polymerase chain reaction pcr clean up system  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Promega polymerase chain reaction pcr clean up system
    The H2A variant H2A.Z is not involved in INO80 related effects at stress genes. H2A.Z is not involved in delayed promoter <t>nucleosome</t> repopulation in arp8 Δ. ( A and B ) Nucleosome scanning assay of the CTT1 locus (−600 to +350 bp). Wild-type and htz1 Δ cells were treated with 0.4M NaCl for 10, 30 and 60 min or left untreated. NuSA are shown in (A) and quantification of NuSA of the CTT1 −1 and +1 nucleosomes in wild-type and htz1 Δ are shown in (B). Graphs in (B) are normalized to the untreated wild-type sample. ( C ) The stress induced transient recruitment of INO80 to the 5΄ end of the CTT1 locus is similar in wild-type and htz1 Δ mutant. Recruitment to the CTT1 5΄ region (+275) including the +1 nucleosome during osmotic stress (for indicated time points) was measured by ChIP of Ino80-TAP. ( D ) Expression of the CTT1 locus during osmotic stress is not influenced by absence of H2A.Z. Wild-type cells (BY4741), arp8 Δ, htz1 Δ and htz1 Δ arp8 Δ mutants were treated with 0.4M NaCl for indicated time points. CTT1 expression levels were quantified relative to VCX1 by <t>qRT-PCR.</t> Expression levels were normalized to the maximum expression levels in wild-type (10 min).
    Polymerase Chain Reaction Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr clean up system/product/Promega
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr clean up system - by Bioz Stars, 2020-04
    92/100 stars

    Images

    1) Product Images from "INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes"

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1292

    The H2A variant H2A.Z is not involved in INO80 related effects at stress genes. H2A.Z is not involved in delayed promoter nucleosome repopulation in arp8 Δ. ( A and B ) Nucleosome scanning assay of the CTT1 locus (−600 to +350 bp). Wild-type and htz1 Δ cells were treated with 0.4M NaCl for 10, 30 and 60 min or left untreated. NuSA are shown in (A) and quantification of NuSA of the CTT1 −1 and +1 nucleosomes in wild-type and htz1 Δ are shown in (B). Graphs in (B) are normalized to the untreated wild-type sample. ( C ) The stress induced transient recruitment of INO80 to the 5΄ end of the CTT1 locus is similar in wild-type and htz1 Δ mutant. Recruitment to the CTT1 5΄ region (+275) including the +1 nucleosome during osmotic stress (for indicated time points) was measured by ChIP of Ino80-TAP. ( D ) Expression of the CTT1 locus during osmotic stress is not influenced by absence of H2A.Z. Wild-type cells (BY4741), arp8 Δ, htz1 Δ and htz1 Δ arp8 Δ mutants were treated with 0.4M NaCl for indicated time points. CTT1 expression levels were quantified relative to VCX1 by qRT-PCR. Expression levels were normalized to the maximum expression levels in wild-type (10 min).
    Figure Legend Snippet: The H2A variant H2A.Z is not involved in INO80 related effects at stress genes. H2A.Z is not involved in delayed promoter nucleosome repopulation in arp8 Δ. ( A and B ) Nucleosome scanning assay of the CTT1 locus (−600 to +350 bp). Wild-type and htz1 Δ cells were treated with 0.4M NaCl for 10, 30 and 60 min or left untreated. NuSA are shown in (A) and quantification of NuSA of the CTT1 −1 and +1 nucleosomes in wild-type and htz1 Δ are shown in (B). Graphs in (B) are normalized to the untreated wild-type sample. ( C ) The stress induced transient recruitment of INO80 to the 5΄ end of the CTT1 locus is similar in wild-type and htz1 Δ mutant. Recruitment to the CTT1 5΄ region (+275) including the +1 nucleosome during osmotic stress (for indicated time points) was measured by ChIP of Ino80-TAP. ( D ) Expression of the CTT1 locus during osmotic stress is not influenced by absence of H2A.Z. Wild-type cells (BY4741), arp8 Δ, htz1 Δ and htz1 Δ arp8 Δ mutants were treated with 0.4M NaCl for indicated time points. CTT1 expression levels were quantified relative to VCX1 by qRT-PCR. Expression levels were normalized to the maximum expression levels in wild-type (10 min).

