polymerase chain reaction pcr primers  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Millipore polymerase chain reaction pcr primers
    Polymerase Chain Reaction Pcr Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr primers/product/Millipore
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr primers - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    MTT Assay:

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: .. Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Auranofin, 3-amino-1,2,4-triazole (3-AT), and radioimmunoprecipitation assay lysis buffer containing phenylmethyl-sulfonyl fluoride, protease inhibitor cocktail, and sodium orthovanadate were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX).

    Amplification:

    Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
    Article Snippet: The inserted sequences for pCri-11, 13, and 14 were amplified from pET-15b-SUMO1 , pMIS3.0E , and pKLSLt , respectively. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo-Scientific, respectively.

    Article Title: Whole-exome sequencing of sickle cell disease patients with hyperhemolysis syndrome suggests a role for rare variation in disease predisposition
    Article Snippet: Polymerase chain reaction (PCR) primers (Sigma-Aldrich) were designed using Primer-blast ). .. PCR amplification was done using DNA polymerase (PrimeSTAR GXL, Clontech Laboratories) with patients’ DNA as template, according to manufacturer’s instructions (annealing temperature 638C).

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Construct preparation Constructs spanning fragments of the gene coding for hα2 M, namely full-length hα2 M and its N- and C-terminal parts (N-hα2 M and C-hα2 M; for details on constructs, plasmids, vectors and primers, see Table and Fig. ), and the coding sequence for GRAB from Streptococcus pyogenes serotype M1 (UP Q7DAL7) were amplified with primers that introduced either restriction sites for directional cloning or overhangs for restriction-free cloning. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively.

    Agarose Gel Electrophoresis:

    Article Title: Whole-exome sequencing of sickle cell disease patients with hyperhemolysis syndrome suggests a role for rare variation in disease predisposition
    Article Snippet: Polymerase chain reaction (PCR) primers (Sigma-Aldrich) were designed using Primer-blast ). .. PCR products were visualized (1% agarose gel stained with ethidium bromide) and then sequenced (Genewiz).

    Radio Immunoprecipitation:

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Auranofin, 3-amino-1,2,4-triazole (3-AT), and radioimmunoprecipitation assay lysis buffer containing phenylmethyl-sulfonyl fluoride, protease inhibitor cocktail, and sodium orthovanadate were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX).

    Clone Assay:

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Construct preparation Constructs spanning fragments of the gene coding for hα2 M, namely full-length hα2 M and its N- and C-terminal parts (N-hα2 M and C-hα2 M; for details on constructs, plasmids, vectors and primers, see Table and Fig. ), and the coding sequence for GRAB from Streptococcus pyogenes serotype M1 (UP Q7DAL7) were amplified with primers that introduced either restriction sites for directional cloning or overhangs for restriction-free cloning. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively.

    Protease Inhibitor:

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: .. Chemicals Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Auranofin, 3-amino-1,2,4-triazole (3-AT), and radioimmunoprecipitation assay lysis buffer containing phenylmethyl-sulfonyl fluoride, protease inhibitor cocktail, and sodium orthovanadate were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX).

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: .. Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Role of Caenorhabditis elegans AKT1/2 and SGK-1 in Manganese Toxicity
    Article Snippet: .. Manganese chloride (MnCl2 ), cholesterol, nicotinamide adenine dinucleotide phosphate (NADPH), glutathione (GSH), glutathione reductase (GR), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). .. TaqMan primers used for qRT-PCR analysis were obtained from Life Technologies (Carlsbad, CA, USA).

    Polymerase Chain Reaction:

    Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
    Article Snippet: .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo-Scientific, respectively. .. PCR was performed using Phusion high-fidelity DNA polymerase (Thermo-Scientific) according to the manufacturer's instructions and following a standard optimisation step of a thermal gradient in each reaction.

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: .. Chemicals Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Lead (Pb) exposure induces dopaminergic neurotoxicity in Caenorhabditis elegans: Involvement of the dopamine transporter
    Article Snippet: .. 2.1 Reagents Reagents such as lead (II) acetate trihydrate [Pb(CH3 COO)2 ], cholesterol, albumin and polymerase chain reaction (PCR) primers were purchased from Sigma (St. Louis, MO, USA). .. TaqMan primers used for real-time quantitative reverse transcription PCR (qRT-PCR) analysis were obtained from Life Technologies (Carlsbad, CA, USA).

