Structured Review

TaKaRa polymerase chain reaction pcr kit
(A) Identification of the fat-1 gene by <t>PCR;</t> screen of fat-1 gene positive <t>C57BL6</t> mice and fat-1 gene negative C57BL6 mice. (B) Gas liquid chromatography measured the amount of n-3 PUFAs and n-6 PUFAs of the mouse tail. PUFAs, polyunsaturated fatty acids; PCR, polymerase chain reaction.
Polymerase Chain Reaction Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr kit/product/TaKaRa
Average 99 stars, based on 14 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction pcr kit - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Endogenous n-3 polyunsaturated fatty acids protect against imiquimod-induced psoriasis-like inflammation via the IL-17/IL-23 axis"

Article Title: Endogenous n-3 polyunsaturated fatty acids protect against imiquimod-induced psoriasis-like inflammation via the IL-17/IL-23 axis

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2014.2136

(A) Identification of the fat-1 gene by PCR; screen of fat-1 gene positive C57BL6 mice and fat-1 gene negative C57BL6 mice. (B) Gas liquid chromatography measured the amount of n-3 PUFAs and n-6 PUFAs of the mouse tail. PUFAs, polyunsaturated fatty acids; PCR, polymerase chain reaction.
Figure Legend Snippet: (A) Identification of the fat-1 gene by PCR; screen of fat-1 gene positive C57BL6 mice and fat-1 gene negative C57BL6 mice. (B) Gas liquid chromatography measured the amount of n-3 PUFAs and n-6 PUFAs of the mouse tail. PUFAs, polyunsaturated fatty acids; PCR, polymerase chain reaction.

Techniques Used: Polymerase Chain Reaction, Mouse Assay, Gas Chromatography

Related Articles

Methylation Sequencing:

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: Paragraph title: Genomic DNA isolation and bisulfite sequencing ... The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A).

Clone Assay:

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: Double-stranded synthetic DNA was cloned into pDR274 (Addgene, #42250) expressing a single guide RNA (sgRNA). .. After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms
Article Snippet: The 5’ flanking region of the sense transcripts of SlLNR1 were obtained by RNA ligase-mediated rapid amplification of 5' cDNA ends First Choice ® RLM-RACE Kit (Invitrogen, USA), according to the instructions of the manufacturer, and the 3’ end was verified by 3’ RACE PCR kit (TAKARA). .. All the above PCR products were cloned into pMD19-T (Takara) and validated by sequencing.

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: The −0.92 kb to 0 kb of BCL6 gene was amplified from genomic DNA and cloned into the pMD® 18-T vector (TaKaRa, #D103A). .. The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A).

Amplification:

Article Title: Inference of the impact of insertion sequence (IS) elements on bacterial genome diversification through analysis of small-size structural polymorphisms in Escherichia coli O157 genomes
Article Snippet: .. Long-range PCR amplification of the O157 chromosomal segments was performed as previously described ( ) using an LA PCR kit (TaKaRa Bio, Inc.) and the primers previously prepared for WGPS analysis (WGPS-F and WGPS-R primers). ..

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: .. The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ). .. In vitro transcription-translation was performed according to the supplier’s instructions for a 1.4-ml reaction mixture by using a T7 coupled reticulocyte lysate system (TnT; Promega).

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: When a fimA genotype was not identified by the first PCR despite of positive for the P. gingivalis 16S rRNA gene, the two-step PCR procedure (nested PCR) was applied: At first, a DNA fragment was amplified with a set of fimA universal primers (fimA uni-F and fimA uni-R corresponding to P. gingivalis W83 genome 2237849–2237871 and 2239047–2239068, respectively) designed for common sequences among the six fimA genes using 40 cycles. .. Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment.

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms
Article Snippet: .. The 5’ flanking region of the sense transcripts of SlLNR1 were obtained by RNA ligase-mediated rapid amplification of 5' cDNA ends First Choice ® RLM-RACE Kit (Invitrogen, USA), according to the instructions of the manufacturer, and the 3’ end was verified by 3’ RACE PCR kit (TAKARA). .. Full sense transcript of the SlLNR1 was amplified with the primers designed according to the joint sequence by RT-PCR.

Article Title: Jmjd1a Demethylase-regulated Histone Modification Is Essential for cAMP-response Element Modulator-regulated Gene Expression and Spermatogenesis *
Article Snippet: Genomic DNA was purified from the TC-1 mouse embryonic stem (ES) cells with a 129SvEv/j strain background ( ) and used for amplifying the homologous arms of the Jmjd1a targeting vector by using an LA PCR kit (Takara Bio. .. The 5′ arm DNA was amplified by using primers Jmjd1a-5F (cggttaattaactttcctctttaggggcac) and Jmjd1a-5R (aatgcggccgcttgtaaaaccaaccaac).

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: .. The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A). ..

Article Title: Biotinylation of Deoxyguanosine at the Abasic Site in Double-Stranded Oligodeoxynucleotides
Article Snippet: After washing away unbound DNA, the biotinylated DNA was eluted and concentrated on NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan). .. The purified DNA oligonucleotides were amplified by the DNA polymerase chain reaction with Taq polymerase and the sets of primers.

