Structured Review

PerkinElmer polymerase chain reaction pcr buffer
Polymerase Chain Reaction Pcr Buffer, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr buffer/product/PerkinElmer
Average 84 stars, based on 1 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction pcr buffer - by Bioz Stars, 2020-03
84/100 stars

Images

Related Articles

Diagnostic Assay:

Article Title: Aberrant TNF secretion by whole blood in healthy subjects with a history of reactive arthritis: time course in adherent and non-adherent cultures
Article Snippet: .. The following reagents were used: pyrogen‐free heparin (Lövens, Ballerup, Denmark); Dulbecco's phosphate buffered saline (PBS) and RPMI 1640 medium (both from Life Technologies, Paisley, UK); Escherichia coli O111:B4 lipopolysaccharide (LPS); phorbol 12‐myristate 13‐acetate (PMA) and Ca2+ ionophore (all from Sigma, St Louis, Missouri, USA); TNF sample diluent (Diagnostic Products, Los Angeles, California, USA); sterile AB serum (Finnish Red Cross, Helsinki, Finland); fluorescein isothiocyanate (FITC) conjugate of mouse anti‐CD11b mAb (IgG1, clone BEAR 1), phycoerythrin‐CY5 (PC5) conjugate of anti‐CD16 mAb (IgG1, clone 3G8), and PC5 conjugate of irrelevant mouse mAb IgG1 (clone 679.1Mc7) (all from Immunotech, Marseille, France); R‐phycoerythrin (RPE) conjugate of anti‐CD14 mAb (IgG2a, clone TÜK4) and RPE conjugate of irrelevant mAb (IgG2a, clone DAK‐GO5) (both from Dako, Glostrup, Denmark); FACS lysing solution and QuantiBRITE phycoerythrin (PE) standards (Becton Dickinson, San José, California, USA); dNTPs (Pharmacia, Uppsala, Sweden); AmpliTaq Gold DNA polymerase and polymerase chain reaction (PCR) buffer (Perkin Elmer, Boston, Massachusetts, USA); shrimp alkaline phosphatase and exonuclease I (USB, Cleveland, Ohio, USA); DyNAzyme DNA polymerase II and DyNAzyme buffer (Finnzymes, Espoo, Finland); 3 H labelled dCTP (specific activity 53 Ci/mmol) and dTTP (96 Ci/mmol) (Amersham Life Sciences, Buckinghamshire, UK); and primers (Sigma‐Genosys, Cambridgeshire, UK). .. The first was collected into a Falcon polypropylene tube (Becton Dickinson, Lincoln Park, New Jersey, USA) containing heparin 10 IU/ml blood, and placed in an ice water bath.

Amplification:

Article Title: Differential use of immunoglobulin light chain genes and B lymphocyte expansion at sites of disease in rheumatoid arthritis (RA) compared with circulating B lymphocytes
Article Snippet: Poly G-tailed cDNA (5 μl) was amplified using a primer specific for the poly G tail (anch2pc: 5′ ACGAATTCTAGAGTCGACCCC CCCCCCCCCC 3′) with a consensus primer for λ constant regions (CL1: 5′ AAAAATTCACACCAGTGTGGCCTTG 3′) or κ constant region (CK1: 5′ AACAGAGGCAGTTCCAGAGTT 3′). .. PCR mixture (50 μl), containing 5 μl cDNA, 5 μl 10× polymerase chain reaction (PCR) buffer (Perkin-Elmer, Beaconsfield, UK), 100 ng anch2pc and 175 μ m dNTP, was incubated at 96°C for 5 min, 60°C for 5 min before adding 1 U of Taq polymerase.

Article Title: Evaluation of the Clonal Relationship between Primary and Metastatic Renal Cell Carcinoma by Comparative Genomic Hybridization
Article Snippet: .. Microsatellites were amplified from 50 to 150 ng of genomic DNA using 6 pmol of the corresponding primer pairs, with one primer carrying an IRD-41 label, in polymerase chain reaction (PCR) buffer (Perkin Elmer, Norwalk, CT) with 200 mmol/L each of dATP, dCTP, dGTP, and dTTP and 1.25 U of Taq DNA polymerase (Perkin Elmer) in a total reaction volume of 25 μl. .. PCR was performed on an Eppendorf Mastercycler 5330 using the following conditions: denaturation at 95°C for 5 minutes, 35 cycles with 95°C for 20 seconds, 62°C (D3S1350) or 56°C (D3S1038) for 20 seconds, and 72°C for 50 seconds, followed by a final extension step of 5 minutes at 72°C.