    Techniques Used: Variant Assay, Mutagenesis, Chromatin Immunoprecipitation, Expressing, Quantitative RT-PCR

    Related Articles

    Electroporation:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI). .. The DNA was self-ligated using T4 DNA ligase (New England Biolabs), transformed by electroporation into EC100Dpir+ (Epicentre Biotechnologies), and selected on BHI containing 150 μ g mL−1 erythromycin.

    RNA Extraction:

    Article Title: Chemerin Elicits Potent Constrictor Actions via Chemokine‐Like Receptor 1 ( CMKLR1), not G‐Protein‐Coupled Receptor 1 ( GPR1), in Human and Rat Vasculature
    Article Snippet: .. Quantitative Polmerase Chain Reaction RNA extraction, using Trizol Reagent and the PureLink RNA Mini Kit (Life Technologies) with DNase treatment, followed by reverse transcription with the Promega Reverse Transcription System (Promega, Madison, WI), were carried out, as in the manufacturer's instructions, on human SV (n=10), MA (n=8), CA (n=5), aorta (n=5), and ASMCs (n=6), where n is the number of different patients. cDNA products were purified using the Wizard SV Gel and polymerase chain reaction (PCR) Clean‐Up System (Promega) and subjected to real‐time quantitative PCR for 45 cycles using the ABI 7500 Real‐Time PCR System (Life Technologies) with double‐dye Taqman primer probes for human CMKLR1 (Hs01081979_s1), GPR1 (Hs00270990_s1), and RARRES2 (Hs00161209_g1) and human 18S rRNA as an internal control, all from Life Technologies. .. Expression of CMKLR1 , GPR1 , and RARRES2 (the gene for chemerin) was normalized to that of 18S.

    Agarose Gel Electrophoresis:

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes
    Article Snippet: DNA fragments were phenol-chloroform purified and separated on a 1% Agarose gel. .. Mono nucleosome DNA bands were purified (Wizard® SV Gel and polymerase chain reaction (PCR) Clean-Up System, Promega).

    Expressing:

    Article Title: Chemerin Elicits Potent Constrictor Actions via Chemokine‐Like Receptor 1 ( CMKLR1), not G‐Protein‐Coupled Receptor 1 ( GPR1), in Human and Rat Vasculature
    Article Snippet: Quantitative Polmerase Chain Reaction RNA extraction, using Trizol Reagent and the PureLink RNA Mini Kit (Life Technologies) with DNase treatment, followed by reverse transcription with the Promega Reverse Transcription System (Promega, Madison, WI), were carried out, as in the manufacturer's instructions, on human SV (n=10), MA (n=8), CA (n=5), aorta (n=5), and ASMCs (n=6), where n is the number of different patients. cDNA products were purified using the Wizard SV Gel and polymerase chain reaction (PCR) Clean‐Up System (Promega) and subjected to real‐time quantitative PCR for 45 cycles using the ABI 7500 Real‐Time PCR System (Life Technologies) with double‐dye Taqman primer probes for human CMKLR1 (Hs01081979_s1), GPR1 (Hs00270990_s1), and RARRES2 (Hs00161209_g1) and human 18S rRNA as an internal control, all from Life Technologies. .. Expression of CMKLR1 , GPR1 , and RARRES2 (the gene for chemerin) was normalized to that of 18S.

    Fluorescence:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: The resulting colonies were screened for elevated Green Fluorescent Protein (GFP) levels using a Leica MZFLIII fluorescence dissecting microscope (Leica Microsystems, Wetzlar, Germany), equipped with a GFP2 filter set. .. The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI).

    Mutagenesis:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: Paragraph title: Transposon mutagenesis screen ... The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI).

    Centrifugation:

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes
    Article Snippet: Pellets were resuspended in 8 ml Buffer Z2 (1M Sorbitol, 50 mM Tris–HCl pH 7.4, 10 mM freshly added Mercaptoethanol) with Zymolyase (10 mg/ml Seikagaku Corp, 200 μl per sample) and incubated on 30°C for 20–30 min. Spheroplasts were harvested by centrifugation (1500 g ) for 10 min and resuspended in 1.5 ml NPS buffer (0.075% NP-40, 50 mM NaCl, 10 mM Tris pH 7.4, 5 mM MgCl2 1 mM CaCl2 , freshly added 0.5 mM Spermidine and 1 mM Mercaptoethanol). .. Mono nucleosome DNA bands were purified (Wizard® SV Gel and polymerase chain reaction (PCR) Clean-Up System, Promega).