Synthesized:

Article Title: Effects of rosuvastatin on atrial nerve sprouting and electrical remodeling in rabbits with myocardial infarction
Article Snippet: Total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized. .. The mRNA expression levels of TH and KCND3were detected with the RT-PCR reagent kit (Takara, Dalian, Liaoning, China).

Construct:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. Primer TGM2F is specific for the transgenic construct.

Real-time Polymerase Chain Reaction:

Article Title: Effects of rosuvastatin on atrial nerve sprouting and electrical remodeling in rabbits with myocardial infarction
Article Snippet: Paragraph title: Quantitative real-time PCR ... The mRNA expression levels of TH and KCND3were detected with the RT-PCR reagent kit (Takara, Dalian, Liaoning, China).

Incubation:

Article Title: Biotinylation of Deoxyguanosine at the Abasic Site in Double-Stranded Oligodeoxynucleotides
Article Snippet: The reaction was incubated at 37°C for 2 h. To remove the excess click reagents, the biotinylated DNA was purified on NAP-5 columns (GE Healthcare, USA). .. After washing away unbound DNA, the biotinylated DNA was eluted and concentrated on NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan).

Expressing:

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: Double-stranded synthetic DNA was cloned into pDR274 (Addgene, #42250) expressing a single guide RNA (sgRNA). .. After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

Article Title: Effects of rosuvastatin on atrial nerve sprouting and electrical remodeling in rabbits with myocardial infarction
Article Snippet: .. The mRNA expression levels of TH and KCND3were detected with the RT-PCR reagent kit (Takara, Dalian, Liaoning, China). ..

Hybridization:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The plasmid pEP4351 and genomic DNA of the WT strain CH3 were also subjected to hybridization analysis, for use as the positive and negative controls, respectively. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Inverse PCR:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The nucleotide sequence surrounding the transposon insertion site was determined using inverse PCR, as described elsewhere [ ]. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Generated:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The probe was generated and hybridization was conducted using the DIG DNA labeling and detection kit (Roche Diagnostics USA, Indianapolis, IN, USA), according to the manufacturer’s protocol. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen). .. Cas9 mRNA (Addgene #42251) was generated by linearization with PmeI, purified with PCR clean-up kit, and transcribed with mMESSAGE mMACHINE T7 Kit (Thermo Fisher Scientific).

Polymerase Chain Reaction:

Article Title: Inference of the impact of insertion sequence (IS) elements on bacterial genome diversification through analysis of small-size structural polymorphisms in Escherichia coli O157 genomes
Article Snippet: .. Long-range PCR amplification of the O157 chromosomal segments was performed as previously described ( ) using an LA PCR kit (TaKaRa Bio, Inc.) and the primers previously prepared for WGPS analysis (WGPS-F and WGPS-R primers). ..

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China). .. The nucleotide sequence was compared to sequence in the National Center for Biotechnology Information database using the BLASTX program [ ].

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: .. RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. RT-PCR primers were as follows: endogenous BmA3 , BmA3QPCR1F (5′-TACAATGAGCTGCGTGTCG-3′) and BmA3QPCR1R (5′-CGGGCGTGTTGAATGTTTC -3′); and Bmdsx mRNA transcribed from the transgene, TGM2F (5′-ATTGGCGGGACACGATC-3′) and TGM2R (5′-AGCGCTCCGTAGCACAA-3′).

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: .. The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ). .. In vitro transcription-translation was performed according to the supplier’s instructions for a 1.4-ml reaction mixture by using a T7 coupled reticulocyte lysate system (TnT; Promega).

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: .. After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen). .. Cas9 mRNA (Addgene #42251) was generated by linearization with PmeI, purified with PCR clean-up kit, and transcribed with mMESSAGE mMACHINE T7 Kit (Thermo Fisher Scientific).

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: .. Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment. .. Resultant PCR products were subjected to agarose gel electrophoresis using a 0.9% gel, and DNA stained with ethidium bromide was detected at 302 nm by use of ChemiDoc XRS Plus (Bio-Rad) Super Cool CCD Camera (resolution 1,392 × 1,040 pixels).

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms
Article Snippet: .. The 5’ flanking region of the sense transcripts of SlLNR1 were obtained by RNA ligase-mediated rapid amplification of 5' cDNA ends First Choice ® RLM-RACE Kit (Invitrogen, USA), according to the instructions of the manufacturer, and the 3’ end was verified by 3’ RACE PCR kit (TAKARA). .. Full sense transcript of the SlLNR1 was amplified with the primers designed according to the joint sequence by RT-PCR.

Article Title: Jmjd1a Demethylase-regulated Histone Modification Is Essential for cAMP-response Element Modulator-regulated Gene Expression and Spermatogenesis *
Article Snippet: .. Genomic DNA was purified from the TC-1 mouse embryonic stem (ES) cells with a 129SvEv/j strain background ( ) and used for amplifying the homologous arms of the Jmjd1a targeting vector by using an LA PCR kit (Takara Bio. ..

Article Title: Characterization of a novel germline PALB2 duplication in a hereditary breast and ovarian cancer family
Article Snippet: .. LR-PCR was performed using a forward primer in intron 12 and a reverse primer in 3′-untranslated region (UTR) of PALB2 and the TaKaRa LA PCR kit (TaKaRa, Clontech) following the manufacturer’s instructions. ..

