of cancer stem cell reprogramming

    doi: 10.1186/s12967-014-0370-3

    Figure Lengend Snippet: In vitro humanized stromal co-culture model and RESSq-PCR analysis of primary CP CML cells transduced with lentiviral-ADAR1. (A) Schematic diagram of humanized bone marrow stromal co-culture assay. CD34-selected hematopoietic stem and progenitor cells (HSPC) isolated from patients with CP CML were transduced with lenti-ADAR1 or ORF control. After 3 days of culture, cells were transferred to SL/M2 mouse bone marrow stromal monolayers for co-culture and subsequent RESSq-PCR analysis. (B,C) Increased total ADAR1 (B) and lenti-ADAR1 (C) expression in transduced CP CML samples (n = 3). (D) RESSq-PCR analysis showing increased APOBEC3D RNA editing in lenti-ADAR1 transduced cells from patients with CP CML that harbored high ADAR1 expression after transduction. Horizontal dashed lines represent comparative RNA editing activity in K562-ADAR1 and K562-ORF cells.

    Article Snippet: Lentiviral vector preparation and ADAR1 site-directed mutagenesis We have previously characterized lentiviral vectors (Thermo Scientific) for overexpression of human ADAR1 p150-IRES-GFP [ ].

    Techniques: In Vitro, Co-Culture Assay, Polymerase Chain Reaction, Transduction, Co-culture Assay, Isolation, Expressing, Activity Assay

    Identification of an RNA editing fingerprint of malignant progenitor reprogramming, and stable ADAR1 overexpression in K562 cells. (A) LSC purification strategy for detection of CSC-associated RNA recoding. (B-D) RNA-sequencing analysis of FACS-purified CP and BC CML LSC [ 1 ] showing A-to-G RNA editing changes in MDM2, AZIN1 and APOBEC3D (n = 8 per group). (E) Lentiviral construct expressing human ADAR1 or a catalytically inactive form (ADAR1m). (F-H) qRT-PCR analysis of cDNA prepared from K562 lines using primers detecting ADAR1 lentivirus (F) and total human ADAR1 (G,H) showing K562 leukemia cells stably transduced with active ADAR1 or inactive ADAR1m express high levels of ADAR1 transcripts compared with vector open reading frame (ORF) control backbone. *p

    Journal: Journal of Translational Medicine

    Article Title: An RNA editing fingerprint of cancer stem cell reprogramming

    doi: 10.1186/s12967-014-0370-3

    Figure Lengend Snippet: Identification of an RNA editing fingerprint of malignant progenitor reprogramming, and stable ADAR1 overexpression in K562 cells. (A) LSC purification strategy for detection of CSC-associated RNA recoding. (B-D) RNA-sequencing analysis of FACS-purified CP and BC CML LSC [ 1 ] showing A-to-G RNA editing changes in MDM2, AZIN1 and APOBEC3D (n = 8 per group). (E) Lentiviral construct expressing human ADAR1 or a catalytically inactive form (ADAR1m). (F-H) qRT-PCR analysis of cDNA prepared from K562 lines using primers detecting ADAR1 lentivirus (F) and total human ADAR1 (G,H) showing K562 leukemia cells stably transduced with active ADAR1 or inactive ADAR1m express high levels of ADAR1 transcripts compared with vector open reading frame (ORF) control backbone. *p

    Article Snippet: Lentiviral vector preparation and ADAR1 site-directed mutagenesis We have previously characterized lentiviral vectors (Thermo Scientific) for overexpression of human ADAR1 p150-IRES-GFP [ ].

    Techniques: Over Expression, Purification, RNA Sequencing Assay, FACS, Construct, Expressing, Quantitative RT-PCR, Stable Transfection, Transduction, Plasmid Preparation

    Detection of increased RNA editing activity by RESSq-PCR analysis of primary chronic phase versus blast crisis CML progenitors. RNA extracted from FACS-purified CD34 + CD38 + Lin - primary CML progenitors was analyzed by RESSq-PCR to validate the RNA editing fingerprint of leukemic progression. (A) RESSq-PCR analysis detecting increased RNA editing in APOBEC3D in purified BC CML LSC versus CP progenitors. (B) RESSq-PCR analysis detecting increased RNA editing in AZIN1 in purified BC CML LSC versus CP progenitors. Horizontal dashed lines represent comparative RNA editing activity in K562-ADAR1 and K562-ORF cells.

