Structured Review

Roche polymerase chain reaction pcr buffer
Polymerase Chain Reaction Pcr Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr buffer/product/Roche
Average 89 stars, based on 6 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction pcr buffer - by Bioz Stars, 2020-07
89/100 stars

Images

Related Articles

Amplification:

Article Title: Predominant modifier of extreme liver cancer susceptibility in C57BR/cdJ female mice localized to 6 Mb on chromosome 17
Article Snippet: .. Microsatellite markers were amplified using 1 μl or 2 μl DNA (∼100 ng), 184 nM each primer, 46 μM dNTPs, 10× polymerase chain reaction (PCR) buffer (Roche; 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2 , 50 mM KCl) and 0.5 U Taq polymerase (Roche or enzyme purified in our lab by ammonium sulfate precipitation) in a final reaction volume of 21.7 μl. .. Reactions were incubated in an MJ PTC-200 thermal cycler (Bio-Rad, Hercules, CA) at 94°C for 3 min and then for 40 cycles of 94°C for 30 sec, 55°C for 40 sec, 72°C for 60 sec and 72°C for 5 min.

Article Title: The PPCD1 Mouse: Characterization of a Mouse Model for Posterior Polymorphous Corneal Dystrophy and Identification of a Candidate Gene
Article Snippet: .. Microsatellite markers were amplified using 1 µl DNA (∼20 ng), 0.2 µM each primer, 50 µM dNTPs, 1x polymerase chain reaction (PCR) buffer (Roche; 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2 , 50 mM KCl) and 0.5 U Taq polymerase in a final reaction volume of 20 µl. .. Reactions were incubated in an MJ PTC-200 thermal cycler at 94°C for 2 min and then for 40 cycles of 94°C for 30 sec, 55°C for 40 sec, 72°C for 60 sec and 72°C for 5 min.

Article Title: Association of genetic variants in the 3′UTR of HLA-G with Recurrent Pregnancy Loss
Article Snippet: .. 2.3 Amplification and sequencing of 3′UTR of the HLA-G gene (or genotyping) 100 ng of genomic DNA were amplified in a 25 μl reaction containing 1× polymerase chain reaction (PCR) buffer (Roche, USA), 0.2 mM dNTP mix (Roche, USA), 1.5 mM MgCl2 (Roche, USA), 0.8 U Taq Polymerase (Roche, USA), and 1 μM of each primer (For: 5′ TCACCCCTCACTGTGACTGA 3′; Rev: 5′ TTCTCATGTCTTCCATTTATTTTGTC 3′). ..

Polymerase Chain Reaction:

Article Title: Mucosa-associated bacteria in two middle-aged women diagnosed with collagenous colitis
Article Snippet: .. The reaction mixture contained 5 μL of 10× polymerase chain reaction (PCR) buffer (100 mmol Tris-HCl, 15 mmol MgCl2 , 500 mmol KCl, pH 8.3), each deoxynucleotide phosphate at a concentration of 200 μmol, 2.5 U of Tag DNA Polymerase (Roche Diagnostics, GmbH, Mannheim, Germany) and 10 pmol of each primer. ..

Article Title: Predominant modifier of extreme liver cancer susceptibility in C57BR/cdJ female mice localized to 6 Mb on chromosome 17
Article Snippet: .. Microsatellite markers were amplified using 1 μl or 2 μl DNA (∼100 ng), 184 nM each primer, 46 μM dNTPs, 10× polymerase chain reaction (PCR) buffer (Roche; 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2 , 50 mM KCl) and 0.5 U Taq polymerase (Roche or enzyme purified in our lab by ammonium sulfate precipitation) in a final reaction volume of 21.7 μl. .. Reactions were incubated in an MJ PTC-200 thermal cycler (Bio-Rad, Hercules, CA) at 94°C for 3 min and then for 40 cycles of 94°C for 30 sec, 55°C for 40 sec, 72°C for 60 sec and 72°C for 5 min.

Article Title: Heat-transfer-based detection of SNPs in the PAH gene of PKU patients
Article Snippet: .. Deoxyribonucleotide triphosphate (dNTP), polymerase chain reaction (PCR) buffer, and Taq polymerase were obtained from Roche Diagnostics (Basel, Switzerland). .. All primers and synthetic DNA sequences were purchased from Integrated DNA Technology (Leuven, Belgium).