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: .. The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer). .. PCR was performed in a DNA thermal cycler (PerkinElmer) for 30 cycles of 40 s at 94°C, 40 s at 62°C, and 60 s at 72°C.

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR. .. PCR amplification of the K-ras2 fragment in exon 1-containing codons 12 and 13 was done in a total volume of 50 μl of PCR reaction mixture (50 mmol/L KCl; 10 mmol/L Tris-HCl, pH 8.3; 1.5 mmol/L MgCl2 ; 0.01% gelatin; 200 μmol/L each dATP, dGTP, dCTP, and dTTP; and 0.8 to 1.2 μmol/L for each oligonucleotide primer (Beckman, Fullerton, CA)) and 2.0 U of Taq polymerase (Perkin-Elmer).

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ). .. Then samples were incubated for 10 minutes at 94°C to inactivate the proteinase K. Next 7.5 μl of the solution was added to the appropriate PCR mixture for further PCR amplification, under the conditions described below.

Random Hexamer Labeling:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: RNA was reverse-transcribed into cDNA using Rous associated virus-2 (RAV-2) reverse transcriptase (RT) (Takara, Othu, Japan) and random hexamer primers (Boehringer). .. The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT).

Activity Assay:

Article Title: Aberrant TNF secretion by whole blood in healthy subjects with a history of reactive arthritis: time course in adherent and non-adherent cultures
Article Snippet: .. The following reagents were used: pyrogen‐free heparin (Lövens, Ballerup, Denmark); Dulbecco's phosphate buffered saline (PBS) and RPMI 1640 medium (both from Life Technologies, Paisley, UK); Escherichia coli O111:B4 lipopolysaccharide (LPS); phorbol 12‐myristate 13‐acetate (PMA) and Ca2+ ionophore (all from Sigma, St Louis, Missouri, USA); TNF sample diluent (Diagnostic Products, Los Angeles, California, USA); sterile AB serum (Finnish Red Cross, Helsinki, Finland); fluorescein isothiocyanate (FITC) conjugate of mouse anti‐CD11b mAb (IgG1, clone BEAR 1), phycoerythrin‐CY5 (PC5) conjugate of anti‐CD16 mAb (IgG1, clone 3G8), and PC5 conjugate of irrelevant mouse mAb IgG1 (clone 679.1Mc7) (all from Immunotech, Marseille, France); R‐phycoerythrin (RPE) conjugate of anti‐CD14 mAb (IgG2a, clone TÜK4) and RPE conjugate of irrelevant mAb (IgG2a, clone DAK‐GO5) (both from Dako, Glostrup, Denmark); FACS lysing solution and QuantiBRITE phycoerythrin (PE) standards (Becton Dickinson, San José, California, USA); dNTPs (Pharmacia, Uppsala, Sweden); AmpliTaq Gold DNA polymerase and polymerase chain reaction (PCR) buffer (Perkin Elmer, Boston, Massachusetts, USA); shrimp alkaline phosphatase and exonuclease I (USB, Cleveland, Ohio, USA); DyNAzyme DNA polymerase II and DyNAzyme buffer (Finnzymes, Espoo, Finland); 3 H labelled dCTP (specific activity 53 Ci/mmol) and dTTP (96 Ci/mmol) (Amersham Life Sciences, Buckinghamshire, UK); and primers (Sigma‐Genosys, Cambridgeshire, UK). .. The first was collected into a Falcon polypropylene tube (Becton Dickinson, Lincoln Park, New Jersey, USA) containing heparin 10 IU/ml blood, and placed in an ice water bath.

Expressing:

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: Paragraph title: Comparison of mRNA expression for collagen type I and transforming growth factor β 1 by cells cultured on LDI–glucose polymer and tissue culture polystyrene ... The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer).