    Microscopy:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: The resulting colonies were screened for elevated Green Fluorescent Protein (GFP) levels using a Leica MZFLIII fluorescence dissecting microscope (Leica Microsystems, Wetzlar, Germany), equipped with a GFP2 filter set. .. The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI).

    Purification:

    Article Title: Chemerin Elicits Potent Constrictor Actions via Chemokine‐Like Receptor 1 ( CMKLR1), not G‐Protein‐Coupled Receptor 1 ( GPR1), in Human and Rat Vasculature
    Article Snippet: .. Quantitative Polmerase Chain Reaction RNA extraction, using Trizol Reagent and the PureLink RNA Mini Kit (Life Technologies) with DNase treatment, followed by reverse transcription with the Promega Reverse Transcription System (Promega, Madison, WI), were carried out, as in the manufacturer's instructions, on human SV (n=10), MA (n=8), CA (n=5), aorta (n=5), and ASMCs (n=6), where n is the number of different patients. cDNA products were purified using the Wizard SV Gel and polymerase chain reaction (PCR) Clean‐Up System (Promega) and subjected to real‐time quantitative PCR for 45 cycles using the ABI 7500 Real‐Time PCR System (Life Technologies) with double‐dye Taqman primer probes for human CMKLR1 (Hs01081979_s1), GPR1 (Hs00270990_s1), and RARRES2 (Hs00161209_g1) and human 18S rRNA as an internal control, all from Life Technologies. .. Expression of CMKLR1 , GPR1 , and RARRES2 (the gene for chemerin) was normalized to that of 18S.

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes
    Article Snippet: .. Mono nucleosome DNA bands were purified (Wizard® SV Gel and polymerase chain reaction (PCR) Clean-Up System, Promega). ..

    Article Title: Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein
    Article Snippet: .. Plasmid substrates, oligonucleotides and DNA fragments pBluescript-KS-II (−) or pDVG94 plasmids (gift from Dik van Gent, Cancer Genomics Center, Rotterdam, The Netherlands) were digested with FastDigest restriction enzymes HindIII, AfeI/EcoRV (Thermo Scientific) respectively, according to the manufacturer's instructions and linear forms were then purified by Gel and polymerase chain reaction (PCR) Clean-Up System (Promega). .. The ss oligonucleotide used as competitor in NHEJ EMSA were as follows : 6 bases : 5′ GTGTGA; 10 bases : 5′ GTGTGAGTGT; 15 bases : 5′ GTGTGAGTGTGAGTG; 20 bases : 5′ GTGTGAGTGTGAGTGTGAGT; 25 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAG; 30 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGA; 35 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTG.

    Real-time Polymerase Chain Reaction:

    Article Title: Chemerin Elicits Potent Constrictor Actions via Chemokine‐Like Receptor 1 ( CMKLR1), not G‐Protein‐Coupled Receptor 1 ( GPR1), in Human and Rat Vasculature
    Article Snippet: .. Quantitative Polmerase Chain Reaction RNA extraction, using Trizol Reagent and the PureLink RNA Mini Kit (Life Technologies) with DNase treatment, followed by reverse transcription with the Promega Reverse Transcription System (Promega, Madison, WI), were carried out, as in the manufacturer's instructions, on human SV (n=10), MA (n=8), CA (n=5), aorta (n=5), and ASMCs (n=6), where n is the number of different patients. cDNA products were purified using the Wizard SV Gel and polymerase chain reaction (PCR) Clean‐Up System (Promega) and subjected to real‐time quantitative PCR for 45 cycles using the ABI 7500 Real‐Time PCR System (Life Technologies) with double‐dye Taqman primer probes for human CMKLR1 (Hs01081979_s1), GPR1 (Hs00270990_s1), and RARRES2 (Hs00161209_g1) and human 18S rRNA as an internal control, all from Life Technologies. .. Expression of CMKLR1 , GPR1 , and RARRES2 (the gene for chemerin) was normalized to that of 18S.