Article Title: Effect of thrombin peptide 508 (TP508) on bone healing during distraction osteogenesis in rabbit tibia
Article Snippet: .. The RNA content was determined by measuring the absorbance in water at 260 nm by means of an Ultrospec III spectrophotometer (Amersham, Buckinghamshire, England). cDNA synthesis was performed by using 750 ng total RNA in a final reaction volume of 20 μl containing 5 U transcriptor (Roche Applied Science), 5× polymerase chain reaction (PCR) buffer, 4 U random primers (Roche), 20 U protector RNase inhibitor (Roche), 1 mmol each dNTP and 10 μl template. .. The reverse transcription step was performed on a Gene Amp 9700 Thermocycler (Applied Biosystems, Foster City, Calif., USA) at 55°C for 30 min followed by 85°C for 5 min. Real-time PCR was performed on the ABI PRISM 7700 sequence detection system (Applied Biosystems).

Article Title: The PPCD1 Mouse: Characterization of a Mouse Model for Posterior Polymorphous Corneal Dystrophy and Identification of a Candidate Gene
Article Snippet: .. Microsatellite markers were amplified using 1 µl DNA (∼20 ng), 0.2 µM each primer, 50 µM dNTPs, 1x polymerase chain reaction (PCR) buffer (Roche; 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2 , 50 mM KCl) and 0.5 U Taq polymerase in a final reaction volume of 20 µl. .. Reactions were incubated in an MJ PTC-200 thermal cycler at 94°C for 2 min and then for 40 cycles of 94°C for 30 sec, 55°C for 40 sec, 72°C for 60 sec and 72°C for 5 min.

Article Title: Association of genetic variants in the 3′UTR of HLA-G with Recurrent Pregnancy Loss
Article Snippet: .. 2.3 Amplification and sequencing of 3′UTR of the HLA-G gene (or genotyping) 100 ng of genomic DNA were amplified in a 25 μl reaction containing 1× polymerase chain reaction (PCR) buffer (Roche, USA), 0.2 mM dNTP mix (Roche, USA), 1.5 mM MgCl2 (Roche, USA), 0.8 U Taq Polymerase (Roche, USA), and 1 μM of each primer (For: 5′ TCACCCCTCACTGTGACTGA 3′; Rev: 5′ TTCTCATGTCTTCCATTTATTTTGTC 3′). ..

Spectrophotometry:

Article Title: Effect of thrombin peptide 508 (TP508) on bone healing during distraction osteogenesis in rabbit tibia
Article Snippet: .. The RNA content was determined by measuring the absorbance in water at 260 nm by means of an Ultrospec III spectrophotometer (Amersham, Buckinghamshire, England). cDNA synthesis was performed by using 750 ng total RNA in a final reaction volume of 20 μl containing 5 U transcriptor (Roche Applied Science), 5× polymerase chain reaction (PCR) buffer, 4 U random primers (Roche), 20 U protector RNase inhibitor (Roche), 1 mmol each dNTP and 10 μl template. .. The reverse transcription step was performed on a Gene Amp 9700 Thermocycler (Applied Biosystems, Foster City, Calif., USA) at 55°C for 30 min followed by 85°C for 5 min. Real-time PCR was performed on the ABI PRISM 7700 sequence detection system (Applied Biosystems).

Purification:

Article Title: Predominant modifier of extreme liver cancer susceptibility in C57BR/cdJ female mice localized to 6 Mb on chromosome 17
Article Snippet: .. Microsatellite markers were amplified using 1 μl or 2 μl DNA (∼100 ng), 184 nM each primer, 46 μM dNTPs, 10× polymerase chain reaction (PCR) buffer (Roche; 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2 , 50 mM KCl) and 0.5 U Taq polymerase (Roche or enzyme purified in our lab by ammonium sulfate precipitation) in a final reaction volume of 21.7 μl. .. Reactions were incubated in an MJ PTC-200 thermal cycler (Bio-Rad, Hercules, CA) at 94°C for 3 min and then for 40 cycles of 94°C for 30 sec, 55°C for 40 sec, 72°C for 60 sec and 72°C for 5 min.

