Structured Review

Roche polymerase chain reaction pcr fragment
Polymerase Chain Reaction Pcr Fragment, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr fragment/product/Roche
Average 88 stars, based on 2 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction pcr fragment - by Bioz Stars, 2020-07
88/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Identification of functional DNA variants in the constitutive promoter region of MDM2
Article Snippet: .. The corresponding promoter region was amplified in one polymerase chain reaction (PCR) fragment in a 50μL reaction volume, using the following conditions: 20 pmole of 5′ AAAGCCCAAATTTCCTTGCT3′ (forward) and 5′ CTCCATCTTTCCGACACACA3′ (reverse) primers, 2 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 1× Fast Start Taq DNA polymerase buffer and GC rich buffer, 2U Fast Start Taq DNA polymerase (Roche Diagnostics, Laval, Canada) and 15 ng of genomic DNA. .. The PCR program was 95°C for 3 min; 10 cycles with a denaturation at 95°C for 15 s; annealing at 55–50°C (each cycle decreases by 0.5°C) for 20 s and elongation at 68°C for 2 min; followed by 25 cycles at 50°C for annealing.

Amplification:

Article Title: Identification of functional DNA variants in the constitutive promoter region of MDM2
Article Snippet: .. The corresponding promoter region was amplified in one polymerase chain reaction (PCR) fragment in a 50μL reaction volume, using the following conditions: 20 pmole of 5′ AAAGCCCAAATTTCCTTGCT3′ (forward) and 5′ CTCCATCTTTCCGACACACA3′ (reverse) primers, 2 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (dNTPs), 1× Fast Start Taq DNA polymerase buffer and GC rich buffer, 2U Fast Start Taq DNA polymerase (Roche Diagnostics, Laval, Canada) and 15 ng of genomic DNA. .. The PCR program was 95°C for 3 min; 10 cycles with a denaturation at 95°C for 15 s; annealing at 55–50°C (each cycle decreases by 0.5°C) for 20 s and elongation at 68°C for 2 min; followed by 25 cycles at 50°C for annealing.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Roche apoptosis assessment
    The effect of telomerase downregulation on <t>apoptosis</t> in breast cancer MCF7 and MDA-MB-231 cells MCF7 ( open bars ) and MDA-MB-231 ( grey bars ) were treated with 100 nM specific siRNA or with camptothecin (as positive control) and subjected to Annexin V and propidium iodide labeling followed by flow cytometry analysis. All experiments (three separate) were performed in triplicates, and error bars show the (±SEM) values. * p
    Apoptosis Assessment, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apoptosis assessment/product/Roche
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    apoptosis assessment - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    88
    Roche sinr4a1
    TXNDC5 is a novel NR4A1-regulated gene involved in ER stress-mediated apoptosis (A) Heat map of genes including ROS metabolism genes regulated by <t>siNR4A1</t> in Panc-1 cells (left panel). Each cell in the matrix represents the expression level of a gene feature. Red and green reflect relatively high and low expression levels of genes, respectively, as indicated in the scale bar (a log2-transformed scale). (A, right panel and B) Panc-1 cells were transfected with each indicated siRNA for 48 hr and mRNA levels were determined by real-time PCR, as described in the Materials and Methods. TATA-binding protein (TBP) was used as an internal control and mRNA levels are presented as means with s.d. of three experiments. * P
    Sinr4a1, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sinr4a1/product/Roche
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sinr4a1 - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    85
    Roche hbv dna pcr fragment
    ( a ) Schematic representation of the intramolecular ligation technique to obtain the preCore and YMDD Pol motif close to each other. ( 1 ) The circle in a continuous line represents the complete <t>HBV</t> genome (3200 bp). The semicircles in discontinuous lines represent the first (first <t>PCR,</t> 2700 bp) and the nested (2194 bp for genotype A2 sequences and 2155 bp for genotype D sequences) PCR products. ( 2 ) The product obtained after intramolecular ligation and primers used to sequence the circular molecule ( Table 2 ) are indicated in the figure. ( b ) Agarose gel obtained after intramolecular digestion. Two markers (M-I and M-II) were loaded in the gel; band lengths are shown at the left side of the image. Two samples (S1 and S2) were loaded and four bands were detected; band lengths are indicated at the right side of the image. A band with an apparent size of 1700 bp was the circular molecule, with the preCore and YMDD Pol motif close to each other. Band B was the nested PCR product without ligation, and band D were dimers of nested PCR products without ligation. Band C corresponded to the ligated dimers. B , C and D bands were not used, because the main interest was to analyze regions from the same genome. ( c ) Sequence of the circular construct including the preCore region, YMDD polymerase motif (in box), and HindIII sequence. PreCore (1, 2, 14, 15, 28 and 29) and Core ( 1 ) codons analyzed in the text are also enclosed in boxes.
    Hbv Dna Pcr Fragment, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hbv dna pcr fragment/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hbv dna pcr fragment - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    92
    Roche thj 11t cells
    Immunocytochemical and Western blotting demonstration of resveratrol-induced alterations of RAR-β and PPAR-β/δ expression and their intracellular distribution patterns in <t>THJ-11T</t> cells. ( A ) Immunocytochemical staining (×40); ( B ) ImageJ-based quantification of nuclear labeling of RAR-β and PPAR-β/δ; ( C ) Levels of RAR-β and PPAR-β/δ determined by Western blotting. Control, 0.2% DMSO-treated cells; Resveratrol, 48 h 100 µM resveratrol treatment. Arrows indicate the portions in higher magnification in the insets (×80). Ratio, ratio between the levels of the target molecules and that of β-ACTIN; *, with statistical significance ( p
    Thj 11t Cells, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thj 11t cells/product/Roche
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    thj 11t cells - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    The effect of telomerase downregulation on apoptosis in breast cancer MCF7 and MDA-MB-231 cells MCF7 ( open bars ) and MDA-MB-231 ( grey bars ) were treated with 100 nM specific siRNA or with camptothecin (as positive control) and subjected to Annexin V and propidium iodide labeling followed by flow cytometry analysis. All experiments (three separate) were performed in triplicates, and error bars show the (±SEM) values. * p