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: .. Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Auranofin, 3-amino-1,2,4-triazole (3-AT), and radioimmunoprecipitation assay lysis buffer containing phenylmethyl-sulfonyl fluoride, protease inhibitor cocktail, and sodium orthovanadate were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX).

    Article Title: Whole-exome sequencing of sickle cell disease patients with hyperhemolysis syndrome suggests a role for rare variation in disease predisposition
    Article Snippet: .. Polymerase chain reaction (PCR) primers (Sigma-Aldrich) were designed using Primer-blast ). .. PCR amplification was done using DNA polymerase (PrimeSTAR GXL, Clontech Laboratories) with patients’ DNA as template, according to manufacturer’s instructions (annealing temperature 638C).

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: .. Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Role of Caenorhabditis elegans AKT1/2 and SGK-1 in Manganese Toxicity
    Article Snippet: .. Manganese chloride (MnCl2 ), cholesterol, nicotinamide adenine dinucleotide phosphate (NADPH), glutathione (GSH), glutathione reductase (GR), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). .. TaqMan primers used for qRT-PCR analysis were obtained from Life Technologies (Carlsbad, CA, USA).

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively. .. PCR was performed using Phusion High Fidelity DNA polymerase (Thermo Scientific) according to the manufacturer’s instructions and following a standard optimization step by thermal gradient in each reaction.

    Quantitative RT-PCR:

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: Chemicals Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Lead (Pb) exposure induces dopaminergic neurotoxicity in Caenorhabditis elegans: Involvement of the dopamine transporter
    Article Snippet: 2.1 Reagents Reagents such as lead (II) acetate trihydrate [Pb(CH3 COO)2 ], cholesterol, albumin and polymerase chain reaction (PCR) primers were purchased from Sigma (St. Louis, MO, USA). .. TaqMan primers used for real-time quantitative reverse transcription PCR (qRT-PCR) analysis were obtained from Life Technologies (Carlsbad, CA, USA).

    Article Title: Mechanisms involved in anti-aging effects of guarana (Paullinia cupana) in Caenorhabditiselegans
    Article Snippet: Agar, ethanol (96%), chloroform, cholesterol, FUDR (5-fluoro-2′-deoxyuridine), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers, and bovine serum albumin (BSA) were purchased from Sigma (USA). .. TaqMan¯ primers used for qRT-PCR analysis and Trizol were purchased from Applied Biosystems/Thermo Fisher Scientific Corporation (USA).

    Article Title: Role of Caenorhabditis elegans AKT1/2 and SGK-1 in Manganese Toxicity
    Article Snippet: Manganese chloride (MnCl2 ), cholesterol, nicotinamide adenine dinucleotide phosphate (NADPH), glutathione (GSH), glutathione reductase (GR), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). .. TaqMan primers used for qRT-PCR analysis were obtained from Life Technologies (Carlsbad, CA, USA).

    Purification:

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively. .. DNA was purified with the OMEGA Biotek Purification Kit according to the manufacturer’s instructions, and all constructs were verified by DNA sequencing.

    Plasmid Preparation:

    Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
    Article Snippet: Paragraph title: Genetic manipulations and vector preparation ... Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo-Scientific, respectively.

    Sequencing:

    Article Title: Whole-exome sequencing of sickle cell disease patients with hyperhemolysis syndrome suggests a role for rare variation in disease predisposition
    Article Snippet: Dideoxy Sanger sequencing was used to validate candidate variants and to genotype candidate variants in the larger non-HHS control cohort ( ). .. Polymerase chain reaction (PCR) primers (Sigma-Aldrich) were designed using Primer-blast ).

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Construct preparation Constructs spanning fragments of the gene coding for hα2 M, namely full-length hα2 M and its N- and C-terminal parts (N-hα2 M and C-hα2 M; for details on constructs, plasmids, vectors and primers, see Table and Fig. ), and the coding sequence for GRAB from Streptococcus pyogenes serotype M1 (UP Q7DAL7) were amplified with primers that introduced either restriction sites for directional cloning or overhangs for restriction-free cloning. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively.

    Positron Emission Tomography:

    Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
    Article Snippet: The inserted sequences for pCri-11, 13, and 14 were amplified from pET-15b-SUMO1 , pMIS3.0E , and pKLSLt , respectively. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo-Scientific, respectively.

    Construct:

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Paragraph title: Construct preparation ... Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively.