Article Title: Biotinylation of Deoxyguanosine at the Abasic Site in Double-Stranded Oligodeoxynucleotides
Article Snippet: .. After washing away unbound DNA, the biotinylated DNA was eluted and concentrated on NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan). .. The purified DNA oligonucleotides were amplified by the DNA polymerase chain reaction with Taq polymerase and the sets of primers.

DNA Sequencing:

Article Title: Inference of the impact of insertion sequence (IS) elements on bacterial genome diversification through analysis of small-size structural polymorphisms in Escherichia coli O157 genomes
Article Snippet: Long-range PCR amplification of the O157 chromosomal segments was performed as previously described ( ) using an LA PCR kit (TaKaRa Bio, Inc.) and the primers previously prepared for WGPS analysis (WGPS-F and WGPS-R primers). .. DNA sequencing of PCR products was performed using the ABI 3710 autosequencer (Applied Biosystems, Inc.), as previously described ( ).

DNA Labeling:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The probe was generated and hybridization was conducted using the DIG DNA labeling and detection kit (Roche Diagnostics USA, Indianapolis, IN, USA), according to the manufacturer’s protocol. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: .. RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. RT-PCR primers were as follows: endogenous BmA3 , BmA3QPCR1F (5′-TACAATGAGCTGCGTGTCG-3′) and BmA3QPCR1R (5′-CGGGCGTGTTGAATGTTTC -3′); and Bmdsx mRNA transcribed from the transgene, TGM2F (5′-ATTGGCGGGACACGATC-3′) and TGM2R (5′-AGCGCTCCGTAGCACAA-3′).

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms
Article Snippet: Paragraph title: RT-PCR and RACE analysis ... The 5’ flanking region of the sense transcripts of SlLNR1 were obtained by RNA ligase-mediated rapid amplification of 5' cDNA ends First Choice ® RLM-RACE Kit (Invitrogen, USA), according to the instructions of the manufacturer, and the 3’ end was verified by 3’ RACE PCR kit (TAKARA).

Article Title: Effects of rosuvastatin on atrial nerve sprouting and electrical remodeling in rabbits with myocardial infarction
Article Snippet: .. The mRNA expression levels of TH and KCND3were detected with the RT-PCR reagent kit (Takara, Dalian, Liaoning, China). ..

Injection:

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen). .. Hormonally stimulated B6D2F1 (C57LB/6 × DBA2) female mice were mated to B6D2F1 male mice and zygotes were collected from oviducts at embryonic day 0.5 (E0.5). sgRNA (50 ng μl− 1 ) and Cas9 mRNA (100 ng μl− 1 ) were mixed and injected into the zygotes in M2 medium.

Binding Assay:

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ). .. The in vitro-translated FLAG-tagged product was dialyzed against BC100 (20 mM Tris-HCl [pH 7.9], 20% glycerol, 0.2 mM EDTA, 100 mM KCl, 1 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride), purified by binding to anti-FLAG M2 agarose (Eastman Kodak Co.), and eluted by using the FLAG peptide (final volume, 200 μl) as described previously ( ).

DNA Extraction:

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: Paragraph title: Genomic DNA isolation and bisulfite sequencing ... The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A).

Mutagenesis:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: Paragraph title: Characterization of the mutant strain RA1062 ... Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Isolation:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: RT-PCR Poly (A)+RNA was isolated individually using a Micro-Fast Track 2.0 mRNA-isolation kit (Invitrogen, www.invitrogen.com ) according to the protocol provided by the manufacturer. .. RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming.

Avidin-Biotin Assay:

Article Title: Biotinylation of Deoxyguanosine at the Abasic Site in Double-Stranded Oligodeoxynucleotides
Article Snippet: In order to remove nonbiotinylated DNA, the reaction solution was loaded on a monomeric avidin column. .. After washing away unbound DNA, the biotinylated DNA was eluted and concentrated on NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan).

Mouse Assay:

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: Paragraph title: Generation of Pramef12 Null mice by CRISPR/Cas9 ... After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

Sequencing:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The nucleotide sequence surrounding the transposon insertion site was determined using inverse PCR, as described elsewhere [ ]. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: The 3′ primer (5′-GGGAAGC TTATTTATCGTCATCGTCTTTGTAGTC CCAAG GGAGGGTCTTGG-3′) was designed to incorporate an in-frame FLAG peptide sequence and a stop codon (underlined) on the 3′ end of the coding sequence of human vigilin at amino acid residue 1264. .. The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ).

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: Generation of Pramef12 Null mice by CRISPR/Cas9 The guide RNA sequence (5′-GGCTTTGCATTGCGAGCTGT-3′) was designed to target DNA sequence downstream of the Pramef12 start codon. .. After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms
Article Snippet: The 5’ flanking region of the sense transcripts of SlLNR1 were obtained by RNA ligase-mediated rapid amplification of 5' cDNA ends First Choice ® RLM-RACE Kit (Invitrogen, USA), according to the instructions of the manufacturer, and the 3’ end was verified by 3’ RACE PCR kit (TAKARA). .. Full sense transcript of the SlLNR1 was amplified with the primers designed according to the joint sequence by RT-PCR.