    Incubation:

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes
    Article Snippet: The reaction was stopped by addition of 12 μl 0.5M ethylenediaminetetraacetic acid pH 8.0 followed by reversal of crosslink in presence of 10 μl Proteinase K (10 mg/ml) and 60 μl 10% sodium dodecyl sulphate and incubation at 65°C over night. .. Mono nucleosome DNA bands were purified (Wizard® SV Gel and polymerase chain reaction (PCR) Clean-Up System, Promega).

    Non-Homologous End Joining:

    Article Title: Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein
    Article Snippet: Plasmid substrates, oligonucleotides and DNA fragments pBluescript-KS-II (−) or pDVG94 plasmids (gift from Dik van Gent, Cancer Genomics Center, Rotterdam, The Netherlands) were digested with FastDigest restriction enzymes HindIII, AfeI/EcoRV (Thermo Scientific) respectively, according to the manufacturer's instructions and linear forms were then purified by Gel and polymerase chain reaction (PCR) Clean-Up System (Promega). .. The ss oligonucleotide used as competitor in NHEJ EMSA were as follows : 6 bases : 5′ GTGTGA; 10 bases : 5′ GTGTGAGTGT; 15 bases : 5′ GTGTGAGTGTGAGTG; 20 bases : 5′ GTGTGAGTGTGAGTGTGAGT; 25 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAG; 30 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGA; 35 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTG.

    DNA Purification:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: To determine the transposon insertion site within each mutant, genomic DNA was extracted from 0.5 mL overnight LBS cultures using the MasterPure DNA Purification Kit (Epicentre Biotechnologies). .. The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI).

    Polymerase Chain Reaction:

    Article Title: Chemerin Elicits Potent Constrictor Actions via Chemokine‐Like Receptor 1 ( CMKLR1), not G‐Protein‐Coupled Receptor 1 ( GPR1), in Human and Rat Vasculature
    Article Snippet: .. Quantitative Polmerase Chain Reaction RNA extraction, using Trizol Reagent and the PureLink RNA Mini Kit (Life Technologies) with DNase treatment, followed by reverse transcription with the Promega Reverse Transcription System (Promega, Madison, WI), were carried out, as in the manufacturer's instructions, on human SV (n=10), MA (n=8), CA (n=5), aorta (n=5), and ASMCs (n=6), where n is the number of different patients. cDNA products were purified using the Wizard SV Gel and polymerase chain reaction (PCR) Clean‐Up System (Promega) and subjected to real‐time quantitative PCR for 45 cycles using the ABI 7500 Real‐Time PCR System (Life Technologies) with double‐dye Taqman primer probes for human CMKLR1 (Hs01081979_s1), GPR1 (Hs00270990_s1), and RARRES2 (Hs00161209_g1) and human 18S rRNA as an internal control, all from Life Technologies. .. Expression of CMKLR1 , GPR1 , and RARRES2 (the gene for chemerin) was normalized to that of 18S.

    Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes
    Article Snippet: .. Mono nucleosome DNA bands were purified (Wizard® SV Gel and polymerase chain reaction (PCR) Clean-Up System, Promega). ..

    Article Title: Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein
    Article Snippet: .. Plasmid substrates, oligonucleotides and DNA fragments pBluescript-KS-II (−) or pDVG94 plasmids (gift from Dik van Gent, Cancer Genomics Center, Rotterdam, The Netherlands) were digested with FastDigest restriction enzymes HindIII, AfeI/EcoRV (Thermo Scientific) respectively, according to the manufacturer's instructions and linear forms were then purified by Gel and polymerase chain reaction (PCR) Clean-Up System (Promega). .. The ss oligonucleotide used as competitor in NHEJ EMSA were as follows : 6 bases : 5′ GTGTGA; 10 bases : 5′ GTGTGAGTGT; 15 bases : 5′ GTGTGAGTGTGAGTG; 20 bases : 5′ GTGTGAGTGTGAGTGTGAGT; 25 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAG; 30 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGA; 35 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTG.

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: .. The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI). .. The DNA was self-ligated using T4 DNA ligase (New England Biolabs), transformed by electroporation into EC100Dpir+ (Epicentre Biotechnologies), and selected on BHI containing 150 μ g mL−1 erythromycin.