Transfection:

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: Additionally, six cell lines were used as controls for known K-ras2 mutations, ie, murine NIH3T3 with a transfected human K-ras2 CGT in codon 12, human SW480 cells (American Type Culture Collection (ATCC), Manassas, VA) that are GTT homozygously mutated in codon 12; human DLD-1 cells (ATCC) heterozygously GAC mutated in codon 13; human SW837 cells (ATCC) heterozygously TGT mutated in codon 12; and two human lung cancer cell lines, A549 and SKLU-1, respectively heterozygously AGT and GAT mutated in codon 12. .. FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR.

Cell Culture:

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: Paragraph title: Comparison of mRNA expression for collagen type I and transforming growth factor β 1 by cells cultured on LDI–glucose polymer and tissue culture polystyrene ... The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer).

Polymerase Chain Reaction:

Article Title: Differential use of immunoglobulin light chain genes and B lymphocyte expansion at sites of disease in rheumatoid arthritis (RA) compared with circulating B lymphocytes
Article Snippet: .. PCR mixture (50 μl), containing 5 μl cDNA, 5 μl 10× polymerase chain reaction (PCR) buffer (Perkin-Elmer, Beaconsfield, UK), 100 ng anch2pc and 175 μ m dNTP, was incubated at 96°C for 5 min, 60°C for 5 min before adding 1 U of Taq polymerase. ..

Article Title: Aberrant TNF secretion by whole blood in healthy subjects with a history of reactive arthritis: time course in adherent and non-adherent cultures
Article Snippet: .. The following reagents were used: pyrogen‐free heparin (Lövens, Ballerup, Denmark); Dulbecco's phosphate buffered saline (PBS) and RPMI 1640 medium (both from Life Technologies, Paisley, UK); Escherichia coli O111:B4 lipopolysaccharide (LPS); phorbol 12‐myristate 13‐acetate (PMA) and Ca2+ ionophore (all from Sigma, St Louis, Missouri, USA); TNF sample diluent (Diagnostic Products, Los Angeles, California, USA); sterile AB serum (Finnish Red Cross, Helsinki, Finland); fluorescein isothiocyanate (FITC) conjugate of mouse anti‐CD11b mAb (IgG1, clone BEAR 1), phycoerythrin‐CY5 (PC5) conjugate of anti‐CD16 mAb (IgG1, clone 3G8), and PC5 conjugate of irrelevant mouse mAb IgG1 (clone 679.1Mc7) (all from Immunotech, Marseille, France); R‐phycoerythrin (RPE) conjugate of anti‐CD14 mAb (IgG2a, clone TÜK4) and RPE conjugate of irrelevant mAb (IgG2a, clone DAK‐GO5) (both from Dako, Glostrup, Denmark); FACS lysing solution and QuantiBRITE phycoerythrin (PE) standards (Becton Dickinson, San José, California, USA); dNTPs (Pharmacia, Uppsala, Sweden); AmpliTaq Gold DNA polymerase and polymerase chain reaction (PCR) buffer (Perkin Elmer, Boston, Massachusetts, USA); shrimp alkaline phosphatase and exonuclease I (USB, Cleveland, Ohio, USA); DyNAzyme DNA polymerase II and DyNAzyme buffer (Finnzymes, Espoo, Finland); 3 H labelled dCTP (specific activity 53 Ci/mmol) and dTTP (96 Ci/mmol) (Amersham Life Sciences, Buckinghamshire, UK); and primers (Sigma‐Genosys, Cambridgeshire, UK). .. The first was collected into a Falcon polypropylene tube (Becton Dickinson, Lincoln Park, New Jersey, USA) containing heparin 10 IU/ml blood, and placed in an ice water bath.

Article Title: Evaluation of the Clonal Relationship between Primary and Metastatic Renal Cell Carcinoma by Comparative Genomic Hybridization
Article Snippet: .. Microsatellites were amplified from 50 to 150 ng of genomic DNA using 6 pmol of the corresponding primer pairs, with one primer carrying an IRD-41 label, in polymerase chain reaction (PCR) buffer (Perkin Elmer, Norwalk, CT) with 200 mmol/L each of dATP, dCTP, dGTP, and dTTP and 1.25 U of Taq DNA polymerase (Perkin Elmer) in a total reaction volume of 25 μl. .. PCR was performed on an Eppendorf Mastercycler 5330 using the following conditions: denaturation at 95°C for 5 minutes, 35 cycles with 95°C for 20 seconds, 62°C (D3S1350) or 56°C (D3S1038) for 20 seconds, and 72°C for 50 seconds, followed by a final extension step of 5 minutes at 72°C.