Concentration Assay:

Article Title: Mucosa-associated bacteria in two middle-aged women diagnosed with collagenous colitis
Article Snippet: .. The reaction mixture contained 5 μL of 10× polymerase chain reaction (PCR) buffer (100 mmol Tris-HCl, 15 mmol MgCl2 , 500 mmol KCl, pH 8.3), each deoxynucleotide phosphate at a concentration of 200 μmol, 2.5 U of Tag DNA Polymerase (Roche Diagnostics, GmbH, Mannheim, Germany) and 10 pmol of each primer. ..

Sequencing:

Article Title: Association of genetic variants in the 3′UTR of HLA-G with Recurrent Pregnancy Loss
Article Snippet: .. 2.3 Amplification and sequencing of 3′UTR of the HLA-G gene (or genotyping) 100 ng of genomic DNA were amplified in a 25 μl reaction containing 1× polymerase chain reaction (PCR) buffer (Roche, USA), 0.2 mM dNTP mix (Roche, USA), 1.5 mM MgCl2 (Roche, USA), 0.8 U Taq Polymerase (Roche, USA), and 1 μM of each primer (For: 5′ TCACCCCTCACTGTGACTGA 3′; Rev: 5′ TTCTCATGTCTTCCATTTATTTTGTC 3′). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Roche pcr buffer
    Human papillomavirus (HPV)16 type-specific polymerase chain reaction products. Lane 4: 50 bp ladder; lanes 3, 5-8: <t>HPV16</t> (+) ve samples showing specific band size at 116 bp; lane 9: HPV16 (–)ve sample; lane 2: Positive control; lane 1: Negative control
    Pcr Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 905 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Roche
    Average 94 stars, based on 905 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    97
    Roche ripa buffer
    Effect of C. sinica or α-viniferin on expression of Tyro gene. B16-F0 cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 48 h (A-C) or 20 h (D, E) in the presence of C. sinica or α-viniferin. Cell lysates were prepared with phosphate buffer, and cell extracts with <t>RIPA</t> buffer. (A) Cell lysates were reacted with 1 mM L-dopa, and the velocity of increasing absorbance values at 475 nm was immediately measured. Tyro activity is represented as the initial velocity of L-dopa oxidation (nmol/min). (B) Cell lysates were resolved on non-denaturing acrylamide gels (without 2-mercaptoethanol) by electrophoresis, and subjected to zymography with soaking of the gels in 1 mM L-dopa. (C) Cell extracts were resolved on <t>SDS-acrylamide</t> gels by electrophoresis, and subjected to Western blot (WB) analysis with anti-Tyro or anti-GAPDH antibody. (D, E) Total RNAs were subjected to RT-PCR analysis of Tyro, TYRP1 or DCT with β-actin as an internal control, and resolved on agarose gels by electrophoresis. (F) B16-F0 cells were transfected with Tyro (-2236/+59)-Luc reporter construct in combination with Renilla control vector. The transfected cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 18 h in the presence of C. sinica or α-viniferin. Firefly luciferase activity, a reporter of the promoter activity of Tyro gene, is represented as a relative fold after normalizing to Renilla activity, a reference of transfection efficiency. Data are mean ± SEM. # p
    Ripa Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 5816 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ripa buffer/product/Roche
    Average 97 stars, based on 5816 article reviews
    Price from $9.99 to $1999.99
    ripa buffer - by Bioz Stars, 2020-07
    97/100 stars
      Buy from Supplier