    Transformation Assay:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI). .. The DNA was self-ligated using T4 DNA ligase (New England Biolabs), transformed by electroporation into EC100Dpir+ (Epicentre Biotechnologies), and selected on BHI containing 150 μ g mL−1 erythromycin.

    Plasmid Preparation:

    Article Title: Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein
    Article Snippet: .. Plasmid substrates, oligonucleotides and DNA fragments pBluescript-KS-II (−) or pDVG94 plasmids (gift from Dik van Gent, Cancer Genomics Center, Rotterdam, The Netherlands) were digested with FastDigest restriction enzymes HindIII, AfeI/EcoRV (Thermo Scientific) respectively, according to the manufacturer's instructions and linear forms were then purified by Gel and polymerase chain reaction (PCR) Clean-Up System (Promega). .. The ss oligonucleotide used as competitor in NHEJ EMSA were as follows : 6 bases : 5′ GTGTGA; 10 bases : 5′ GTGTGAGTGT; 15 bases : 5′ GTGTGAGTGTGAGTG; 20 bases : 5′ GTGTGAGTGTGAGTGTGAGT; 25 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAG; 30 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGA; 35 bases : 5′ GTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTG.

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: Recipients of the reporter plasmid were selected by plating the mating mixture onto LBS with 2.5 μ g mL−1 chloramphenicol. .. The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI).

    DNA Sequencing:

    Article Title: The putative oligosaccharide translocase SypK connects biofilm formation with quorum signaling in Vibrio fischeri
    Article Snippet: The enzyme was removed using the Wizard SV Gel and polymerase chain reaction (PCR) Clean-Up System (Promega, Madison, WI). .. Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen, Venlo, Netherlands) and sequenced at the UWBC DNA Sequencing Facility (University of Wisconsin-Madison) with transposon-specific primers pMJM10-Ext2 (CTAAAGAGGTCCCTAGCGATAAGC) and 170Ext (GCACTGAGAAGCCCTTAGAGCC).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr clean up kit
    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
    Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Promega
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega pcr clean up system
    H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 <t>RT-PCR</t> analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of <t>cDNA</t> (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
    Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 225 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up system/product/Promega
    Average 99 stars, based on 225 article reviews
    Price from $9.99 to $1999.99
    pcr clean up system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Promega wizard pcr clean up system
    <t>PCR</t> and <t>DNA</t> sequencing
    Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr clean up system/product/Promega
    Average 94 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    wizard pcr clean up system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Journal: BioMed Research International

    Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

    doi: 10.1155/2017/5170680

    Figure Lengend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Article Snippet: PCR amplified DNA was cleaned using PCR clean-up kit following the kit protocol (Promega, Wisconsin, USA), sequenced, and verified using nucleotide BLAST tool.

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction

    Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Journal: The Journal of Gene Medicine

    Article Title: Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure, et al. Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure

    doi: 10.1002/jgm.3115

    Figure Lengend Snippet: Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Article Snippet: In total, 10 μg of s‐b cosmid was digested with Sal I (Figure , asterisks) and electrophoresed overnight in a 14‐cm long 0.8% Tris‐acetate‐ethylenediaminetetraacetic acid (TAE) agarose gel at 35 V. The DNA fragment was purified using the Wizard SV Gel and PCR Clean‐up kit as described above and was self‐ligated.

    Techniques: Derivative Assay, Transfection, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

    Journal: Antioxidants

    Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

    doi: 10.3390/antiox8110518

    Figure Lengend Snippet: H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

    Article Snippet: Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany).

    Techniques: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, H2O2 Assay, Concentration Assay

    KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

    Journal: Antioxidants

    Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

    doi: 10.3390/antiox8110518

    Figure Lengend Snippet: KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

    Article Snippet: Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany).

    Techniques: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Derivative Assay

    PCR and DNA sequencing

    Journal:

    Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

    doi: 10.1099/mic.0.024521-0

    Figure Lengend Snippet: PCR and DNA sequencing

    Article Snippet: PCR products were purified using Wizard PCR Clean-up System (Promega), and the DNA sequencing was performed by the genomics core facility at the University of Alabama at Birmingham (UAB).

    Techniques: Polymerase Chain Reaction, DNA Sequencing