    Journal: Molecular Biology Reports

    Article Title: Telomerase downregulation induces proapoptotic genes expression and initializes breast cancer cells apoptosis followed by DNA fragmentation in a cell type dependent manner

    doi: 10.1007/s11033-013-2600-9

    Figure Lengend Snippet: The effect of telomerase downregulation on apoptosis in breast cancer MCF7 and MDA-MB-231 cells MCF7 ( open bars ) and MDA-MB-231 ( grey bars ) were treated with 100 nM specific siRNA or with camptothecin (as positive control) and subjected to Annexin V and propidium iodide labeling followed by flow cytometry analysis. All experiments (three separate) were performed in triplicates, and error bars show the (±SEM) values. * p

    Article Snippet: Apoptosis assessment: TUNEL assay In order to estimate the influence of telomerase subunits downregulation on apoptosis in breast cancer cells a DNA fragmentation assay (In Situ Cell Death Detection Kit, TUNEL; Roche Diagnostics, IN, USA) was performed as previously described [ ].

    Techniques: Multiple Displacement Amplification, Positive Control, Labeling, Flow Cytometry, Cytometry

    The effect of telomerase silencing on expression of genes contributing to apoptosis control Cells were treated with 100 nM of TERT targeting siRNA and after 72 h the expression profile of proapoptotic ( a ) and antiapoptotic ( b ) genes in MCF7 and MDA-MB-231 cancer cells was assessed using qPCR. The experiment was performed in duplicates. The graphs represent the increase or decrease of the expression of the indicated genes relative to untreated control cells, (baseline at “0″ level)

    Journal: Molecular Biology Reports

    Article Title: Telomerase downregulation induces proapoptotic genes expression and initializes breast cancer cells apoptosis followed by DNA fragmentation in a cell type dependent manner

    doi: 10.1007/s11033-013-2600-9

    Figure Lengend Snippet: The effect of telomerase silencing on expression of genes contributing to apoptosis control Cells were treated with 100 nM of TERT targeting siRNA and after 72 h the expression profile of proapoptotic ( a ) and antiapoptotic ( b ) genes in MCF7 and MDA-MB-231 cancer cells was assessed using qPCR. The experiment was performed in duplicates. The graphs represent the increase or decrease of the expression of the indicated genes relative to untreated control cells, (baseline at “0″ level)

    Article Snippet: Apoptosis assessment: TUNEL assay In order to estimate the influence of telomerase subunits downregulation on apoptosis in breast cancer cells a DNA fragmentation assay (In Situ Cell Death Detection Kit, TUNEL; Roche Diagnostics, IN, USA) was performed as previously described [ ].