    Journal: Journal of Translational Medicine

    Article Title: An RNA editing fingerprint of cancer stem cell reprogramming

    doi: 10.1186/s12967-014-0370-3

    Figure Lengend Snippet: Detection of increased RNA editing activity by RESSq-PCR analysis of primary chronic phase versus blast crisis CML progenitors. RNA extracted from FACS-purified CD34 + CD38 + Lin - primary CML progenitors was analyzed by RESSq-PCR to validate the RNA editing fingerprint of leukemic progression. (A) RESSq-PCR analysis detecting increased RNA editing in APOBEC3D in purified BC CML LSC versus CP progenitors. (B) RESSq-PCR analysis detecting increased RNA editing in AZIN1 in purified BC CML LSC versus CP progenitors. Horizontal dashed lines represent comparative RNA editing activity in K562-ADAR1 and K562-ORF cells.

    Article Snippet: Lentiviral vector preparation and ADAR1 site-directed mutagenesis We have previously characterized lentiviral vectors (Thermo Scientific) for overexpression of human ADAR1 p150-IRES-GFP [ ].

    Techniques: Activity Assay, Polymerase Chain Reaction, FACS, Purification

    RESSq-PCR assay primer design and RNA editing fingerprint validation in stable human ADAR1-overexpressing cells. (A,B) Primer design strategy showing RNA editing site-specific qRT-PCR (RESSq-PCR) primer design strategy (1) to selectively detect wild-type (A) or edited (G/I) bases using the Tetra-primer amplification refractory mutation system (ARMS) principles (A) . Adaptation of the RESSq-PCR primer design strategy (2) for positions that are not compatible with the Tetra-primer ARMS method due to significant differences in GC content directly upstream and downstream or the edited nucleotide position (B) . FW = forward primer, Rev = reverse primer, Pos = positive control flanking primers. (C) RESSq-PCR analysis of MDM2, APOBEC3D, GLI1 and AZIN1 RNA recoding in stably-transduced K562-ADAR1 cells compared with K562 wt, K562-ORF and K562-ADAR1m lines (n = 2-4 per site). *p

    Journal: Journal of Translational Medicine

    Article Title: An RNA editing fingerprint of cancer stem cell reprogramming

    doi: 10.1186/s12967-014-0370-3

    Figure Lengend Snippet: RESSq-PCR assay primer design and RNA editing fingerprint validation in stable human ADAR1-overexpressing cells. (A,B) Primer design strategy showing RNA editing site-specific qRT-PCR (RESSq-PCR) primer design strategy (1) to selectively detect wild-type (A) or edited (G/I) bases using the Tetra-primer amplification refractory mutation system (ARMS) principles (A) . Adaptation of the RESSq-PCR primer design strategy (2) for positions that are not compatible with the Tetra-primer ARMS method due to significant differences in GC content directly upstream and downstream or the edited nucleotide position (B) . FW = forward primer, Rev = reverse primer, Pos = positive control flanking primers. (C) RESSq-PCR analysis of MDM2, APOBEC3D, GLI1 and AZIN1 RNA recoding in stably-transduced K562-ADAR1 cells compared with K562 wt, K562-ORF and K562-ADAR1m lines (n = 2-4 per site). *p

    Article Snippet: Lentiviral vector preparation and ADAR1 site-directed mutagenesis We have previously characterized lentiviral vectors (Thermo Scientific) for overexpression of human ADAR1 p150-IRES-GFP [ ].

    Techniques: Polymerase Chain Reaction, Quantitative RT-PCR, Amplification, Mutagenesis, Positive Control, Stable Transfection