    88
    Roche radioimmunoprecipitation assay extraction buffer
    Endogenous MAGE-11 expression. (A) MAGE-11 mRNA was analyzed by RT-PCR. Total RNA (2 μg) was reverse transcribed, and the resulting cDNAs were amplified by 35 PCR cycles (top). In addition, 2 μl of the first PCRs was used as a template for a second 35-cycle PCR amplification with the same primers (bottom). Amplified MAGE-11 DNA fragments are shown for pSG5-MAGE-11 (lane 1), human foreskin fibroblasts (HFF, lane 2) and prostate cancer cell lines LNCaP (lane 3), LNCaP-C4-2 (lane 4), CWR-R1 (lane 5), CWR22-RV1 (lane 6), LAPC4 (lane 7), PC-3 (lane 8), and DU-145 (lane 9), as well as from HeLa cells (lane 10), HeLaAR1C cell line stably expressing human AR (lane 11), HepG2 (lane 12), COS cells (lane 13), CV1 cells (lane 14), human testis tissue (lane 15), and the no-RNA control (lane 16). The products were analyzed on 2% agarose gels. (B) Total RNA was isolated from adult human tissues with Trizol, reverse transcribed, and PCR amplified as described in Materials and Methods. Shown are the results of 35 PCR cycles with cDNA from human testis (lane 1), prostate (lane 2), a prostate tumor (lane 3), breast (lane 4), ovary (lane 5), lung (lane 6), adrenal gland (lane 7), and liver (lane 8). (C) Endogenous MAGE-11 protein (70 kDa) was detected in immunoblots with the anti-MAGE-11 peptide antibody described in Materials and Methods. The indicated cell lines were cultured to near confluence, and total protein was extracted with <t>radioimmunoprecipitation</t> assay buffer as described in Materials and Methods. Total protein (100 μg) was analyzed in each lane, and immunoblot analyses were performed with the peptide affinity-purified MAGE-11 antibody (2.9 μg/ml) raised in a rabbit. The MAGE-11 antibody was untreated (lanes 1 to 8) or preadsorbed overnight at 4°C by adding 5 μl of 0.5 mg of peptide immunogen/ml to 28 μl of 0.52-mg/ml antibody (lanes 9 to 16). Transiently expressed pSG5-MAGE-11 from COS cells was analyzed with 1 μg (lanes 1 and 9) and 2 μg (lanes 8 and 16) of total protein. The HeLaAR1C cell line expresses a stably integrated Flag-tagged human AR (P. D. Reynolds and E. M. Wilson, unpublished studies). The MAGE-11 antibody was relatively specific to MAGE-11 but also interacted on immunoblots with a ∼80-kDa DNA helicase (data not shown).
    Radioimmunoprecipitation Assay Extraction Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/radioimmunoprecipitation assay extraction buffer/product/Roche
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    radioimmunoprecipitation assay extraction buffer - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    Human papillomavirus (HPV)16 type-specific polymerase chain reaction products. Lane 4: 50 bp ladder; lanes 3, 5-8: HPV16 (+) ve samples showing specific band size at 116 bp; lane 9: HPV16 (–)ve sample; lane 2: Positive control; lane 1: Negative control

    Journal: Journal of Mid-Life Health

    Article Title: Polymerase chain reaction and deoxyribonucleic acid-sequencing based study on distribution of human papillomavirus 16/18 among histopathological types of cervical intra-epithelial neoplasia and primary invasive cervical carcinoma: A scenario in North Bengal, India

    doi: 10.4103/0976-7800.127786

    Figure Lengend Snippet: Human papillomavirus (HPV)16 type-specific polymerase chain reaction products. Lane 4: 50 bp ladder; lanes 3, 5-8: HPV16 (+) ve samples showing specific band size at 116 bp; lane 9: HPV16 (–)ve sample; lane 2: Positive control; lane 1: Negative control

    Article Snippet: HPV TS-PCR The HPV16-specific PCR mixture (20 μl) contained ×10 PCR buffer, 2 mM MgCl2 , 200 μM dNTP, 4 ng primers, 0.5 U FS Taq and 100 ng DNA.

    Techniques: Polymerase Chain Reaction, Positive Control, Negative Control

    Flow chart depicting study design. TS-PCR: Type-specific polymerase chain reaction, HPV: Human papillomavirus, H and E: Hematoxylin and eosin, PAS: Periodic Acid-Schiff

    Journal: Journal of Mid-Life Health

    Article Title: Polymerase chain reaction and deoxyribonucleic acid-sequencing based study on distribution of human papillomavirus 16/18 among histopathological types of cervical intra-epithelial neoplasia and primary invasive cervical carcinoma: A scenario in North Bengal, India

    doi: 10.4103/0976-7800.127786

    Figure Lengend Snippet: Flow chart depicting study design. TS-PCR: Type-specific polymerase chain reaction, HPV: Human papillomavirus, H and E: Hematoxylin and eosin, PAS: Periodic Acid-Schiff

    Article Snippet: HPV TS-PCR The HPV16-specific PCR mixture (20 μl) contained ×10 PCR buffer, 2 mM MgCl2 , 200 μM dNTP, 4 ng primers, 0.5 U FS Taq and 100 ng DNA.