    Expressing:

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: The vectors used were pCri-8a for bacterial expression, pIEx (Novagen) for expression in Drosophila melanogaster Schneider 2 embryonic cells (S2; Gibco), and pCMV-Sport 6 (Thermo Scientific) for expression in human Expi293F™ cells (Gibco). .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively.

    Modification:

    Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
    Article Snippet: The insert was cloned between the Nco I or Nde I and Xho I restriction sites and was modified to contain an Msc I or Nhe I restriction site immediately after the Nco I and Nde I sites, respectively. .. Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo-Scientific, respectively.

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Dulbecco's modified Eagle's media was purchased from Fisher Scientific (Mississauga, Ontario, Canada).

    Marker:

    Article Title: Role of Caenorhabditis elegans AKT1/2 and SGK-1 in Manganese Toxicity
    Article Snippet: Manganese chloride (MnCl2 ), cholesterol, nicotinamide adenine dinucleotide phosphate (NADPH), glutathione (GSH), glutathione reductase (GR), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). .. Trizol, SuperSignal West Pico chemiluminescent substrate and molecular weight marker for DNA were purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Staining:

    Article Title: Whole-exome sequencing of sickle cell disease patients with hyperhemolysis syndrome suggests a role for rare variation in disease predisposition
    Article Snippet: Polymerase chain reaction (PCR) primers (Sigma-Aldrich) were designed using Primer-blast ). .. PCR products were visualized (1% agarose gel stained with ethidium bromide) and then sequenced (Genewiz).

    Lysis:

    Article Title: Jadomycin breast cancer cytotoxicity is mediated by a copper-dependent, reactive oxygen species–inducing mechanism
    Article Snippet: Chemical and biological materials Thiazolyl blue methyltetrazolium bromide (MTT), N -acetyl cysteine (NAC), Triton X-100, H2 O2 30% (w/w) in water, paclitaxel, dimethylsulfoxide, methanol, sodium lactate, phenazine methosulfate, β -nicotinamide adenine dinucleotide, iodonitrotetrazolium chloride, copper (II) sulfate (CuSO4 ), d -penicillamine (d -Pen), MitoTEMPO, sodium diethyldithiocarbamate (DDC), ellagic acid (EA), and polymerase chain reaction (PCR) primers were purchased from Sigma Aldrich (Oakville, Ontario, Canada). .. Auranofin, 3-amino-1,2,4-triazole (3-AT), and radioimmunoprecipitation assay lysis buffer containing phenylmethyl-sulfonyl fluoride, protease inhibitor cocktail, and sodium orthovanadate were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX).

    Molecular Weight:

    Article Title: Role of Caenorhabditis elegans AKT1/2 and SGK-1 in Manganese Toxicity
    Article Snippet: Manganese chloride (MnCl2 ), cholesterol, nicotinamide adenine dinucleotide phosphate (NADPH), glutathione (GSH), glutathione reductase (GR), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), protease inhibitor, phosphatase inhibitor cocktails, polymerase chain reaction (PCR) primers and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). .. Trizol, SuperSignal West Pico chemiluminescent substrate and molecular weight marker for DNA were purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    DNA Sequencing:

