Structured Review

Stratagene polymerase chain reaction mixture
Polymerase Chain Reaction Mixture, supplied by Stratagene, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction mixture/product/Stratagene
Average 89 stars, based on 1 article reviews
Price from $9.99 to $1999.99
polymerase chain reaction mixture - by Bioz Stars, 2021-01
89/100 stars

Images

Related Articles

Clone Assay:

Article Title: Site-specific interaction of the murine pre-replicative complex with origin DNA: assembly and disassembly during cell cycle transit and differentiation
Article Snippet: .. Site-directed mutagenesis The PCR mixture contained 20 ng template plasmid DNA (1545 bp rDNA fragment from −3476 to −1931 cloned into pUC18), 15 pmol of each oligonucleotide, 200 µM dNTPs, 2.5 U Pfu DNA polymerase (Stratagene) and buffer in a total volume of 50 µl. ..

Amplification:

Article Title: Estrogen receptors activate atrial natriuretic peptide in the rat heart
Article Snippet: .. Ten microliters of first-strand cDNA was added to a PCR mixture and amplified for 25–33 cycles by incubation at 95°C for 1 min, 57o C for 1 min, and 72°C for 1.5 min, with a final incubation at 72°C for 3 min, all in a Robocycler gradient 40 thermocycler (Stratagene). .. The methodology of semiquantitative RT-PCR and primer selection for ERα and ERβ transcript amplifications was adapted from Kuiper et al. ( ).

Ligation:

Article Title: Hepatocyte turnover during resolution of a transient hepadnaviral infection
Article Snippet: .. Approximately 0.4 ml from each well of the ligation plate was transferred to a third PCR microplate whose wells each contained 10 μl of the PCR mix consisting of Herculase Hotstart DNA Polymerase (25 units/ml, from Stratagene), Herculase buffer supplemented to contain 2.5 mM MgCl2 , 200 μM each dNTP, 100 nM each S1 primer set, and 100 units/ml Hin dIII. .. Finally, ≈0.1 μl from each well was transferred to a fourth PCR microplate whose wells each contained 10 μl of the Herculase PCR mix above, but with 100 nM each of the nested S2 primer set, and omitting the Hin dIII.

Mutagenesis:

Article Title: Site-specific interaction of the murine pre-replicative complex with origin DNA: assembly and disassembly during cell cycle transit and differentiation
Article Snippet: .. Site-directed mutagenesis The PCR mixture contained 20 ng template plasmid DNA (1545 bp rDNA fragment from −3476 to −1931 cloned into pUC18), 15 pmol of each oligonucleotide, 200 µM dNTPs, 2.5 U Pfu DNA polymerase (Stratagene) and buffer in a total volume of 50 µl. ..

Quantitative RT-PCR:

Article Title: Pentoxifylline inhibits pulmonary inflammation induced by infrarenal aorticcross-clamping dependent of adenosine receptor A2A
Article Snippet: .. The qRT-PCR reaction mixtures containing cDNA, PCR mix and A2A primers (5’-GAAGCAGATGGAGAGCCAAC-3’ and 5’-GAGAGGATGATGGCCAGGTA-3’) were prepared, and analyzed by MX3000P Real-time PCR systems (Stratagen, USA). ..

Real-time Polymerase Chain Reaction:

Article Title: Pentoxifylline inhibits pulmonary inflammation induced by infrarenal aorticcross-clamping dependent of adenosine receptor A2A
Article Snippet: .. The qRT-PCR reaction mixtures containing cDNA, PCR mix and A2A primers (5’-GAAGCAGATGGAGAGCCAAC-3’ and 5’-GAGAGGATGATGGCCAGGTA-3’) were prepared, and analyzed by MX3000P Real-time PCR systems (Stratagen, USA). ..

