Structured Review

Shanghai Generay Biotech polymerase chain reaction pcr primers
Polymerase Chain Reaction Pcr Primers, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr primers/product/Shanghai Generay Biotech
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction pcr primers - by Bioz Stars, 2020-03
86/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Luteolin decreases invasiveness, deactivates STAT3 signaling, and reverses interleukin-6 induced epithelial–mesenchymal transition and matrix metalloproteinase secretion of pancreatic cancer cells
Article Snippet: .. Polymerase chain reaction (PCR) primers were purchased from Generay Biotech (Shanghai, People’s Republic of China). .. Anti-phospho-STAT3 (Tyr705), anti-STAT3, anti-E-Cadherin, anti-N-Cadherin, anti-Vimentin, anti-Snail, anti-ZEB1/TCF8, anti-MMP2, and anti-MMP9 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA).

Modification:

Article Title: Luteolin decreases invasiveness, deactivates STAT3 signaling, and reverses interleukin-6 induced epithelial–mesenchymal transition and matrix metalloproteinase secretion of pancreatic cancer cells
Article Snippet: Roswell Park Memorial Institute (RPMI)-1640, Dulbecco’s Modified Eagle’s Medium (DMEM), and trypsin were purchased from GIBCO (Grand Island, NY, USA). .. Polymerase chain reaction (PCR) primers were purchased from Generay Biotech (Shanghai, People’s Republic of China).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Shanghai Generay Biotech akr1b10 mrna
    <t>AKR1B10</t> expression at (A) <t>mRNA</t> and (B) protein levels in A549 cells following interference. AKR1B10 mRNA expressions of the blank control group, the negative control group (NC) and the interference group were 0.137±0.008, 0.144±0.08 and 0.039±0.006, respectively. ## P
    Akr1b10 Mrna, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/akr1b10 mrna/product/Shanghai Generay Biotech
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    akr1b10 mrna - by Bioz Stars, 2020-03
    86/100 stars
      Buy from Supplier

    92
    Shanghai Generay Biotech qrt pcr primers
    Hsa_circ_0036877 can serve as a potential novel blood biomarker for early PE. a Expression of hsa_circ_0036877 in blood samples from 110 matched normal participants and 34 patients with PE at 24 weeks of gestation was detected by <t>qRT-PCR.</t> The expression of hsa_circ_0036877 in blood samples of PE (ΔCt mean ± s.e.m., 1.778 ± 0.6888) diagnosed after gestation based on ACOG was significantly higher than in normal controls (ΔCt mean ± s.e.m., 6.651 ± 0.2192). Higher ΔCt value indicated lower expression. Bars indicate means ± s.e.m. from independent experiments. *** p
    Qrt Pcr Primers, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr primers/product/Shanghai Generay Biotech
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    qrt pcr primers - by Bioz Stars, 2020-03
    92/100 stars
      Buy from Supplier

    99
    Shanghai Generay Biotech mirna specific primer sequences
    Expression profiles of candidate <t>miRNAs</t> in patients with and without CAD. The three candidate miRNAs were evaluated with <t>qRT-PCR</t> using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P
    Mirna Specific Primer Sequences, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirna specific primer sequences/product/Shanghai Generay Biotech
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    mirna specific primer sequences - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    AKR1B10 expression at (A) mRNA and (B) protein levels in A549 cells following interference. AKR1B10 mRNA expressions of the blank control group, the negative control group (NC) and the interference group were 0.137±0.008, 0.144±0.08 and 0.039±0.006, respectively. ## P

    Journal: Molecular Medicine Reports

    Article Title: Inhibiting proliferation and migration of lung cancer using small interfering RNA targeting on Aldo-keto reductase family 1 member B10

    doi: 10.3892/mmr.2017.8173

    Figure Lengend Snippet: AKR1B10 expression at (A) mRNA and (B) protein levels in A549 cells following interference. AKR1B10 mRNA expressions of the blank control group, the negative control group (NC) and the interference group were 0.137±0.008, 0.144±0.08 and 0.039±0.006, respectively. ## P

    Article Snippet: The primers used to detect AKR1B10 mRNA were (forward), 5′-CCCAGGTTCTGATCCGTTTC-3′ and (reverse), 5′-GGTTGCCATCTCCTCATCAC-3′ (Generay Biotech Co., Ltd., Shanghai, China).