    Techniques: Flow Cytometry, Polymerase Chain Reaction

    The linear range of the real-time PCR method when detecting purified DNA from C. jejuni CCUG 11284 on the RotorGene 3000 (5 × 10 1 to 1 × 10 7 copies; □) and the ABI-PRISM 7700 (10 3 to 10 7 copies; ▴). A real-time PCR sample

    Journal: Applied and Environmental Microbiology

    Article Title: Enrichment Followed by Quantitative PCR both for Rapid Detection and as a Tool for Quantitative Risk Assessment of Food-Borne Thermotolerant Campylobacters

    doi: 10.1128/AEM.70.6.3588-3592.2004

    Figure Lengend Snippet: The linear range of the real-time PCR method when detecting purified DNA from C. jejuni CCUG 11284 on the RotorGene 3000 (5 × 10 1 to 1 × 10 7 copies; □) and the ABI-PRISM 7700 (10 3 to 10 7 copies; ▴). A real-time PCR sample

    Article Snippet: The 25-μl real-time PCR mixture contained 1× PCR buffer for Tth DNA polymerase (Roche A/S, Hvidovre, Denmark), 1 U of Tth DNA polymerase (Roche A/S), 0.4 mM deoxynucleoside triphosphate mixture (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom), 0.44 μM forward primer 5′ CTG CTT AAC ACA AGT TGA GTA GG 3′, 0.48 μM reverse primer 5′ TTC CTT AGG TAC CGT CAG AA 3′ (DNA Technology, Århus, Denmark; C. jejuni 16S rRNA; GenBank accession no. ), 2.5 mM MgCl2 (Applied Biosystems), 30 μg of bovine serum albumin (BSA) for chicken samples and 5 μg of BSA for pure DNA (Roche A/S), 20 nM target Campylobacter probe labeled with 6-carboxyfluorescein (FAM; reporter dye) and 6-carboxytetramethylrhodamine (TAMRA; quencher dye) (5′ FAM-TGT CAT CCT CCA CGC GGC GTT GCT GC-TAMRA 3′; DNA Technology), 50 nM IAC probe (5′ VIC-TTC ATG AGG ACA CCT GAG TTG A-TAMRA 3′; Applied Biosystems), 5 × 103 copies of IAC (124 bp), and 5 μl of DNA sample.

    Techniques: Real-time Polymerase Chain Reaction, Purification

    Effect of C. sinica or α-viniferin on expression of Tyro gene. B16-F0 cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 48 h (A-C) or 20 h (D, E) in the presence of C. sinica or α-viniferin. Cell lysates were prepared with phosphate buffer, and cell extracts with RIPA buffer. (A) Cell lysates were reacted with 1 mM L-dopa, and the velocity of increasing absorbance values at 475 nm was immediately measured. Tyro activity is represented as the initial velocity of L-dopa oxidation (nmol/min). (B) Cell lysates were resolved on non-denaturing acrylamide gels (without 2-mercaptoethanol) by electrophoresis, and subjected to zymography with soaking of the gels in 1 mM L-dopa. (C) Cell extracts were resolved on SDS-acrylamide gels by electrophoresis, and subjected to Western blot (WB) analysis with anti-Tyro or anti-GAPDH antibody. (D, E) Total RNAs were subjected to RT-PCR analysis of Tyro, TYRP1 or DCT with β-actin as an internal control, and resolved on agarose gels by electrophoresis. (F) B16-F0 cells were transfected with Tyro (-2236/+59)-Luc reporter construct in combination with Renilla control vector. The transfected cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 18 h in the presence of C. sinica or α-viniferin. Firefly luciferase activity, a reporter of the promoter activity of Tyro gene, is represented as a relative fold after normalizing to Renilla activity, a reference of transfection efficiency. Data are mean ± SEM. # p