    Techniques: Expressing, Multiple Displacement Amplification, Real-time Polymerase Chain Reaction

    TXNDC5 is a novel NR4A1-regulated gene involved in ER stress-mediated apoptosis (A) Heat map of genes including ROS metabolism genes regulated by siNR4A1 in Panc-1 cells (left panel). Each cell in the matrix represents the expression level of a gene feature. Red and green reflect relatively high and low expression levels of genes, respectively, as indicated in the scale bar (a log2-transformed scale). (A, right panel and B) Panc-1 cells were transfected with each indicated siRNA for 48 hr and mRNA levels were determined by real-time PCR, as described in the Materials and Methods. TATA-binding protein (TBP) was used as an internal control and mRNA levels are presented as means with s.d. of three experiments. * P

    Journal: Molecular cancer research : MCR

    Article Title: The Orphan Nuclear Receptor NR4A1 (Nur77) Regulates Oxidative and Endoplasmic Reticulum Stress in Pancreatic Cancer Cells

    doi: 10.1158/1541-7786.MCR-13-0567

    Figure Lengend Snippet: TXNDC5 is a novel NR4A1-regulated gene involved in ER stress-mediated apoptosis (A) Heat map of genes including ROS metabolism genes regulated by siNR4A1 in Panc-1 cells (left panel). Each cell in the matrix represents the expression level of a gene feature. Red and green reflect relatively high and low expression levels of genes, respectively, as indicated in the scale bar (a log2-transformed scale). (A, right panel and B) Panc-1 cells were transfected with each indicated siRNA for 48 hr and mRNA levels were determined by real-time PCR, as described in the Materials and Methods. TATA-binding protein (TBP) was used as an internal control and mRNA levels are presented as means with s.d. of three experiments. * P

    Article Snippet: After incubation with siNR4A1 or DIM-C-pPhOH, cells were subjected to DNA fragmentation assay according to the manufacturer’s instructions (Cell Death Detection ELISAPLUS, Roche).

    Techniques: Expressing, Transformation Assay, Transfection, Real-time Polymerase Chain Reaction, Binding Assay

    Knockdown of NR4A1 induces ER stress and apoptosis in multiple cancer cell lines (A) Panc-1 cells were transfected with either siScr or siNR4A1, and TEM analysis was performed at 60 hr after transfection. The structure of the ER (arrows) in cells transfected with siNR4A1 showed morphological disorders. (B, C, and D) Panc-1, L3.6pL, MCF-7/RKO cells, respectively, were transfected with either siScr or siNR4A1 for 72 hr, and whole cell lysates were analyzed by western blot analysis. β-Actin was used as a loading control.

    Journal: Molecular cancer research : MCR

    Article Title: The Orphan Nuclear Receptor NR4A1 (Nur77) Regulates Oxidative and Endoplasmic Reticulum Stress in Pancreatic Cancer Cells

    doi: 10.1158/1541-7786.MCR-13-0567

    Figure Lengend Snippet: Knockdown of NR4A1 induces ER stress and apoptosis in multiple cancer cell lines (A) Panc-1 cells were transfected with either siScr or siNR4A1, and TEM analysis was performed at 60 hr after transfection. The structure of the ER (arrows) in cells transfected with siNR4A1 showed morphological disorders. (B, C, and D) Panc-1, L3.6pL, MCF-7/RKO cells, respectively, were transfected with either siScr or siNR4A1 for 72 hr, and whole cell lysates were analyzed by western blot analysis. β-Actin was used as a loading control.

    Article Snippet: After incubation with siNR4A1 or DIM-C-pPhOH, cells were subjected to DNA fragmentation assay according to the manufacturer’s instructions (Cell Death Detection ELISAPLUS, Roche).