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: Sequence analysis showed a bisulfite-modification efficiency of 99–100%. .. The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A).

CRISPR:

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: Paragraph title: Generation of Pramef12 Null mice by CRISPR/Cas9 ... After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

Nested PCR:

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: When a fimA genotype was not identified by the first PCR despite of positive for the P. gingivalis 16S rRNA gene, the two-step PCR procedure (nested PCR) was applied: At first, a DNA fragment was amplified with a set of fimA universal primers (fimA uni-F and fimA uni-R corresponding to P. gingivalis W83 genome 2237849–2237871 and 2239047–2239068, respectively) designed for common sequences among the six fimA genes using 40 cycles. .. Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment.

Purification:

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: Paragraph title: In vitro transcription and translation and purification of human vigilin. ... The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ).

Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice
Article Snippet: .. After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen). .. Cas9 mRNA (Addgene #42251) was generated by linearization with PmeI, purified with PCR clean-up kit, and transcribed with mMESSAGE mMACHINE T7 Kit (Thermo Fisher Scientific).

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: .. Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment. .. Resultant PCR products were subjected to agarose gel electrophoresis using a 0.9% gel, and DNA stained with ethidium bromide was detected at 302 nm by use of ChemiDoc XRS Plus (Bio-Rad) Super Cool CCD Camera (resolution 1,392 × 1,040 pixels).

Article Title: Jmjd1a Demethylase-regulated Histone Modification Is Essential for cAMP-response Element Modulator-regulated Gene Expression and Spermatogenesis *
Article Snippet: .. Genomic DNA was purified from the TC-1 mouse embryonic stem (ES) cells with a 129SvEv/j strain background ( ) and used for amplifying the homologous arms of the Jmjd1a targeting vector by using an LA PCR kit (Takara Bio. ..

Article Title: Biotinylation of Deoxyguanosine at the Abasic Site in Double-Stranded Oligodeoxynucleotides
Article Snippet: The reaction was incubated at 37°C for 2 h. To remove the excess click reagents, the biotinylated DNA was purified on NAP-5 columns (GE Healthcare, USA). .. After washing away unbound DNA, the biotinylated DNA was eluted and concentrated on NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan).

Plasmid Preparation:

Article Title: The Riemerella anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis
Article Snippet: The plasmid pEP4351 and genomic DNA of the WT strain CH3 were also subjected to hybridization analysis, for use as the positive and negative controls, respectively. .. Primer pairs specific for Tn4351 (primers TN-1 and IS4351-F) were used to amplify the sequences adjacent to the insertion site using the LA PCR kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China).

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: .. The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ). .. In vitro transcription-translation was performed according to the supplier’s instructions for a 1.4-ml reaction mixture by using a T7 coupled reticulocyte lysate system (TnT; Promega).

Article Title: Jmjd1a Demethylase-regulated Histone Modification Is Essential for cAMP-response Element Modulator-regulated Gene Expression and Spermatogenesis *
Article Snippet: .. Genomic DNA was purified from the TC-1 mouse embryonic stem (ES) cells with a 129SvEv/j strain background ( ) and used for amplifying the homologous arms of the Jmjd1a targeting vector by using an LA PCR kit (Takara Bio. ..

Article Title: AID assists DNMT1 to attenuate BCL6 expression through DNA methylation in diffuse large B-cell lymphoma cell lines
Article Snippet: After confirmation by Xbal and SalI restriction enzymes, the vector with the target fragments were commercially sequenced (Sunny). .. The fragments containing the first intron of BCL6 gene were amplified from genomic DNA by long-range PCR according to the manufacturer’s protocol of TaKaRa LA PCR™ Kit Ver.2.1 (TaKaRa, #RR013A).

Agarose Gel Electrophoresis:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. PCR conditions for Bmdsx were as follows: 94° C, 3 min followed by 35 cycles of 98° C, 20 seconds; 53.5° C, 30 seconds; and 72, 1 min. PCR products were analyzed on a 1.6 or 2% agarose gel.

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment. .. Resultant PCR products were subjected to agarose gel electrophoresis using a 0.9% gel, and DNA stained with ethidium bromide was detected at 302 nm by use of ChemiDoc XRS Plus (Bio-Rad) Super Cool CCD Camera (resolution 1,392 × 1,040 pixels).

In Vitro:

Article Title: In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein
Article Snippet: Paragraph title: In vitro transcription and translation and purification of human vigilin. ... The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone ( ).

Transgenic Assay:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. Primer TGM2F is specific for the transgenic construct.

Chromosome Walking:

Article Title: Characterization of a novel germline PALB2 duplication in a hereditary breast and ovarian cancer family
Article Snippet: LR-PCR was performed using a forward primer in intron 12 and a reverse primer in 3′-untranslated region (UTR) of PALB2 and the TaKaRa LA PCR kit (TaKaRa, Clontech) following the manufacturer’s instructions. .. The duplication breakpoint was more specifically identified using a primer walking strategy with a series of forward primers in the 3′-UTR and reverse primers in intron 12.