    Article Title: Recombinant production of human α2-macroglobulin variants and interaction studies with recombinant G-related α2-macroglobulin binding protein and latent transforming growth factor-β2
    Article Snippet: Polymerase chain reaction (PCR) primers and DNA modifying enzymes were purchased from Sigma-Aldrich and Thermo Scientific, respectively. .. DNA was purified with the OMEGA Biotek Purification Kit according to the manufacturer’s instructions, and all constructs were verified by DNA sequencing.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Millipore mouse anti β catenin antibody
    miR‐342‐5p promoted endothelial–mesenchymal transition in vitro. A, HUVEC s were transfected with miR‐342‐5p, miR‐342‐5p ASO , or control. Cell migration was determined 24 hours after the transfection using a scratch assay. B, HUVEC s were transfected with miR‐342‐5p or control: (upper) Cell migration was determined 24 hours after the transfection using a Transwell assay; (middle and lower) cells were observed under bright field or fluorescence microscope after staining with anti–α‐ SMA and anti‐ CD 31. C, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, ZO ‐1, FSP 1, vimentin, Twist, <t>β‐catenin,</t> and Snail2 was determined 72 hours after transfection using qRT ‐ PCR . D, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, α‐ SMA , β‐catenin, and vimentin was determined 48 hours after the transfection using Western blot. E, Healthy pups at postnatal day 3 were injected intravitreally with miR‐342‐5p agomir. The level of miR‐342‐5p, CD 31, and α‐ SMA was determined on postnatal day 7 using qRT ‐ PCR . F, HUVEC s were transfected with control, miR‐342‐5p, or miR‐342‐5p plus endoglin. The expression of endoglin, CD 31, and β‐catenin was determined 72 hours after transfection with Western blot. Bars indicate mean± SD (n=5), * P
    Mouse Anti β Catenin Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti β catenin antibody/product/Millipore
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mouse anti β catenin antibody - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    88
    Millipore chip qrt pcr primers
    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for <t>qRT-PCR</t> analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p
    Chip Qrt Pcr Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chip qrt pcr primers/product/Millipore
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    chip qrt pcr primers - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    99
    Millipore hcmv dna polymerase genes
    Kinetics of <t>DNA</t> replication of wild-type (WT) viruses and representative recombinant HSV-1 (A) and <t>HCMV</t> (B) mutants. Vero cells and human foreskin fibroblasts were infected with recombinant viruses at MOIs of 0.01 (HSV-1) and 0.05 (HCMV), respectively. The viral DNA levels in the lysates of infected cells collected at 12 h and daily for 3 days (HSV-1) or daily for 8 days (HCMV) were measured by real-time PCR assays. Results represent the mean ± SEM viral genome copy numbers determined in triplicate wells at each time point. *, P
    Hcmv Dna Polymerase Genes, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hcmv dna polymerase genes/product/Millipore
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hcmv dna polymerase genes - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    miR‐342‐5p promoted endothelial–mesenchymal transition in vitro. A, HUVEC s were transfected with miR‐342‐5p, miR‐342‐5p ASO , or control. Cell migration was determined 24 hours after the transfection using a scratch assay. B, HUVEC s were transfected with miR‐342‐5p or control: (upper) Cell migration was determined 24 hours after the transfection using a Transwell assay; (middle and lower) cells were observed under bright field or fluorescence microscope after staining with anti–α‐ SMA and anti‐ CD 31. C, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, ZO ‐1, FSP 1, vimentin, Twist, β‐catenin, and Snail2 was determined 72 hours after transfection using qRT ‐ PCR . D, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, α‐ SMA , β‐catenin, and vimentin was determined 48 hours after the transfection using Western blot. E, Healthy pups at postnatal day 3 were injected intravitreally with miR‐342‐5p agomir. The level of miR‐342‐5p, CD 31, and α‐ SMA was determined on postnatal day 7 using qRT ‐ PCR . F, HUVEC s were transfected with control, miR‐342‐5p, or miR‐342‐5p plus endoglin. The expression of endoglin, CD 31, and β‐catenin was determined 72 hours after transfection with Western blot. Bars indicate mean± SD (n=5), * P

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: miR‐342‐5p Is a Notch Downstream Molecule and Regulates Multiple Angiogenic Pathways Including Notch, Vascular Endothelial Growth Factor and Transforming Growth Factor β Signaling

    doi: 10.1161/JAHA.115.003042

    Figure Lengend Snippet: miR‐342‐5p promoted endothelial–mesenchymal transition in vitro. A, HUVEC s were transfected with miR‐342‐5p, miR‐342‐5p ASO , or control. Cell migration was determined 24 hours after the transfection using a scratch assay. B, HUVEC s were transfected with miR‐342‐5p or control: (upper) Cell migration was determined 24 hours after the transfection using a Transwell assay; (middle and lower) cells were observed under bright field or fluorescence microscope after staining with anti–α‐ SMA and anti‐ CD 31. C, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, ZO ‐1, FSP 1, vimentin, Twist, β‐catenin, and Snail2 was determined 72 hours after transfection using qRT ‐ PCR . D, HUVEC s were transfected with miR‐342‐5p or control. The expression of CD 31, α‐ SMA , β‐catenin, and vimentin was determined 48 hours after the transfection using Western blot. E, Healthy pups at postnatal day 3 were injected intravitreally with miR‐342‐5p agomir. The level of miR‐342‐5p, CD 31, and α‐ SMA was determined on postnatal day 7 using qRT ‐ PCR . F, HUVEC s were transfected with control, miR‐342‐5p, or miR‐342‐5p plus endoglin. The expression of endoglin, CD 31, and β‐catenin was determined 72 hours after transfection with Western blot. Bars indicate mean± SD (n=5), * P