    Techniques: Transfection, Transmission Electron Microscopy, Western Blot

    Knockdown of NR4A1 induces ER stress-mediated apoptosis by increasing ROS production in pancreatic cancer cells (A) Panc-1 cells were transfected with each indicated siRNA for 72 hr, and whole cell lysates were analyzed by western blot analysis. (B-D) Cells were transfected with siScr or siNR4A1 for 6 hr. At 60 hr after transfection, ROS production was measured by the oxidation of non-fluorescent DCFH-DA to fluorescent DCF using a fluorescence plate reader (B). # P

    Journal: Molecular cancer research : MCR

    Article Title: The Orphan Nuclear Receptor NR4A1 (Nur77) Regulates Oxidative and Endoplasmic Reticulum Stress in Pancreatic Cancer Cells

    doi: 10.1158/1541-7786.MCR-13-0567

    Figure Lengend Snippet: Knockdown of NR4A1 induces ER stress-mediated apoptosis by increasing ROS production in pancreatic cancer cells (A) Panc-1 cells were transfected with each indicated siRNA for 72 hr, and whole cell lysates were analyzed by western blot analysis. (B-D) Cells were transfected with siScr or siNR4A1 for 6 hr. At 60 hr after transfection, ROS production was measured by the oxidation of non-fluorescent DCFH-DA to fluorescent DCF using a fluorescence plate reader (B). # P

    Article Snippet: After incubation with siNR4A1 or DIM-C-pPhOH, cells were subjected to DNA fragmentation assay according to the manufacturer’s instructions (Cell Death Detection ELISAPLUS, Roche).

    Techniques: Transfection, Western Blot, Fluorescence

    2D-PAGE gels showing differentially expressed proteins in Panc-1 cells transfected with siNR4A1 and functional classification of the proteins . Functional distribution (B) and canonical pathway (C) of the 38 identified proteins. Assignments were made based on information from the NCBI, the Swiss-Prot/TrEMBL Protein Knowledge Base, and the Ingenuity Pathways Knowledge Base. Enlarged images of protein spots for which image analysis software reported ≥2-fold differences in accumulation in siNR4A1-transfected cells are shown (D, left panel). Panc-1 cells were transfected with either siScr or siNR4A1 for 60 hr, and whole cell lysates were analyzed by western blot analysis (D, right panel).

    Journal: Molecular cancer research : MCR

    Article Title: The Orphan Nuclear Receptor NR4A1 (Nur77) Regulates Oxidative and Endoplasmic Reticulum Stress in Pancreatic Cancer Cells

    doi: 10.1158/1541-7786.MCR-13-0567

    Figure Lengend Snippet: 2D-PAGE gels showing differentially expressed proteins in Panc-1 cells transfected with siNR4A1 and functional classification of the proteins . Functional distribution (B) and canonical pathway (C) of the 38 identified proteins. Assignments were made based on information from the NCBI, the Swiss-Prot/TrEMBL Protein Knowledge Base, and the Ingenuity Pathways Knowledge Base. Enlarged images of protein spots for which image analysis software reported ≥2-fold differences in accumulation in siNR4A1-transfected cells are shown (D, left panel). Panc-1 cells were transfected with either siScr or siNR4A1 for 60 hr, and whole cell lysates were analyzed by western blot analysis (D, right panel).

    Article Snippet: After incubation with siNR4A1 or DIM-C-pPhOH, cells were subjected to DNA fragmentation assay according to the manufacturer’s instructions (Cell Death Detection ELISAPLUS, Roche).

    Techniques: Polyacrylamide Gel Electrophoresis, Transfection, Functional Assay, Software, Western Blot

    ( a ) Schematic representation of the intramolecular ligation technique to obtain the preCore and YMDD Pol motif close to each other. ( 1 ) The circle in a continuous line represents the complete HBV genome (3200 bp). The semicircles in discontinuous lines represent the first (first PCR, 2700 bp) and the nested (2194 bp for genotype A2 sequences and 2155 bp for genotype D sequences) PCR products. ( 2 ) The product obtained after intramolecular ligation and primers used to sequence the circular molecule ( Table 2 ) are indicated in the figure. ( b ) Agarose gel obtained after intramolecular digestion. Two markers (M-I and M-II) were loaded in the gel; band lengths are shown at the left side of the image. Two samples (S1 and S2) were loaded and four bands were detected; band lengths are indicated at the right side of the image. A band with an apparent size of 1700 bp was the circular molecule, with the preCore and YMDD Pol motif close to each other. Band B was the nested PCR product without ligation, and band D were dimers of nested PCR products without ligation. Band C corresponded to the ligated dimers. B , C and D bands were not used, because the main interest was to analyze regions from the same genome. ( c ) Sequence of the circular construct including the preCore region, YMDD polymerase motif (in box), and HindIII sequence. PreCore (1, 2, 14, 15, 28 and 29) and Core ( 1 ) codons analyzed in the text are also enclosed in boxes.