Produced:

Article Title: The Bmdsx transgene including trimmed introns is sex-specifically spliced in tissues of the silkworm, Bombyx mori
Article Snippet: .. RT-PCR was performed using the LA RNA PCR kit (Takara, www.takara-bio.co.jp ) following the manufacturer's instructions. cDNA was produced by random priming. .. RT-PCR primers were as follows: endogenous BmA3 , BmA3QPCR1F (5′-TACAATGAGCTGCGTGTCG-3′) and BmA3QPCR1R (5′-CGGGCGTGTTGAATGTTTC -3′); and Bmdsx mRNA transcribed from the transgene, TGM2F (5′-ATTGGCGGGACACGATC-3′) and TGM2R (5′-AGCGCTCCGTAGCACAA-3′).

Staining:

Article Title: Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children
Article Snippet: Secondly, after purification of the products with Nucleo-spin gel and a PCR clean-up kit (Takara Bio, Kusatsu, Japan), the fimA- specific PCR was performed with an aliquot (1 μl) of the eluent containing the DNA fragment. .. Resultant PCR products were subjected to agarose gel electrophoresis using a 0.9% gel, and DNA stained with ethidium bromide was detected at 302 nm by use of ChemiDoc XRS Plus (Bio-Rad) Super Cool CCD Camera (resolution 1,392 × 1,040 pixels).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa cdna preparation kit
    Northern analyses of a few select forward subtracted SSH <t>cDNA</t> clones . RNA isolated from the leaves of the control and 425 mM NaCl-treated plants and blotted onto Hybond N + membrane was hybridized with the individual radiolabelled ESTs. A RNA blot each for the control and NaCl-treated sample was hybridized with <t>PCR</t> amplified radiolabelled actin fragment. The horizontal bars against the individual genes represent increase (in%) in transcripts of the respective genes in response to NaCl treatment of the plant when compared to control. The values were obtained after normalization of the blot intensities of actin for the control and NaCl treated sample.
    Cdna Preparation Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna preparation kit/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cdna preparation kit - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    91
    TaKaRa ramos cells
    <t>AID</t> is transcribed in the Jurkat-AID and not in the control Jurkat cell line. AID transcription was monitored with RT-PCR in a control cell line, Jurkat, and in a Jurkat-AID cell line stably transfected with AID. A Burkitt lymphoma cell line <t>Ramos</t> constitutively expressing AID was used as a positive control for AID expression. G3PDH was used as an internal control. The bands corresponding to AID (380 bp) and G3PDH (1000 bp) are shown with black arrows.
    Ramos Cells, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ramos cells/product/TaKaRa
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ramos cells - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    96
    TaKaRa resolvase based mutation detection kit
    (A) AAV vector maps depicting the AAV-P Mecp2 -Cas9 vector and an inducible gRNA vector, AAV-gRNAi-TetR-GFP. (B) The gRNAi plasmid described in (A) , containing either a Tet gRNA or no gRNA (Empty), were co-transfected with pX330 Empty into N2A cells in the presence or absence of Dox. Nighty six hours post transfection, the cells were harvested, the genomic DNA was isolated and PCR, and RFLP analysis was performed to assess if genome editing had occurred at the Tet2 locus. Genome editing was not observed in cells that had received the gRNA Empty plasmid either in the presence or absence of Dox as expected. Cells that were transfected with a plasmid containing the gRNA Tet2 plasmid, did exhibit editing in the presence of Dox, but not in the absence of Dox, indicating that genome editing could be regulated in a Dox dependent manner. Similar results were observed in at least 3 independent samples per group. (C) The H1/TO promoter gRNA expression cassette was compared to gRNA expression cassettes composed of either a full length H1/TO promoter (H1-L/TO), a U6/TO promoter or a non-inducible U6 promoter (U6) for their ability to edit the Tet2 locus. Cells were transfected with the respective vectors in the presence or absence of Dox and genome editing was assessed 96 h post transfection ( n = 4 per groups). (D) Quantification of genome editing revealed that the inducible promoter gRNA expression cassettes were not significantly different from each other (n.s. = p ≤ 0.0778) in their ability to edit the Tet2 locus and they were all slightly but significantly different from the non-inducible U6 promoter construct ( * p ≤ 0.003). Four independent samples were screened with similar results. (E) Partial sequences of the inducible promoters used, highlighting the tetracycline operators (Tet-O) and transcriptional start site. (F) Genomic DNA from the same U6, H1/TO, and UTC samples used for (C,D) were subjected to a mutation detection kit (Clontech), in which the PCR amplified product was denatured, annealed and digested with <t>Resolvase</t> to directly detect edited DNA. (G) Levels of editing were comparable to those seen using the restriction digest PCR/RFLP analysis used for (C,D) . Again, levels of editing were significantly higher in the U6 group, compared to the H1/TO group (# p ≤ 0.005, Two Tailed T -test).
    Resolvase Based Mutation Detection Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/resolvase based mutation detection kit/product/TaKaRa
    Average 96 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    resolvase based mutation detection kit - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    Image Search Results


    Northern analyses of a few select forward subtracted SSH cDNA clones . RNA isolated from the leaves of the control and 425 mM NaCl-treated plants and blotted onto Hybond N + membrane was hybridized with the individual radiolabelled ESTs. A RNA blot each for the control and NaCl-treated sample was hybridized with PCR amplified radiolabelled actin fragment. The horizontal bars against the individual genes represent increase (in%) in transcripts of the respective genes in response to NaCl treatment of the plant when compared to control. The values were obtained after normalization of the blot intensities of actin for the control and NaCl treated sample.