    Article Snippet: The primary antibodies included rabbit antihuman EVL (1:50; Santa Cruz Biotechnology), mouse antihuman endoglin (1:800; BD Biosciences), rabbit anti–phosphorylated Smad1/5 (1:1000; Cell Signaling), rabbit anti–phosphorylated Smad2/3 (1:500; Santa Cruz Biotechnology), rabbit anti–phosphorylated Akt (Ser 473, 1:800; Cell Signaling), rabbit anti‐Akt (1:800; Cell Signaling), rabbit anti–phosphorylated ERK (1:1000; Cell Signaling), rabbit anti‐ERK (1:1000; Cell Signaling), mouse anti‐β‐actin (1:1000; Sigma‐Aldrich), mouse anti‐CD31 antibody (1:1000; Abcam), rabbit anti–α‐smooth muscle actin antibody (1:200; Abcam), mouse anti–β‐catenin antibody (1:1000; Millipore), rabbit anti‐vimentin antibody (1:1000; Abcam).

    Techniques: In Vitro, Transfection, Allele-specific Oligonucleotide, Migration, Wound Healing Assay, Transwell Assay, Fluorescence, Microscopy, Staining, Expressing, Quantitative RT-PCR, Western Blot, Injection

    miR‐342‐5p antagonized TGF ‐β in endothelial cells. A, HUVEC s were cultured in the presence of TGF ‐β or PBS , and the expression of miR‐342‐5p and EVL mRNA was determined using quantitative reverse transcription polymerase chain reaction. B, HUVEC s were transfected with miR‐342‐5p ASO or control and cultured in the presence of TGF ‐β or PBS . Cells were trypsinized 72 hours after transfection and tested for lumen formation, and the number of branches and the length (×10 3 μm) of cell cords of the enclosed lumens were measured. C, Cells in (B) were tested for sprouting by using the fibrin gel beads assay. Images were captured under a microscope and sprouting was quantitatively analyzed by measuring the number and length (×10 2 μm) of sprouts. D, Cells in (B) were assayed for the protein levels of CD 31, α‐ SMA , β‐catenin, and vimentin 72 hours after the transfection by using Western blot. Bars indicate mean± SD (n=3), * P

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: miR‐342‐5p Is a Notch Downstream Molecule and Regulates Multiple Angiogenic Pathways Including Notch, Vascular Endothelial Growth Factor and Transforming Growth Factor β Signaling

    doi: 10.1161/JAHA.115.003042

    Figure Lengend Snippet: miR‐342‐5p antagonized TGF ‐β in endothelial cells. A, HUVEC s were cultured in the presence of TGF ‐β or PBS , and the expression of miR‐342‐5p and EVL mRNA was determined using quantitative reverse transcription polymerase chain reaction. B, HUVEC s were transfected with miR‐342‐5p ASO or control and cultured in the presence of TGF ‐β or PBS . Cells were trypsinized 72 hours after transfection and tested for lumen formation, and the number of branches and the length (×10 3 μm) of cell cords of the enclosed lumens were measured. C, Cells in (B) were tested for sprouting by using the fibrin gel beads assay. Images were captured under a microscope and sprouting was quantitatively analyzed by measuring the number and length (×10 2 μm) of sprouts. D, Cells in (B) were assayed for the protein levels of CD 31, α‐ SMA , β‐catenin, and vimentin 72 hours after the transfection by using Western blot. Bars indicate mean± SD (n=3), * P

    Article Snippet: The primary antibodies included rabbit antihuman EVL (1:50; Santa Cruz Biotechnology), mouse antihuman endoglin (1:800; BD Biosciences), rabbit anti–phosphorylated Smad1/5 (1:1000; Cell Signaling), rabbit anti–phosphorylated Smad2/3 (1:500; Santa Cruz Biotechnology), rabbit anti–phosphorylated Akt (Ser 473, 1:800; Cell Signaling), rabbit anti‐Akt (1:800; Cell Signaling), rabbit anti–phosphorylated ERK (1:1000; Cell Signaling), rabbit anti‐ERK (1:1000; Cell Signaling), mouse anti‐β‐actin (1:1000; Sigma‐Aldrich), mouse anti‐CD31 antibody (1:1000; Abcam), rabbit anti–α‐smooth muscle actin antibody (1:200; Abcam), mouse anti–β‐catenin antibody (1:1000; Millipore), rabbit anti‐vimentin antibody (1:1000; Abcam).