    Journal: Nucleic Acids Research

    Article Title: Ultra-deep pyrosequencing analysis of the hepatitis B virus preCore region and main catalytic motif of the viral polymerase in the same viral genome

    doi: 10.1093/nar/gkr451

    Figure Lengend Snippet: ( a ) Schematic representation of the intramolecular ligation technique to obtain the preCore and YMDD Pol motif close to each other. ( 1 ) The circle in a continuous line represents the complete HBV genome (3200 bp). The semicircles in discontinuous lines represent the first (first PCR, 2700 bp) and the nested (2194 bp for genotype A2 sequences and 2155 bp for genotype D sequences) PCR products. ( 2 ) The product obtained after intramolecular ligation and primers used to sequence the circular molecule ( Table 2 ) are indicated in the figure. ( b ) Agarose gel obtained after intramolecular digestion. Two markers (M-I and M-II) were loaded in the gel; band lengths are shown at the left side of the image. Two samples (S1 and S2) were loaded and four bands were detected; band lengths are indicated at the right side of the image. A band with an apparent size of 1700 bp was the circular molecule, with the preCore and YMDD Pol motif close to each other. Band B was the nested PCR product without ligation, and band D were dimers of nested PCR products without ligation. Band C corresponded to the ligated dimers. B , C and D bands were not used, because the main interest was to analyze regions from the same genome. ( c ) Sequence of the circular construct including the preCore region, YMDD polymerase motif (in box), and HindIII sequence. PreCore (1, 2, 14, 15, 28 and 29) and Core ( 1 ) codons analyzed in the text are also enclosed in boxes.

    Article Snippet: Optimal results were obtained with 0.5 ng/µ1 of the HBV DNA-PCR fragment, and 1 U of T4 DNA ligase (Roche Diagnostics GmbH).

    Techniques: Ligation, Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis, Nested PCR, Construct

    Immunocytochemical and Western blotting demonstration of resveratrol-induced alterations of RAR-β and PPAR-β/δ expression and their intracellular distribution patterns in THJ-11T cells. ( A ) Immunocytochemical staining (×40); ( B ) ImageJ-based quantification of nuclear labeling of RAR-β and PPAR-β/δ; ( C ) Levels of RAR-β and PPAR-β/δ determined by Western blotting. Control, 0.2% DMSO-treated cells; Resveratrol, 48 h 100 µM resveratrol treatment. Arrows indicate the portions in higher magnification in the insets (×80). Ratio, ratio between the levels of the target molecules and that of β-ACTIN; *, with statistical significance ( p

    Journal: International Journal of Molecular Sciences

    Article Title: Resveratrol Suppresses the Growth and Enhances Retinoic Acid Sensitivity of Anaplastic Thyroid Cancer Cells

    doi: 10.3390/ijms19041030

    Figure Lengend Snippet: Immunocytochemical and Western blotting demonstration of resveratrol-induced alterations of RAR-β and PPAR-β/δ expression and their intracellular distribution patterns in THJ-11T cells. ( A ) Immunocytochemical staining (×40); ( B ) ImageJ-based quantification of nuclear labeling of RAR-β and PPAR-β/δ; ( C ) Levels of RAR-β and PPAR-β/δ determined by Western blotting. Control, 0.2% DMSO-treated cells; Resveratrol, 48 h 100 µM resveratrol treatment. Arrows indicate the portions in higher magnification in the insets (×80). Ratio, ratio between the levels of the target molecules and that of β-ACTIN; *, with statistical significance ( p

    Article Snippet: The DNA fragmentation assay in THJ-11T cells on coverslips, treated with both RA and resveratrol, was performed by using a modification of the terminal deoxynucleotide transferase (TdT)-mediated dUTP-biotin nick end-labeling method (TUNEL; Roche Inc., Basel, Switzerland).