    Systematic identification and functional evaluation of HCC metastasis-related miR-612 . (A) Hierarchical clustering of 32 differentially expressed miRNAs. The scale bar at the bottom depicts the standard deviation from the mean. PT and MT represent primary tumor and metastatic tumor, respectively. (B) Pathway perturbation assays. The heat map highlights the highest coefficient of miRNA interference on the signal pathway (red bracket). (C) Association between endogenous levels of miR-612 and motility and invasiveness in HCC cells. (C, left) Real-time PCR analysis to quantify the endogenous levels of miR-612 in HCCLM3, MHCC97H, HepG2, and SMMC-7721 cells. U6 was included as a control and data were normalized to the level of HCCLM3 cells. n = 3. (C, right) Transwell analysis to determine motility and invasion abilities of HCC cells. (D and E) Cell proliferation of HCCLM3 and HepG2 after transient transfections with indicated oligonucleotides. n = 6. (F) Representative images of migration and invasion assays. Bars, 100 µm. (G and H) Motility and invasion assays of HCCLM3 and HepG2 cells with indicated treatment. n = 3. WT, Lipo2000, mock, miR-612-o, or miR-612-i were defined as nontransfected, Lipo2000-treated, negative control oligonucleotide transfected, miR-612 mimic transfected, or miR-612 inhibitor transfected, respectively. Data are mean ± SEM and are representative of three independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: miR-612 suppresses the invasive-metastatic cascade in hepatocellular carcinoma

    doi: 10.1084/jem.20120153

    Figure Lengend Snippet: Systematic identification and functional evaluation of HCC metastasis-related miR-612 . (A) Hierarchical clustering of 32 differentially expressed miRNAs. The scale bar at the bottom depicts the standard deviation from the mean. PT and MT represent primary tumor and metastatic tumor, respectively. (B) Pathway perturbation assays. The heat map highlights the highest coefficient of miRNA interference on the signal pathway (red bracket). (C) Association between endogenous levels of miR-612 and motility and invasiveness in HCC cells. (C, left) Real-time PCR analysis to quantify the endogenous levels of miR-612 in HCCLM3, MHCC97H, HepG2, and SMMC-7721 cells. U6 was included as a control and data were normalized to the level of HCCLM3 cells. n = 3. (C, right) Transwell analysis to determine motility and invasion abilities of HCC cells. (D and E) Cell proliferation of HCCLM3 and HepG2 after transient transfections with indicated oligonucleotides. n = 6. (F) Representative images of migration and invasion assays. Bars, 100 µm. (G and H) Motility and invasion assays of HCCLM3 and HepG2 cells with indicated treatment. n = 3. WT, Lipo2000, mock, miR-612-o, or miR-612-i were defined as nontransfected, Lipo2000-treated, negative control oligonucleotide transfected, miR-612 mimic transfected, or miR-612 inhibitor transfected, respectively. Data are mean ± SEM and are representative of three independent experiments.

    Article Snippet: At 24, 48, or 72 h after oligonucleotide transfection, 10 µl of the kit reagent was added to each well, and 2 h later all plates were scanned by a microplate reader (Thermo Fisher Scientific) at 450 nm.

    Techniques: Functional Assay, Standard Deviation, Real-time Polymerase Chain Reaction, Transfection, Migration, Negative Control

    Molecular biology characterizations of transgenic plants. PCR analysis of T 3 transformants, showing partial amplification of (A) 746 bp cry1Ab/Ac gene (B) 489 bp hpt gene. (C) Southern blot analysis of genomic DNA of T 4 plants digested with Nco I and probed with DIG labeled 746 bp of cry1Ab/Ac showing single copy integration. (D) RT-PCR analysis of T 3 and T 4 plants of a same transgenic line showing 83 bp amplification of cry1Ab/Ac gene in transgenic plants and 145 bp 26S rRNA gene (internal control) in all plants.

    Journal: Frontiers in Plant Science

    Article Title: Bt Jute Expressing Fused δ-Endotoxin Cry1Ab/Ac for Resistance to Lepidopteran Pests

    doi: 10.3389/fpls.2017.02188

    Figure Lengend Snippet: Molecular biology characterizations of transgenic plants. PCR analysis of T 3 transformants, showing partial amplification of (A) 746 bp cry1Ab/Ac gene (B) 489 bp hpt gene. (C) Southern blot analysis of genomic DNA of T 4 plants digested with Nco I and probed with DIG labeled 746 bp of cry1Ab/Ac showing single copy integration. (D) RT-PCR analysis of T 3 and T 4 plants of a same transgenic line showing 83 bp amplification of cry1Ab/Ac gene in transgenic plants and 145 bp 26S rRNA gene (internal control) in all plants.