    Journal: Theranostics

    Article Title: α-Viniferin Improves Facial Hyperpigmentation via Accelerating Feedback Termination of cAMP/PKA-Signaled Phosphorylation Circuit in Facultative Melanogenesis

    doi: 10.7150/thno.24385

    Figure Lengend Snippet: Effect of C. sinica or α-viniferin on expression of Tyro gene. B16-F0 cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 48 h (A-C) or 20 h (D, E) in the presence of C. sinica or α-viniferin. Cell lysates were prepared with phosphate buffer, and cell extracts with RIPA buffer. (A) Cell lysates were reacted with 1 mM L-dopa, and the velocity of increasing absorbance values at 475 nm was immediately measured. Tyro activity is represented as the initial velocity of L-dopa oxidation (nmol/min). (B) Cell lysates were resolved on non-denaturing acrylamide gels (without 2-mercaptoethanol) by electrophoresis, and subjected to zymography with soaking of the gels in 1 mM L-dopa. (C) Cell extracts were resolved on SDS-acrylamide gels by electrophoresis, and subjected to Western blot (WB) analysis with anti-Tyro or anti-GAPDH antibody. (D, E) Total RNAs were subjected to RT-PCR analysis of Tyro, TYRP1 or DCT with β-actin as an internal control, and resolved on agarose gels by electrophoresis. (F) B16-F0 cells were transfected with Tyro (-2236/+59)-Luc reporter construct in combination with Renilla control vector. The transfected cells were pretreated with C. sinica or α-viniferin for 2 h and stimulated with α-MSH for 18 h in the presence of C. sinica or α-viniferin. Firefly luciferase activity, a reporter of the promoter activity of Tyro gene, is represented as a relative fold after normalizing to Renilla activity, a reference of transfection efficiency. Data are mean ± SEM. # p

    Article Snippet: Cell extracts were prepared with RIPA buffer (iNtRON, IBS-BR002), resolved on SDS-acrylamide gels by electrophoresis, and transferred to polyvinylidene difluoride membranes (Roche 03010040001).

    Techniques: Expressing, Activity Assay, Electrophoresis, Zymography, Western Blot, Reverse Transcription Polymerase Chain Reaction, Transfection, Construct, Plasmid Preparation, Luciferase

    Endogenous MAGE-11 expression. (A) MAGE-11 mRNA was analyzed by RT-PCR. Total RNA (2 μg) was reverse transcribed, and the resulting cDNAs were amplified by 35 PCR cycles (top). In addition, 2 μl of the first PCRs was used as a template for a second 35-cycle PCR amplification with the same primers (bottom). Amplified MAGE-11 DNA fragments are shown for pSG5-MAGE-11 (lane 1), human foreskin fibroblasts (HFF, lane 2) and prostate cancer cell lines LNCaP (lane 3), LNCaP-C4-2 (lane 4), CWR-R1 (lane 5), CWR22-RV1 (lane 6), LAPC4 (lane 7), PC-3 (lane 8), and DU-145 (lane 9), as well as from HeLa cells (lane 10), HeLaAR1C cell line stably expressing human AR (lane 11), HepG2 (lane 12), COS cells (lane 13), CV1 cells (lane 14), human testis tissue (lane 15), and the no-RNA control (lane 16). The products were analyzed on 2% agarose gels. (B) Total RNA was isolated from adult human tissues with Trizol, reverse transcribed, and PCR amplified as described in Materials and Methods. Shown are the results of 35 PCR cycles with cDNA from human testis (lane 1), prostate (lane 2), a prostate tumor (lane 3), breast (lane 4), ovary (lane 5), lung (lane 6), adrenal gland (lane 7), and liver (lane 8). (C) Endogenous MAGE-11 protein (70 kDa) was detected in immunoblots with the anti-MAGE-11 peptide antibody described in Materials and Methods. The indicated cell lines were cultured to near confluence, and total protein was extracted with radioimmunoprecipitation assay buffer as described in Materials and Methods. Total protein (100 μg) was analyzed in each lane, and immunoblot analyses were performed with the peptide affinity-purified MAGE-11 antibody (2.9 μg/ml) raised in a rabbit. The MAGE-11 antibody was untreated (lanes 1 to 8) or preadsorbed overnight at 4°C by adding 5 μl of 0.5 mg of peptide immunogen/ml to 28 μl of 0.52-mg/ml antibody (lanes 9 to 16). Transiently expressed pSG5-MAGE-11 from COS cells was analyzed with 1 μg (lanes 1 and 9) and 2 μg (lanes 8 and 16) of total protein. The HeLaAR1C cell line expresses a stably integrated Flag-tagged human AR (P. D. Reynolds and E. M. Wilson, unpublished studies). The MAGE-11 antibody was relatively specific to MAGE-11 but also interacted on immunoblots with a ∼80-kDa DNA helicase (data not shown).