    Journal: BMC Plant Biology

    Article Title: Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization

    doi: 10.1186/1471-2229-9-69

    Figure Lengend Snippet: Northern analyses of a few select forward subtracted SSH cDNA clones . RNA isolated from the leaves of the control and 425 mM NaCl-treated plants and blotted onto Hybond N + membrane was hybridized with the individual radiolabelled ESTs. A RNA blot each for the control and NaCl-treated sample was hybridized with PCR amplified radiolabelled actin fragment. The horizontal bars against the individual genes represent increase (in%) in transcripts of the respective genes in response to NaCl treatment of the plant when compared to control. The values were obtained after normalization of the blot intensities of actin for the control and NaCl treated sample.

    Article Snippet: Double stranded cDNA was prepared by reverse transcription of 4 μg of the purified mRNA in 20 μl reaction solution following the steps outlined in the cDNA preparation kit (Super SMART PCR cDNA synthesis kit, Clontech, Palo alto, USA).

    Techniques: Northern Blot, Clone Assay, Isolation, Northern blot, Polymerase Chain Reaction, Amplification

    AID is transcribed in the Jurkat-AID and not in the control Jurkat cell line. AID transcription was monitored with RT-PCR in a control cell line, Jurkat, and in a Jurkat-AID cell line stably transfected with AID. A Burkitt lymphoma cell line Ramos constitutively expressing AID was used as a positive control for AID expression. G3PDH was used as an internal control. The bands corresponding to AID (380 bp) and G3PDH (1000 bp) are shown with black arrows.

    Journal: PLoS ONE

    Article Title: Ectopic Expression of AID in a Non-B Cell Line Triggers A:T and G:C Point Mutations in Non-Replicating Episomal Vectors

    doi: 10.1371/journal.pone.0001480

    Figure Lengend Snippet: AID is transcribed in the Jurkat-AID and not in the control Jurkat cell line. AID transcription was monitored with RT-PCR in a control cell line, Jurkat, and in a Jurkat-AID cell line stably transfected with AID. A Burkitt lymphoma cell line Ramos constitutively expressing AID was used as a positive control for AID expression. G3PDH was used as an internal control. The bands corresponding to AID (380 bp) and G3PDH (1000 bp) are shown with black arrows.

    Article Snippet: AID cDNA was obtained from a cDNA library of Ramos cells (produced using the Creator SMART cDNA Library Construction Kit from Clontech) and initially cloned into the pCDNA-LIB plasmid (Clontech).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Stable Transfection, Transfection, Expressing, Positive Control

    (A) AAV vector maps depicting the AAV-P Mecp2 -Cas9 vector and an inducible gRNA vector, AAV-gRNAi-TetR-GFP. (B) The gRNAi plasmid described in (A) , containing either a Tet gRNA or no gRNA (Empty), were co-transfected with pX330 Empty into N2A cells in the presence or absence of Dox. Nighty six hours post transfection, the cells were harvested, the genomic DNA was isolated and PCR, and RFLP analysis was performed to assess if genome editing had occurred at the Tet2 locus. Genome editing was not observed in cells that had received the gRNA Empty plasmid either in the presence or absence of Dox as expected. Cells that were transfected with a plasmid containing the gRNA Tet2 plasmid, did exhibit editing in the presence of Dox, but not in the absence of Dox, indicating that genome editing could be regulated in a Dox dependent manner. Similar results were observed in at least 3 independent samples per group. (C) The H1/TO promoter gRNA expression cassette was compared to gRNA expression cassettes composed of either a full length H1/TO promoter (H1-L/TO), a U6/TO promoter or a non-inducible U6 promoter (U6) for their ability to edit the Tet2 locus. Cells were transfected with the respective vectors in the presence or absence of Dox and genome editing was assessed 96 h post transfection ( n = 4 per groups). (D) Quantification of genome editing revealed that the inducible promoter gRNA expression cassettes were not significantly different from each other (n.s. = p ≤ 0.0778) in their ability to edit the Tet2 locus and they were all slightly but significantly different from the non-inducible U6 promoter construct ( * p ≤ 0.003). Four independent samples were screened with similar results. (E) Partial sequences of the inducible promoters used, highlighting the tetracycline operators (Tet-O) and transcriptional start site. (F) Genomic DNA from the same U6, H1/TO, and UTC samples used for (C,D) were subjected to a mutation detection kit (Clontech), in which the PCR amplified product was denatured, annealed and digested with Resolvase to directly detect edited DNA. (G) Levels of editing were comparable to those seen using the restriction digest PCR/RFLP analysis used for (C,D) . Again, levels of editing were significantly higher in the U6 group, compared to the H1/TO group (# p ≤ 0.005, Two Tailed T -test).