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: .. The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer). .. PCR was performed in a DNA thermal cycler (PerkinElmer) for 30 cycles of 40 s at 94°C, 40 s at 62°C, and 60 s at 72°C.

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: .. The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ). .. Then 0.5 μg of proteinase K diluted in 1 μl of double-distilled water (ddH2 O) was added to each sample and incubated at 55°C for 24 hours.

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: .. The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). ..

Cellular Antioxidant Activity Assay:

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR. .. A PCR product of 69 bp was obtained after successive amplifications using both outside and inside (nested) primers flanking codons 12 and 13 of the K-ras2 gene, as follows: outside primers: 5′ primer, 5′-TAA GGC CTG CTG AAA ATG ACT GAA T-3′, and 3′ primer, 5′-CTC TAT TGT TGG ATC ATA TTC GTC-3′; inside primers (nested): 5′ primer, 5′-ACT GAA TAT AAA CTT GTG GTA GTT-3′, and 3′ primer, 5′-AAT TAG CTG TAT CGT CAA GGC-3′.

Molecular Weight:

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: High molecular weight genomic DNA was extracted by a standard method. .. FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR.

DNA Extraction:

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: Paragraph title: DNA Extraction ... The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ).

Isolation:

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: Selected cases were submitted to laser-based microdissection (PALM Laser-Microbeam Systems GmbH, Germany) to obtain isolated single neoplastic follicles and single nests of medullary carcinoma. .. The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ).

Mouse Assay:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: To analyse gene expressions of cytokine in the eye, tumour-bearing eyes pooled from each group of five mice were enucleated on day 7 after the inoculation, minced with scissors, and treated with collagenase/dispase (Boehringer, Mannheim, Germany) at a final concentration of 1 mg/ml for 90 min at 37°C. .. The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT).

FACS:

Article Title: Aberrant TNF secretion by whole blood in healthy subjects with a history of reactive arthritis: time course in adherent and non-adherent cultures
Article Snippet: .. The following reagents were used: pyrogen‐free heparin (Lövens, Ballerup, Denmark); Dulbecco's phosphate buffered saline (PBS) and RPMI 1640 medium (both from Life Technologies, Paisley, UK); Escherichia coli O111:B4 lipopolysaccharide (LPS); phorbol 12‐myristate 13‐acetate (PMA) and Ca2+ ionophore (all from Sigma, St Louis, Missouri, USA); TNF sample diluent (Diagnostic Products, Los Angeles, California, USA); sterile AB serum (Finnish Red Cross, Helsinki, Finland); fluorescein isothiocyanate (FITC) conjugate of mouse anti‐CD11b mAb (IgG1, clone BEAR 1), phycoerythrin‐CY5 (PC5) conjugate of anti‐CD16 mAb (IgG1, clone 3G8), and PC5 conjugate of irrelevant mouse mAb IgG1 (clone 679.1Mc7) (all from Immunotech, Marseille, France); R‐phycoerythrin (RPE) conjugate of anti‐CD14 mAb (IgG2a, clone TÜK4) and RPE conjugate of irrelevant mAb (IgG2a, clone DAK‐GO5) (both from Dako, Glostrup, Denmark); FACS lysing solution and QuantiBRITE phycoerythrin (PE) standards (Becton Dickinson, San José, California, USA); dNTPs (Pharmacia, Uppsala, Sweden); AmpliTaq Gold DNA polymerase and polymerase chain reaction (PCR) buffer (Perkin Elmer, Boston, Massachusetts, USA); shrimp alkaline phosphatase and exonuclease I (USB, Cleveland, Ohio, USA); DyNAzyme DNA polymerase II and DyNAzyme buffer (Finnzymes, Espoo, Finland); 3 H labelled dCTP (specific activity 53 Ci/mmol) and dTTP (96 Ci/mmol) (Amersham Life Sciences, Buckinghamshire, UK); and primers (Sigma‐Genosys, Cambridgeshire, UK). .. The first was collected into a Falcon polypropylene tube (Becton Dickinson, Lincoln Park, New Jersey, USA) containing heparin 10 IU/ml blood, and placed in an ice water bath.