    Journal: Molecular and Cellular Biology

    Article Title: Melanoma Antigen Gene Protein MAGE-11 Regulates Androgen Receptor Function by Modulating the Interdomain Interaction

    doi: 10.1128/MCB.25.4.1238-1257.2005

    Figure Lengend Snippet: Endogenous MAGE-11 expression. (A) MAGE-11 mRNA was analyzed by RT-PCR. Total RNA (2 μg) was reverse transcribed, and the resulting cDNAs were amplified by 35 PCR cycles (top). In addition, 2 μl of the first PCRs was used as a template for a second 35-cycle PCR amplification with the same primers (bottom). Amplified MAGE-11 DNA fragments are shown for pSG5-MAGE-11 (lane 1), human foreskin fibroblasts (HFF, lane 2) and prostate cancer cell lines LNCaP (lane 3), LNCaP-C4-2 (lane 4), CWR-R1 (lane 5), CWR22-RV1 (lane 6), LAPC4 (lane 7), PC-3 (lane 8), and DU-145 (lane 9), as well as from HeLa cells (lane 10), HeLaAR1C cell line stably expressing human AR (lane 11), HepG2 (lane 12), COS cells (lane 13), CV1 cells (lane 14), human testis tissue (lane 15), and the no-RNA control (lane 16). The products were analyzed on 2% agarose gels. (B) Total RNA was isolated from adult human tissues with Trizol, reverse transcribed, and PCR amplified as described in Materials and Methods. Shown are the results of 35 PCR cycles with cDNA from human testis (lane 1), prostate (lane 2), a prostate tumor (lane 3), breast (lane 4), ovary (lane 5), lung (lane 6), adrenal gland (lane 7), and liver (lane 8). (C) Endogenous MAGE-11 protein (70 kDa) was detected in immunoblots with the anti-MAGE-11 peptide antibody described in Materials and Methods. The indicated cell lines were cultured to near confluence, and total protein was extracted with radioimmunoprecipitation assay buffer as described in Materials and Methods. Total protein (100 μg) was analyzed in each lane, and immunoblot analyses were performed with the peptide affinity-purified MAGE-11 antibody (2.9 μg/ml) raised in a rabbit. The MAGE-11 antibody was untreated (lanes 1 to 8) or preadsorbed overnight at 4°C by adding 5 μl of 0.5 mg of peptide immunogen/ml to 28 μl of 0.52-mg/ml antibody (lanes 9 to 16). Transiently expressed pSG5-MAGE-11 from COS cells was analyzed with 1 μg (lanes 1 and 9) and 2 μg (lanes 8 and 16) of total protein. The HeLaAR1C cell line expresses a stably integrated Flag-tagged human AR (P. D. Reynolds and E. M. Wilson, unpublished studies). The MAGE-11 antibody was relatively specific to MAGE-11 but also interacted on immunoblots with a ∼80-kDa DNA helicase (data not shown).

    Article Snippet: For immunoblot analysis, the radioimmunoprecipitation assay extraction buffer contained 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.5 mM EDTA, 50 mM Tris-HCl (pH 7.4), and 1 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Roche).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Stable Transfection, Isolation, Western Blot, Cell Culture, Radio Immunoprecipitation, Affinity Purification