    Journal: Frontiers in Molecular Neuroscience

    Article Title: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

    doi: 10.3389/fnmol.2016.00070

    Figure Lengend Snippet: (A) AAV vector maps depicting the AAV-P Mecp2 -Cas9 vector and an inducible gRNA vector, AAV-gRNAi-TetR-GFP. (B) The gRNAi plasmid described in (A) , containing either a Tet gRNA or no gRNA (Empty), were co-transfected with pX330 Empty into N2A cells in the presence or absence of Dox. Nighty six hours post transfection, the cells were harvested, the genomic DNA was isolated and PCR, and RFLP analysis was performed to assess if genome editing had occurred at the Tet2 locus. Genome editing was not observed in cells that had received the gRNA Empty plasmid either in the presence or absence of Dox as expected. Cells that were transfected with a plasmid containing the gRNA Tet2 plasmid, did exhibit editing in the presence of Dox, but not in the absence of Dox, indicating that genome editing could be regulated in a Dox dependent manner. Similar results were observed in at least 3 independent samples per group. (C) The H1/TO promoter gRNA expression cassette was compared to gRNA expression cassettes composed of either a full length H1/TO promoter (H1-L/TO), a U6/TO promoter or a non-inducible U6 promoter (U6) for their ability to edit the Tet2 locus. Cells were transfected with the respective vectors in the presence or absence of Dox and genome editing was assessed 96 h post transfection ( n = 4 per groups). (D) Quantification of genome editing revealed that the inducible promoter gRNA expression cassettes were not significantly different from each other (n.s. = p ≤ 0.0778) in their ability to edit the Tet2 locus and they were all slightly but significantly different from the non-inducible U6 promoter construct ( * p ≤ 0.003). Four independent samples were screened with similar results. (E) Partial sequences of the inducible promoters used, highlighting the tetracycline operators (Tet-O) and transcriptional start site. (F) Genomic DNA from the same U6, H1/TO, and UTC samples used for (C,D) were subjected to a mutation detection kit (Clontech), in which the PCR amplified product was denatured, annealed and digested with Resolvase to directly detect edited DNA. (G) Levels of editing were comparable to those seen using the restriction digest PCR/RFLP analysis used for (C,D) . Again, levels of editing were significantly higher in the U6 group, compared to the H1/TO group (# p ≤ 0.005, Two Tailed T -test).

    Article Snippet: Some in vitro samples were screened using the resolvase based mutation detection kit (Guide-it Mutation Detection Kit, Clontech, Cat #631443) following the manufacturer's instructions.

    Techniques: Plasmid Preparation, Transfection, Isolation, Polymerase Chain Reaction, Expressing, Construct, Mutagenesis, Amplification, Two Tailed Test

    SaCas9/CRISPR systemexhibits efficient genome editing in vitro . (A) AAV vector maps depicting EFS-SaCas9-HAFlagHA-KASH and gRNA EMX 1- sg 1 -GFP-KASH. EFS-SaCas9-HAFlagHA-KASH is an AAV vector that consists of an EFS promoter controlling the expression of the coding regions of SaCas9 followed by a self-cleaving P2A peptide sequence, and then an HA Flag HA epitope tag fused to a KASH domain. gRNA EMX 1- sg 1 -GFP-KASH is a dual transgene containing AAV vector with a U6-driven SaCas9 sgRNA expression cassette and a GFP-KASH transgene under the control of an EFS promoter. (B) EFS-SaCas9-HAFlagHA-KASH (SaCas9-KASH) viral plasmid was transfected into 293FT cells. For a control, similar cells were not transfected [untransfected control (UTC)]. Forty-eight hours later, an ICC for SaCas9, HA, and Flag expression was conducted. Images depict cells examined for SaCas9 (i and vii), Flag (iii and ix), and HA (v and xi) immunostaining. Similar fields of view also depict DAPI-stained nuclei [SaCas9 (ii and viii), Flag (iii and ix), and HA (vi and xii)]. Expression patterns followed expectation for cells transfected with SaCas9-KASH, with Flag (iii) and HA (v) expression appearing perinuclear and SaCas9 expression predominately in the nucleus (i). Notably UTCs do not exhibit signal for SaCas9 (vii), Flag (ix), and HA (xi) as expected. (C) gRNA Empty -GFP-KASH (GFP-KASH) viral plasmid was transfected into 293FT cells. For a control, similar cells were not transfected [untransfected control (UTC)]. Forty-eight hours later, native GFP fluorescence was observed for GFP-KASH expression. Similar fields of view also depict DAPI-stained nuclei [GFP (ii and iv). Expression patterns followed expectation for cells transfected with GFP-KASH, with GFP expression appearing perinuclear (i). Notably UTCs do not exhibit GFP expression (iii). (D) 293FT cells were co-transfected with EFS-SaCas9-HAFlagHA-KASH and U6-gRNA EMX 1- sg 1 -GFP-KASH/U6-gRNA EMX 1- sg 2 -GFP-KASH/U6-gRNA Empty -GFP-KASH. Ninety-six hours post transfection, cells were harvested and genomic DNA was isolated and purified. A 448 bp region of the EMX1 locus including the site targeted for editing via the two gRNA EMX1 was PCR amplified from the genomic DNA and analyzed for genome editing with a resolvase-based mutation detection kit (Clontech). Processed samples were electrophoresed on a 2% agarose, 0.5 × TBE gel stained with ethidium bromide. The top band on the gel is uncut DNA at 448 bp in length while the two smaller bands are edited DNA at 279 bp and 169 bp in length for EMX1-sg1, 258 and 190 bp in length for EMX1-sg2. Editing occurred in lanes 2–5 which received both EFS-SaCas9-HAFlagHA-KASH and either U6-gRNA EMX 1- sg 1 -GFP-KASH or U6-gRNA EMX 1- sg 2 -GFP-KASH, but not in lanes 6–7 as expected, which received EFS-SaCas9-HAFlagHA-KASH and U6-gRNA Empty -GFP-KASH. Similar results were obtained in four independent samples per group. (E) Optic densities of the bands were quantified using ImageJ. Editing efficiencies of gRNA EMX 1- sg 1 and gRNA EMX 1- sg 2 were 45 and 41%, respectively [ H (2, N = 12) = 7.652174, p = 0.0218, Kruskal–Wallis]. There was no significant difference between the two gRNAs in their editing efficiency [ t (6) = 0.5860, p = 0.5991]. ∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase

    doi: 10.3389/fnmol.2018.00413

    Figure Lengend Snippet: SaCas9/CRISPR systemexhibits efficient genome editing in vitro . (A) AAV vector maps depicting EFS-SaCas9-HAFlagHA-KASH and gRNA EMX 1- sg 1 -GFP-KASH. EFS-SaCas9-HAFlagHA-KASH is an AAV vector that consists of an EFS promoter controlling the expression of the coding regions of SaCas9 followed by a self-cleaving P2A peptide sequence, and then an HA Flag HA epitope tag fused to a KASH domain. gRNA EMX 1- sg 1 -GFP-KASH is a dual transgene containing AAV vector with a U6-driven SaCas9 sgRNA expression cassette and a GFP-KASH transgene under the control of an EFS promoter. (B) EFS-SaCas9-HAFlagHA-KASH (SaCas9-KASH) viral plasmid was transfected into 293FT cells. For a control, similar cells were not transfected [untransfected control (UTC)]. Forty-eight hours later, an ICC for SaCas9, HA, and Flag expression was conducted. Images depict cells examined for SaCas9 (i and vii), Flag (iii and ix), and HA (v and xi) immunostaining. Similar fields of view also depict DAPI-stained nuclei [SaCas9 (ii and viii), Flag (iii and ix), and HA (vi and xii)]. Expression patterns followed expectation for cells transfected with SaCas9-KASH, with Flag (iii) and HA (v) expression appearing perinuclear and SaCas9 expression predominately in the nucleus (i). Notably UTCs do not exhibit signal for SaCas9 (vii), Flag (ix), and HA (xi) as expected. (C) gRNA Empty -GFP-KASH (GFP-KASH) viral plasmid was transfected into 293FT cells. For a control, similar cells were not transfected [untransfected control (UTC)]. Forty-eight hours later, native GFP fluorescence was observed for GFP-KASH expression. Similar fields of view also depict DAPI-stained nuclei [GFP (ii and iv). Expression patterns followed expectation for cells transfected with GFP-KASH, with GFP expression appearing perinuclear (i). Notably UTCs do not exhibit GFP expression (iii). (D) 293FT cells were co-transfected with EFS-SaCas9-HAFlagHA-KASH and U6-gRNA EMX 1- sg 1 -GFP-KASH/U6-gRNA EMX 1- sg 2 -GFP-KASH/U6-gRNA Empty -GFP-KASH. Ninety-six hours post transfection, cells were harvested and genomic DNA was isolated and purified. A 448 bp region of the EMX1 locus including the site targeted for editing via the two gRNA EMX1 was PCR amplified from the genomic DNA and analyzed for genome editing with a resolvase-based mutation detection kit (Clontech). Processed samples were electrophoresed on a 2% agarose, 0.5 × TBE gel stained with ethidium bromide. The top band on the gel is uncut DNA at 448 bp in length while the two smaller bands are edited DNA at 279 bp and 169 bp in length for EMX1-sg1, 258 and 190 bp in length for EMX1-sg2. Editing occurred in lanes 2–5 which received both EFS-SaCas9-HAFlagHA-KASH and either U6-gRNA EMX 1- sg 1 -GFP-KASH or U6-gRNA EMX 1- sg 2 -GFP-KASH, but not in lanes 6–7 as expected, which received EFS-SaCas9-HAFlagHA-KASH and U6-gRNA Empty -GFP-KASH. Similar results were obtained in four independent samples per group. (E) Optic densities of the bands were quantified using ImageJ. Editing efficiencies of gRNA EMX 1- sg 1 and gRNA EMX 1- sg 2 were 45 and 41%, respectively [ H (2, N = 12) = 7.652174, p = 0.0218, Kruskal–Wallis]. There was no significant difference between the two gRNAs in their editing efficiency [ t (6) = 0.5860, p = 0.5991]. ∗ p

    Article Snippet: The resultant PCR amplified DNA was screened using the resolvase-based mutation detection kit (Clontech, Cat #631443).

    Techniques: CRISPR, In Vitro, Plasmid Preparation, Expressing, Sequencing, Transfection, Immunocytochemistry, Immunostaining, Staining, Fluorescence, Isolation, Purification, Polymerase Chain Reaction, Amplification, Mutagenesis