Activated Clotting Time Assay:

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR. .. A PCR product of 69 bp was obtained after successive amplifications using both outside and inside (nested) primers flanking codons 12 and 13 of the K-ras2 gene, as follows: outside primers: 5′ primer, 5′-TAA GGC CTG CTG AAA ATG ACT GAA T-3′, and 3′ primer, 5′-CTC TAT TGT TGG ATC ATA TTC GTC-3′; inside primers (nested): 5′ primer, 5′-ACT GAA TAT AAA CTT GTG GTA GTT-3′, and 3′ primer, 5′-AAT TAG CTG TAT CGT CAA GGC-3′.

Software:

Article Title: Evaluation of the Clonal Relationship between Primary and Metastatic Renal Cell Carcinoma by Comparative Genomic Hybridization
Article Snippet: Microsatellites were amplified from 50 to 150 ng of genomic DNA using 6 pmol of the corresponding primer pairs, with one primer carrying an IRD-41 label, in polymerase chain reaction (PCR) buffer (Perkin Elmer, Norwalk, CT) with 200 mmol/L each of dATP, dCTP, dGTP, and dTTP and 1.25 U of Taq DNA polymerase (Perkin Elmer) in a total reaction volume of 25 μl. .. PCR products were separated on 5% LongRanger gels (FMC BioProducts, Denmark), and the band densities were measured using a LICOR DNA sequencer 4000 (MWG Biotech) and RFLPscan software (Scanalytics, CSPI).

RNA Extraction:

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: After culture of BMSCs on LDI–glucose polymer or TCPS, cells were washed twice with PBS for 5 min each time, and their RNA was extracted with an RNA extraction kit (Qiagen, Santa Clara, CA). .. The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer).

Agarose Gel Electrophoresis:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). .. Each PCR product (10 μl) was electrophoresed on 1.7% agarose gel and was stained by ethidium bromide.

Laser Capture Microdissection:

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: Selected cases were submitted to laser-based microdissection (PALM Laser-Microbeam Systems GmbH, Germany) to obtain isolated single neoplastic follicles and single nests of medullary carcinoma. .. The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ).

Incubation:

Article Title: Differential use of immunoglobulin light chain genes and B lymphocyte expansion at sites of disease in rheumatoid arthritis (RA) compared with circulating B lymphocytes
Article Snippet: .. PCR mixture (50 μl), containing 5 μl cDNA, 5 μl 10× polymerase chain reaction (PCR) buffer (Perkin-Elmer, Beaconsfield, UK), 100 ng anch2pc and 175 μ m dNTP, was incubated at 96°C for 5 min, 60°C for 5 min before adding 1 U of Taq polymerase. ..

Article Title: Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers
Article Snippet: Thereafter, the reaction mixture was cooled on ice and incubated with 200 U of Moloney murine leukemia virus (Mo-MuLV) reverse transcriptase for 60 min at 37°C. .. The cDNA was amplified with 0.1 μ g of each specific primer in a reaction mixture containing 200 μ M dNTPs and 0.1 unit of Taq polymerase in polymerase chain reaction (PCR) buffer (PerkinElmer).

Article Title: Mixed Medullary-Follicular Thyroid Carcinoma
Article Snippet: The dewaxed and hematoxylin-stained tissue was placed in 0.5-ml Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany) and boiled for 10 minutes at 94°C in 18 μl 1× polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl; GeneAmp, Perkin Elmer, Roche, NJ). .. Then 0.5 μg of proteinase K diluted in 1 μl of double-distilled water (ddH2 O) was added to each sample and incubated at 55°C for 24 hours.

Concentration Assay:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: To analyse gene expressions of cytokine in the eye, tumour-bearing eyes pooled from each group of five mice were enucleated on day 7 after the inoculation, minced with scissors, and treated with collagenase/dispase (Boehringer, Mannheim, Germany) at a final concentration of 1 mg/ml for 90 min at 37°C. .. The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT).