    Article Snippet: The qRT-PCR reaction mixture comprised of cry1Ab/Ac specific primers (RTF5′-GACTGCTGGAGTGATTATCGACAGA-3′, RT5′-AGCTCGGTACCTCGACTTATTC AG-3′), 26SrRNA primers (F5′-GTTCCACACGAGATTTCTGTTC-3′, R5′-TTTTAGACCCAAGACC GGC-3′) and MAXIMA SYBR GREEN® (Thermo Scientific, Waltham, MA, United States).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Southern Blot, Labeling, Reverse Transcription Polymerase Chain Reaction

    Enzyme linked immunosorbent assay quantification showing variation in Cry1Ab/Ac protein expression in different transgenic plant lines. All data were expressed as the mean ± SE of 3 replicates. Significant difference ( ∗∗∗∗ P

    Journal: Frontiers in Plant Science

    Article Title: Bt Jute Expressing Fused δ-Endotoxin Cry1Ab/Ac for Resistance to Lepidopteran Pests

    doi: 10.3389/fpls.2017.02188

    Figure Lengend Snippet: Enzyme linked immunosorbent assay quantification showing variation in Cry1Ab/Ac protein expression in different transgenic plant lines. All data were expressed as the mean ± SE of 3 replicates. Significant difference ( ∗∗∗∗ P

    Article Snippet: The qRT-PCR reaction mixture comprised of cry1Ab/Ac specific primers (RTF5′-GACTGCTGGAGTGATTATCGACAGA-3′, RT5′-AGCTCGGTACCTCGACTTATTC AG-3′), 26SrRNA primers (F5′-GTTCCACACGAGATTTCTGTTC-3′, R5′-TTTTAGACCCAAGACC GGC-3′) and MAXIMA SYBR GREEN® (Thermo Scientific, Waltham, MA, United States).

    Techniques: Enzyme-linked Immunosorbent Assay, Expressing, Transgenic Assay

    Stages of Bt jute development. (A) Schematic map of transformation vector pCAMBIA1301- actin-cry1Ab/Ac-nos (without gus ) containing rice actin constitutive promoter (with its first intron), fused cry1Ab/Ac gene and nos terminator. Marked site for Nco I and portion in the gene was used as probe for Southern analysis (B) Isolated shoot tips from 5 day-old plants in infiltration media containing LBA4404 Agrobacterium cells. (C) Transformants (arrow marked) selected in hygromycin-B containing MS media remain healthy whereas non-transformed seedlings show browning and die. (D) Each transgenic plant of 90 DAS age, was subjected to WPB in the greenhouse with 10, second instar larvae. (E) Fibers of Bt jute and WT (non-transgenic) were compared after extraction where no significant differences were found in color, texture and quality.

    Journal: Frontiers in Plant Science

    Article Title: Bt Jute Expressing Fused δ-Endotoxin Cry1Ab/Ac for Resistance to Lepidopteran Pests

    doi: 10.3389/fpls.2017.02188

    Figure Lengend Snippet: Stages of Bt jute development. (A) Schematic map of transformation vector pCAMBIA1301- actin-cry1Ab/Ac-nos (without gus ) containing rice actin constitutive promoter (with its first intron), fused cry1Ab/Ac gene and nos terminator. Marked site for Nco I and portion in the gene was used as probe for Southern analysis (B) Isolated shoot tips from 5 day-old plants in infiltration media containing LBA4404 Agrobacterium cells. (C) Transformants (arrow marked) selected in hygromycin-B containing MS media remain healthy whereas non-transformed seedlings show browning and die. (D) Each transgenic plant of 90 DAS age, was subjected to WPB in the greenhouse with 10, second instar larvae. (E) Fibers of Bt jute and WT (non-transgenic) were compared after extraction where no significant differences were found in color, texture and quality.

    Article Snippet: The qRT-PCR reaction mixture comprised of cry1Ab/Ac specific primers (RTF5′-GACTGCTGGAGTGATTATCGACAGA-3′, RT5′-AGCTCGGTACCTCGACTTATTC AG-3′), 26SrRNA primers (F5′-GTTCCACACGAGATTTCTGTTC-3′, R5′-TTTTAGACCCAAGACC GGC-3′) and MAXIMA SYBR GREEN® (Thermo Scientific, Waltham, MA, United States).

    Techniques: Transformation Assay, Plasmid Preparation, Isolation, Mass Spectrometry, Transgenic Assay