    Techniques: Expressing, Negative Control

    Expression of AKR1B10 in A549, 95C and 95D cell lines by reverse transcription-quantitative polymerase chain reaction. The expression levels of AKR1B10 mRNA in A549, 95C and 95D cell lines were 0.095±0.002, 0.033±0.004 and 0.036±0.002, respectively. ## P

    Journal: Molecular Medicine Reports

    Article Title: Inhibiting proliferation and migration of lung cancer using small interfering RNA targeting on Aldo-keto reductase family 1 member B10

    doi: 10.3892/mmr.2017.8173

    Figure Lengend Snippet: Expression of AKR1B10 in A549, 95C and 95D cell lines by reverse transcription-quantitative polymerase chain reaction. The expression levels of AKR1B10 mRNA in A549, 95C and 95D cell lines were 0.095±0.002, 0.033±0.004 and 0.036±0.002, respectively. ## P

    Article Snippet: The primers used to detect AKR1B10 mRNA were (forward), 5′-CCCAGGTTCTGATCCGTTTC-3′ and (reverse), 5′-GGTTGCCATCTCCTCATCAC-3′ (Generay Biotech Co., Ltd., Shanghai, China).

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Hsa_circ_0036877 can serve as a potential novel blood biomarker for early PE. a Expression of hsa_circ_0036877 in blood samples from 110 matched normal participants and 34 patients with PE at 24 weeks of gestation was detected by qRT-PCR. The expression of hsa_circ_0036877 in blood samples of PE (ΔCt mean ± s.e.m., 1.778 ± 0.6888) diagnosed after gestation based on ACOG was significantly higher than in normal controls (ΔCt mean ± s.e.m., 6.651 ± 0.2192). Higher ΔCt value indicated lower expression. Bars indicate means ± s.e.m. from independent experiments. *** p

    Journal: Clinical Epigenetics

    Article Title: Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia

    doi: 10.1186/s13148-018-0482-3

    Figure Lengend Snippet: Hsa_circ_0036877 can serve as a potential novel blood biomarker for early PE. a Expression of hsa_circ_0036877 in blood samples from 110 matched normal participants and 34 patients with PE at 24 weeks of gestation was detected by qRT-PCR. The expression of hsa_circ_0036877 in blood samples of PE (ΔCt mean ± s.e.m., 1.778 ± 0.6888) diagnosed after gestation based on ACOG was significantly higher than in normal controls (ΔCt mean ± s.e.m., 6.651 ± 0.2192). Higher ΔCt value indicated lower expression. Bars indicate means ± s.e.m. from independent experiments. *** p

    Article Snippet: ΔCt = CTRNA − CTGapdh , which represents the amount of RNAs normalized relative to the amount of Gapdh . qRT-PCR primers from Generay Biotech Co., Ltd. (Shanghai, China) are listed in Additional file : Table S4.

    Techniques: Biomarker Assay, Expressing, Quantitative RT-PCR

    mRNA ( a ), lncRNA ( b ), and circRNA ( c ) expression validated by qRT-PCR. Genes determined to be differentially expressed in all SPE patients by microarray analysis were validated by qRT-PCR. The height of the columns in the chart represents the log-transformed average fold change in expression across the two groups of patients for each of the validated genes. Bars represent standard errors

    Journal: Clinical Epigenetics

    Article Title: Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia

    doi: 10.1186/s13148-018-0482-3

    Figure Lengend Snippet: mRNA ( a ), lncRNA ( b ), and circRNA ( c ) expression validated by qRT-PCR. Genes determined to be differentially expressed in all SPE patients by microarray analysis were validated by qRT-PCR. The height of the columns in the chart represents the log-transformed average fold change in expression across the two groups of patients for each of the validated genes. Bars represent standard errors

    Article Snippet: ΔCt = CTRNA − CTGapdh , which represents the amount of RNAs normalized relative to the amount of Gapdh . qRT-PCR primers from Generay Biotech Co., Ltd. (Shanghai, China) are listed in Additional file : Table S4.

    Techniques: Expressing, Quantitative RT-PCR, Microarray, Transformation Assay

    Hsa_circ_0036877 can serve as a potential novel blood biomarker for early PE. a Expression of hsa_circ_0036877 in blood samples from 110 matched normal participants and 34 patients with PE at 24 weeks of gestation was detected by qRT-PCR. The expression of hsa_circ_0036877 in blood samples of PE (ΔCt mean ± s.e.m., 1.778 ± 0.6888) diagnosed after gestation based on ACOG was significantly higher than in normal controls (ΔCt mean ± s.e.m., 6.651 ± 0.2192). Higher ΔCt value indicated lower expression. Bars indicate means ± s.e.m. from independent experiments. *** p

    Journal: Clinical Epigenetics

    Article Title: Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia

    doi: 10.1186/s13148-018-0482-3

    Figure Lengend Snippet: Hsa_circ_0036877 can serve as a potential novel blood biomarker for early PE. a Expression of hsa_circ_0036877 in blood samples from 110 matched normal participants and 34 patients with PE at 24 weeks of gestation was detected by qRT-PCR. The expression of hsa_circ_0036877 in blood samples of PE (ΔCt mean ± s.e.m., 1.778 ± 0.6888) diagnosed after gestation based on ACOG was significantly higher than in normal controls (ΔCt mean ± s.e.m., 6.651 ± 0.2192). Higher ΔCt value indicated lower expression. Bars indicate means ± s.e.m. from independent experiments. *** p

    Article Snippet: ΔCt = CTRNA − CTGapdh , which represents the amount of RNAs normalized relative to the amount of Gapdh . qRT-PCR primers from Generay Biotech Co., Ltd. (Shanghai, China) are listed in Additional file : Table S4.