CTG Assay:

Article Title: Specific K-ras2 Mutations in Human Sporadic Colorectal Adenomas Are Associated with DNA Near-Diploid Aneuploidy and Inhibition of Proliferation
Article Snippet: FCM-sorted nuclei from both control mucosa and adenomas were stored at −80°C and then treated as follows: they were first washed 30 minutes at 1500 × g in phosphate-buffered saline, then resuspended in 1× polymerase chain reaction (PCR) buffer (Perkin-Elmer Corp., Norwalk, CT), and finally heated to 100°C for 10 minutes before PCR. .. A PCR product of 69 bp was obtained after successive amplifications using both outside and inside (nested) primers flanking codons 12 and 13 of the K-ras2 gene, as follows: outside primers: 5′ primer, 5′-TAA GGC CTG CTG AAA ATG ACT GAA T-3′, and 3′ primer, 5′-CTC TAT TGT TGG ATC ATA TTC GTC-3′; inside primers (nested): 5′ primer, 5′-ACT GAA TAT AAA CTT GTG GTA GTT-3′, and 3′ primer, 5′-AAT TAG CTG TAT CGT CAA GGC-3′.

Staining:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). .. Each PCR product (10 μl) was electrophoresed on 1.7% agarose gel and was stained by ethidium bromide.

Gradient Centrifugation:

Article Title: Requirement for splenic CD4+ T cells in the immune privilege of the anterior chamber of the eye
Article Snippet: For recovering lymphocytes from the monodispersed cells, mixtures of lymphocytes and tumour cells were first prepared by Ficoll–Isopaque density (1090) gradient centrifugation, and then both CD4+ and CD8+ T cells were selectively separated using immune beads from the mixture. .. The cDNA reaction mixture was diluted with 90 μl of polymerase chain reaction (PCR) buffer and mixed with 50 pmol of the 5′ and 3′ primer, 1.25 m m dNTP, 20 m m MgCl2 , and 2 U of thermostable Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    PerkinElmer pcr buffer
    Differential detection of T. saginata , T. solium , and E. granulossus by multiplex <t>PCR.</t> Samples of genomic DNA (1 ng) from T. saginata (lane 1), T. solium (lane 2), T. taeniformis B (lane 3), T. taeniformis M (lane 4), E. granulosus (lane 5), a calf (lane 6), and a human (lane 7) were amplified by the multiplex PCR based on the PTs7S35F1, PTs7S35F2, and PTs7S35R1 primers derived from the T. saginata genomic sequence <t>HDP2.</t> A negative control without DNA was also included (lane 8). The reactions were carried out as described in Materials and Methods. The amplification products were fractionated on a 2% agarose gel and were stained with ethidium bromide. Promega PCR molecular markers were used (lanes M).
    Pcr Buffer, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/PerkinElmer
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    PerkinElmer pcr buffer ii
    Leishmania burden in patient 1, estimated by semiquantitative <t>PCR</t> with peripheral blood. Six serial 10-fold dilutions of the extracted <t>DNA</t> separately underwent amplification with human β-globin and Leishmania -specific primers. Lane 1, molecular weight marker; lanes 2 to 7, serial 10-fold dilutions from 1 μg to 1 pg of target DNA; lane 8, negative control; lane 9, positive control. T 0 , time of clinical presentation with VL (fever, pancytopenia, hepatosplenomegaly); T 1 , 2 weeks following successful treatment with a negative result by PCR with peripheral blood; T 2 , time of follow-up at 34 weeks with reappearance of a positive PCR result without clinical symptoms of VL; T 3 , time of follow-up at 36 weeks with an increase in the parasite burden and the reappearance of symptoms of VL.
    Pcr Buffer Ii, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 169 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer ii/product/PerkinElmer
    Average 99 stars, based on 169 article reviews
    Price from $9.99 to $1999.99
    pcr buffer ii - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Differential detection of T. saginata , T. solium , and E. granulossus by multiplex PCR. Samples of genomic DNA (1 ng) from T. saginata (lane 1), T. solium (lane 2), T. taeniformis B (lane 3), T. taeniformis M (lane 4), E. granulosus (lane 5), a calf (lane 6), and a human (lane 7) were amplified by the multiplex PCR based on the PTs7S35F1, PTs7S35F2, and PTs7S35R1 primers derived from the T. saginata genomic sequence HDP2. A negative control without DNA was also included (lane 8). The reactions were carried out as described in Materials and Methods. The amplification products were fractionated on a 2% agarose gel and were stained with ethidium bromide. Promega PCR molecular markers were used (lanes M).