    Techniques: Cell Culture, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Allele-specific Oligonucleotide, Microscopy, Western Blot

    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Multiple Displacement Amplification, Quantitative RT-PCR, Expressing, Chromatin Immunoprecipitation, Sequencing

    REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Sequencing, Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Expressing

    Kinetics of DNA replication of wild-type (WT) viruses and representative recombinant HSV-1 (A) and HCMV (B) mutants. Vero cells and human foreskin fibroblasts were infected with recombinant viruses at MOIs of 0.01 (HSV-1) and 0.05 (HCMV), respectively. The viral DNA levels in the lysates of infected cells collected at 12 h and daily for 3 days (HSV-1) or daily for 8 days (HCMV) were measured by real-time PCR assays. Results represent the mean ± SEM viral genome copy numbers determined in triplicate wells at each time point. *, P

    Journal: Journal of Virology

    Article Title: Contrasting Effects of W781V and W780V Mutations in Helix N of Herpes Simplex Virus 1 and Human Cytomegalovirus DNA Polymerases on Antiviral Drug Susceptibility

    doi: 10.1128/JVI.03360-14

    Figure Lengend Snippet: Kinetics of DNA replication of wild-type (WT) viruses and representative recombinant HSV-1 (A) and HCMV (B) mutants. Vero cells and human foreskin fibroblasts were infected with recombinant viruses at MOIs of 0.01 (HSV-1) and 0.05 (HCMV), respectively. The viral DNA levels in the lysates of infected cells collected at 12 h and daily for 3 days (HSV-1) or daily for 8 days (HCMV) were measured by real-time PCR assays. Results represent the mean ± SEM viral genome copy numbers determined in triplicate wells at each time point. *, P

    Article Snippet: The HSV-1 and HCMV DNA polymerase genes were cloned into pCITE4a (EMD BioScience, San Diego, CA) using the NdeI/NcoI and NdeI/SacI restriction sites to generate pCITE-UL30 and pCITE-UL54, respectively.

    Techniques: Recombinant, Infection, Real-time Polymerase Chain Reaction

    DNA methyltransferase 1 (DNMT1)-mediated upregulation of CLDN6 expression by SB431542. ( A , B ) Real-time polymerase chain reaction (RT-PCR) and immunoblot analysis of DNMT1 and CLDN6, and densitometric analysis of relative gene expression levels after normalization to loading controls GAPDH and β-actin are presented. ( C ) DNMT1 activity assays. ( D ) Methylation-specific PCR (MSP) analysis of CpG island of CLDN6 promoter using bisulfite-treated genomic DNA isolated from MCF-7 and SKBR-3 cells. ( E ) CpG island methylation within the CLDN6 promoter region was measured by bisulfite sequencing in SKBR-3 cells. “Me” stands for methylated, and “U” stands for unmethylated. ( F ) Chromatin immunoprecipitation-polymerase chain reaction (ChIP-PCR) assay to detect the binding of DNMT1 to the promoter of CLDN6 (** p

    Journal: International Journal of Molecular Sciences

    Article Title: SMAD2 Inactivation Inhibits CLDN6 Methylation to Suppress Migration and Invasion of Breast Cancer Cells

    doi: 10.3390/ijms18091863

    Figure Lengend Snippet: DNA methyltransferase 1 (DNMT1)-mediated upregulation of CLDN6 expression by SB431542. ( A , B ) Real-time polymerase chain reaction (RT-PCR) and immunoblot analysis of DNMT1 and CLDN6, and densitometric analysis of relative gene expression levels after normalization to loading controls GAPDH and β-actin are presented. ( C ) DNMT1 activity assays. ( D ) Methylation-specific PCR (MSP) analysis of CpG island of CLDN6 promoter using bisulfite-treated genomic DNA isolated from MCF-7 and SKBR-3 cells. ( E ) CpG island methylation within the CLDN6 promoter region was measured by bisulfite sequencing in SKBR-3 cells. “Me” stands for methylated, and “U” stands for unmethylated. ( F ) Chromatin immunoprecipitation-polymerase chain reaction (ChIP-PCR) assay to detect the binding of DNMT1 to the promoter of CLDN6 (** p

    Article Snippet: Antibodies included anti-DNMT1 (1:500, Cell Signaling Technology), anti-IgG (Millipore), and anti-DNA polymerase II (Millipore); anti-IgG was the negative control and anti-DNA polymerase II was the positive control.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Activity Assay, Methylation, Polymerase Chain Reaction, Isolation, Methylation Sequencing, Chromatin Immunoprecipitation, Binding Assay