    Techniques: Biomarker Assay, Expressing, Quantitative RT-PCR

    mRNA ( a ), lncRNA ( b ), and circRNA ( c ) expression validated by qRT-PCR. Genes determined to be differentially expressed in all SPE patients by microarray analysis were validated by qRT-PCR. The height of the columns in the chart represents the log-transformed average fold change in expression across the two groups of patients for each of the validated genes. Bars represent standard errors

    Journal: Clinical Epigenetics

    Article Title: Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia

    doi: 10.1186/s13148-018-0482-3

    Figure Lengend Snippet: mRNA ( a ), lncRNA ( b ), and circRNA ( c ) expression validated by qRT-PCR. Genes determined to be differentially expressed in all SPE patients by microarray analysis were validated by qRT-PCR. The height of the columns in the chart represents the log-transformed average fold change in expression across the two groups of patients for each of the validated genes. Bars represent standard errors

    Article Snippet: ΔCt = CTRNA − CTGapdh , which represents the amount of RNAs normalized relative to the amount of Gapdh . qRT-PCR primers from Generay Biotech Co., Ltd. (Shanghai, China) are listed in Additional file : Table S4.

    Techniques: Expressing, Quantitative RT-PCR, Microarray, Transformation Assay

    Expression profiles of candidate miRNAs in patients with and without CAD. The three candidate miRNAs were evaluated with qRT-PCR using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P

    Journal: BMC Cardiovascular Disorders

    Article Title: miR-941 as a promising biomarker for acute coronary syndrome

    doi: 10.1186/s12872-017-0653-8

    Figure Lengend Snippet: Expression profiles of candidate miRNAs in patients with and without CAD. The three candidate miRNAs were evaluated with qRT-PCR using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P

    Article Snippet: At the end of the PCR cycling, melt curve analysis was performed to validate the specific generation of the expected PCR product. miRNA-specific primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, PRC) based on the miRNA sequences obtained from the miRBase database (Release 20.0) as follows: hsa-miR-182-5p , UUUGGCAAUGGUAGAACUCACACU; hsa-miR-363-3p , AAUUGCACGGUAUCCAUCUGUA; and hsa-miR-941 , CACCCGGCUGUGUGCACAUGUGC).

    Techniques: Expressing, Quantitative RT-PCR

    Expression profiles of candidate miRNAs in patients with SA, NSTE-ACS, and STEMI. The three candidate miRNAs were evaluated by qRT-PCR using 56 samples (20 cases of SA, 18 cases of NSTE-ACS, and 18 cases of STEMI). ( a ) miR-941 , ( b ) miR-182-5p , and ( c ) miR-363-3p are shown. Abbreviations: CAD, coronary artery disease; SA, stable angina; NSTE-ACS, non-ST elevation acute coronary syndrome; STEMI, ST elevation myocardial infarction. * P

    Journal: BMC Cardiovascular Disorders

    Article Title: miR-941 as a promising biomarker for acute coronary syndrome

    doi: 10.1186/s12872-017-0653-8

    Figure Lengend Snippet: Expression profiles of candidate miRNAs in patients with SA, NSTE-ACS, and STEMI. The three candidate miRNAs were evaluated by qRT-PCR using 56 samples (20 cases of SA, 18 cases of NSTE-ACS, and 18 cases of STEMI). ( a ) miR-941 , ( b ) miR-182-5p , and ( c ) miR-363-3p are shown. Abbreviations: CAD, coronary artery disease; SA, stable angina; NSTE-ACS, non-ST elevation acute coronary syndrome; STEMI, ST elevation myocardial infarction. * P

    Article Snippet: At the end of the PCR cycling, melt curve analysis was performed to validate the specific generation of the expected PCR product. miRNA-specific primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, PRC) based on the miRNA sequences obtained from the miRBase database (Release 20.0) as follows: hsa-miR-182-5p , UUUGGCAAUGGUAGAACUCACACU; hsa-miR-363-3p , AAUUGCACGGUAUCCAUCUGUA; and hsa-miR-941 , CACCCGGCUGUGUGCACAUGUGC).

    Techniques: Expressing, Quantitative RT-PCR