    Journal: Journal of Clinical Microbiology

    Article Title: Differential Diagnosis of Taenia saginata and Taenia solium Infection by PCR

    doi:

    Figure Lengend Snippet: Differential detection of T. saginata , T. solium , and E. granulossus by multiplex PCR. Samples of genomic DNA (1 ng) from T. saginata (lane 1), T. solium (lane 2), T. taeniformis B (lane 3), T. taeniformis M (lane 4), E. granulosus (lane 5), a calf (lane 6), and a human (lane 7) were amplified by the multiplex PCR based on the PTs7S35F1, PTs7S35F2, and PTs7S35R1 primers derived from the T. saginata genomic sequence HDP2. A negative control without DNA was also included (lane 8). The reactions were carried out as described in Materials and Methods. The amplification products were fractionated on a 2% agarose gel and were stained with ethidium bromide. Promega PCR molecular markers were used (lanes M).

    Article Snippet: Multiplex PCR with HDP2-based primers was performed in a total volume of 25 μl with PCR buffer (PCR buffer I; Perkin-Elmer) and final concentrations of 0.4% glycerol, each deoxynucleoside triphosphate (Pharmacia) at a concentration of 200 mM, 0.5 μM primer PTs7S35F1, 0.5 μM primer PTs7S35F2, 1 mM primer PTs7S35R1, and 2.5 U of Taq polymerase (Perkin-Elmer).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Amplification, Derivative Assay, Sequencing, Negative Control, Agarose Gel Electrophoresis, Staining

    Sequence similarity of DNA amplified by PCR from B. cereus ATCC 43881 (solid circles), B. thuringiensis ATCC 33679 (open circles), B. cereus F1-15 (solid squares), B. cereus 3A (open squares), B. cereus D-17 (open triangles), B. cereus 14759 (solid triangles), and B. subtilis 6051 (open diamonds) to B. anthracis pXO1 ORF sequences. The y axis is the percent similarity of individual PCR products amplified from five different isolates. PCR amplicons were single pass sequenced from the PCR primer sites as described in Materials and Methods.

    Journal: Journal of Bacteriology

    Article Title: Bacillus anthracis pXO1 Plasmid Sequence Conservation among Closely Related Bacterial Species

    doi: 10.1128/JB.184.1.134-141.2002

    Figure Lengend Snippet: Sequence similarity of DNA amplified by PCR from B. cereus ATCC 43881 (solid circles), B. thuringiensis ATCC 33679 (open circles), B. cereus F1-15 (solid squares), B. cereus 3A (open squares), B. cereus D-17 (open triangles), B. cereus 14759 (solid triangles), and B. subtilis 6051 (open diamonds) to B. anthracis pXO1 ORF sequences. The y axis is the percent similarity of individual PCR products amplified from five different isolates. PCR amplicons were single pass sequenced from the PCR primer sites as described in Materials and Methods.

    Article Snippet: PCR mixtures to generate hybridization probes contained 0.5 to 1.0 ng of pXO1 DNA as the template and 1× PCR buffer containing 1.5 mM MgCl2 , 0.8 mM (each) deoxynucleoside triphosphate, 1.25 U of Ampli Taq DNA polymerase (Perkin-Elmer, Boston, Mass.), and 45 μM (each) primer per 50-μl reaction mixture.