    Techniques: Western Blot, Expressing, Staining, Labeling

    Resveratrol reverses the retinoic acid sensitivity of THJ-11T cells. ( A ) H/E staining (×40); ( B ) deoxynucleotidyl transferase-mediated dUTP-biotin nick and labeling assay (TUNEL) for apoptotic cell labeling (Green in color; ×40); ( C ) MTT cell proliferation assay; ( D ) viable cell counting; ( E ) immunocytochemical staining of thyroglobulin (Tg) and E-cadherin (×40). Control, cultured in 0.2% dimethylsulfoxide (DMSO)-containing medium; RA, retinoic acid treatment; Res, resveratrol treatment; Resveratrol plus RA, treated with a combination of 10 µM retinoic acid and 100 µM resveratrol for 48 h; Resveratrol-alone, 100 µM resveratrol; *, with statistical significance ( p

    Journal: International Journal of Molecular Sciences

    Article Title: Resveratrol Suppresses the Growth and Enhances Retinoic Acid Sensitivity of Anaplastic Thyroid Cancer Cells

    doi: 10.3390/ijms19041030

    Figure Lengend Snippet: Resveratrol reverses the retinoic acid sensitivity of THJ-11T cells. ( A ) H/E staining (×40); ( B ) deoxynucleotidyl transferase-mediated dUTP-biotin nick and labeling assay (TUNEL) for apoptotic cell labeling (Green in color; ×40); ( C ) MTT cell proliferation assay; ( D ) viable cell counting; ( E ) immunocytochemical staining of thyroglobulin (Tg) and E-cadherin (×40). Control, cultured in 0.2% dimethylsulfoxide (DMSO)-containing medium; RA, retinoic acid treatment; Res, resveratrol treatment; Resveratrol plus RA, treated with a combination of 10 µM retinoic acid and 100 µM resveratrol for 48 h; Resveratrol-alone, 100 µM resveratrol; *, with statistical significance ( p

    Article Snippet: The DNA fragmentation assay in THJ-11T cells on coverslips, treated with both RA and resveratrol, was performed by using a modification of the terminal deoxynucleotide transferase (TdT)-mediated dUTP-biotin nick end-labeling method (TUNEL; Roche Inc., Basel, Switzerland).

    Techniques: Staining, Labeling, TUNEL Assay, MTT Assay, Proliferation Assay, Cell Counting, Cell Culture

    Differential expression of CRABP2 and FARP5 in THJ-11T cells in the absence or presence of 100 µM resveratrol. ( A ) Double immunofluorescent labeling (×40); ( B ) ImageJ (Version 1.0, National Institutes of Health, Bethesda, MD, USA)-based quantification of nuclear labeling of CRABP2 and FABP5; ( C ) Western blotting; ( D ) RT-PCR. Control, 0.2% DMSO-treated cells; Resveratrol-alone, 100 µM resveratrol treatment; Ratio, ratio between the levels of the target molecules and that of β-ACTIN/ β-actin ; *, with statistical significance ( p

    Journal: International Journal of Molecular Sciences

    Article Title: Resveratrol Suppresses the Growth and Enhances Retinoic Acid Sensitivity of Anaplastic Thyroid Cancer Cells

    doi: 10.3390/ijms19041030

    Figure Lengend Snippet: Differential expression of CRABP2 and FARP5 in THJ-11T cells in the absence or presence of 100 µM resveratrol. ( A ) Double immunofluorescent labeling (×40); ( B ) ImageJ (Version 1.0, National Institutes of Health, Bethesda, MD, USA)-based quantification of nuclear labeling of CRABP2 and FABP5; ( C ) Western blotting; ( D ) RT-PCR. Control, 0.2% DMSO-treated cells; Resveratrol-alone, 100 µM resveratrol treatment; Ratio, ratio between the levels of the target molecules and that of β-ACTIN/ β-actin ; *, with statistical significance ( p

    Article Snippet: The DNA fragmentation assay in THJ-11T cells on coverslips, treated with both RA and resveratrol, was performed by using a modification of the terminal deoxynucleotide transferase (TdT)-mediated dUTP-biotin nick end-labeling method (TUNEL; Roche Inc., Basel, Switzerland).

    Techniques: Expressing, Labeling, Western Blot, Reverse Transcription Polymerase Chain Reaction