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction

    ( A ) Panhandle PCR products from der(11) chromosome of t(4;11)(q21;q23) in treatment-related ALL of patient 33. Brackets indicate separate panhandle PCRs where identical 2620-bp products were obtained. ( B ) Sequence of t(4;11) breakpoint junction in individual subclones, 38–1, 38–2, and 38–4, from panhandle PCR. The 5′ 2029 bp include MLL forward nested primer and MLL bcr sequence; 516 bp of 3′ sequence are partner DNA, and 75 bp of 3′ sequence extend from ligated oligonucleotide (P-Oligo) through reverse nested primer. Comparison with normal sequence identified the breakpoint at nucleotide 2158 in MLL intron 6 (bold arrow). Alu J repeats in MLL and partner DNA are shown. Sequences were the same in all three subclones.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Panhandle PCR strategy to amplify MLL genomic breakpoints in treatment-related leukemias

    doi:

    Figure Lengend Snippet: ( A ) Panhandle PCR products from der(11) chromosome of t(4;11)(q21;q23) in treatment-related ALL of patient 33. Brackets indicate separate panhandle PCRs where identical 2620-bp products were obtained. ( B ) Sequence of t(4;11) breakpoint junction in individual subclones, 38–1, 38–2, and 38–4, from panhandle PCR. The 5′ 2029 bp include MLL forward nested primer and MLL bcr sequence; 516 bp of 3′ sequence are partner DNA, and 75 bp of 3′ sequence extend from ligated oligonucleotide (P-Oligo) through reverse nested primer. Comparison with normal sequence identified the breakpoint at nucleotide 2158 in MLL intron 6 (bold arrow). Alu J repeats in MLL and partner DNA are shown. Sequences were the same in all three subclones.

    Article Snippet: Two hundred nanograms of genomic DNA from the leukemic cells were amplified in 50-μl PCR mixtures with 0.5 units of Taq Gold DNA polymerase, 250 μM each dNTP, PCR buffer at 1× final concentration (Perkin–Elmer), and 5 pmol each primer.

    Techniques: Polymerase Chain Reaction, Sequencing

    Leishmania burden in patient 1, estimated by semiquantitative PCR with peripheral blood. Six serial 10-fold dilutions of the extracted DNA separately underwent amplification with human β-globin and Leishmania -specific primers. Lane 1, molecular weight marker; lanes 2 to 7, serial 10-fold dilutions from 1 μg to 1 pg of target DNA; lane 8, negative control; lane 9, positive control. T 0 , time of clinical presentation with VL (fever, pancytopenia, hepatosplenomegaly); T 1 , 2 weeks following successful treatment with a negative result by PCR with peripheral blood; T 2 , time of follow-up at 34 weeks with reappearance of a positive PCR result without clinical symptoms of VL; T 3 , time of follow-up at 36 weeks with an increase in the parasite burden and the reappearance of symptoms of VL.

    Journal: Journal of Clinical Microbiology

    Article Title: Role of PCR in Diagnosis and Prognosis of Visceral Leishmaniasis in Patients Coinfected with Human Immunodeficiency Virus Type 1

    doi: 10.1128/JCM.39.1.357-361.2001

    Figure Lengend Snippet: Leishmania burden in patient 1, estimated by semiquantitative PCR with peripheral blood. Six serial 10-fold dilutions of the extracted DNA separately underwent amplification with human β-globin and Leishmania -specific primers. Lane 1, molecular weight marker; lanes 2 to 7, serial 10-fold dilutions from 1 μg to 1 pg of target DNA; lane 8, negative control; lane 9, positive control. T 0 , time of clinical presentation with VL (fever, pancytopenia, hepatosplenomegaly); T 1 , 2 weeks following successful treatment with a negative result by PCR with peripheral blood; T 2 , time of follow-up at 34 weeks with reappearance of a positive PCR result without clinical symptoms of VL; T 3 , time of follow-up at 36 weeks with an increase in the parasite burden and the reappearance of symptoms of VL.

    Article Snippet: PCRs were performed in a final volume of 100 μl containing 1 μg of template DNA (or 5 μl of crude lysate), each primer at a concentration of 0.2 μM, 200 μM deoxynucleoside triphosphates, 2.5 U of AmpliTaq Gold DNA polymerase, 2 mM MgCl2 , and 1× PCR Buffer II (Perkin-Elmer).

    Techniques: Polymerase Chain Reaction, Amplification, Molecular Weight, Marker, Negative Control, Positive Control