Incubation:

Article Title: Estrogen receptors activate atrial natriuretic peptide in the rat heart
Article Snippet: .. Ten microliters of first-strand cDNA was added to a PCR mixture and amplified for 25–33 cycles by incubation at 95°C for 1 min, 57o C for 1 min, and 72°C for 1.5 min, with a final incubation at 72°C for 3 min, all in a Robocycler gradient 40 thermocycler (Stratagene). .. The methodology of semiquantitative RT-PCR and primer selection for ERα and ERβ transcript amplifications was adapted from Kuiper et al. ( ).

Article Title: Mitogen‐Activated Protein Kinase and Intracellular Polyamine Signaling Is Involved in TRPV1 Activation–Induced Cardiac Hypertrophy
Article Snippet: .. The polymerase chain reaction mixture was incubated in a DNA Thermal Cycler (Stratagene). .. The resulting relative increase in reporter fluorescent dye (SYBR green) emission was monitored with the use of the ABI PRISM7700 sequence detector (Applied Biosystems).

Polymerase Chain Reaction:

Article Title: Site-specific interaction of the murine pre-replicative complex with origin DNA: assembly and disassembly during cell cycle transit and differentiation
Article Snippet: .. Site-directed mutagenesis The PCR mixture contained 20 ng template plasmid DNA (1545 bp rDNA fragment from −3476 to −1931 cloned into pUC18), 15 pmol of each oligonucleotide, 200 µM dNTPs, 2.5 U Pfu DNA polymerase (Stratagene) and buffer in a total volume of 50 µl. ..

Article Title: A Novel Gene, erm(41), Confers Inducible Macrolide Resistance to Clinical Isolates of Mycobacterium abscessus but Is Absent from Mycobacterium chelonae ▿
Article Snippet: .. The basic 50-μl PCR mixture comprised 2 μl DNA, 1 μl Herculase II fusion DNA polymerase (Stratagene, La Jolla, California), 200 μM deoxynucleoside triphosphate, 1 μM each primer, 5% dimethyl sulfoxide, 1× Herculase II PCR buffer (Stratagene). .. Reactions were run for 2 min at 95°C, followed by 30 to 35 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. For cloning of the resistance element, M. abscessus DNA was amplified with primers MC8-22bam (ACGTTGGATCCGAGCGCCGTCACAAGATGCACA) and MC8-23hind (GCGAGAAGCTTGACTTCCCCGCACCGATTCCAC).

Article Title: The RNA Editing Pattern of cox2 mRNA Is Affected by Point Mutations in Plant Mitochondria
Article Snippet: .. The PCR mixture contained 1 µM of each primer, 200 µM of each dNTP and 2.5 units of Pfu DNA polymerase (Stratagene) in a final volume of 50 µl, according to the supplier's protocol. .. Parameters for amplification were 95°C for 2 min, 20 cycles at 95°C for 30 s, 48°C for 30 s and 68°C for 14 min, and finally 68°C for 10 min. After amplification, 10 units of DpnI endonuclease (Promega) were directly added to the PCR reaction for 3 hours at 37°C to eliminate the original DNA template.

Article Title: Pentoxifylline inhibits pulmonary inflammation induced by infrarenal aorticcross-clamping dependent of adenosine receptor A2A
Article Snippet: .. The qRT-PCR reaction mixtures containing cDNA, PCR mix and A2A primers (5’-GAAGCAGATGGAGAGCCAAC-3’ and 5’-GAGAGGATGATGGCCAGGTA-3’) were prepared, and analyzed by MX3000P Real-time PCR systems (Stratagen, USA). ..

Article Title: Hepatocyte turnover during resolution of a transient hepadnaviral infection
Article Snippet: .. Approximately 0.4 ml from each well of the ligation plate was transferred to a third PCR microplate whose wells each contained 10 μl of the PCR mix consisting of Herculase Hotstart DNA Polymerase (25 units/ml, from Stratagene), Herculase buffer supplemented to contain 2.5 mM MgCl2 , 200 μM each dNTP, 100 nM each S1 primer set, and 100 units/ml Hin dIII. .. Finally, ≈0.1 μl from each well was transferred to a fourth PCR microplate whose wells each contained 10 μl of the Herculase PCR mix above, but with 100 nM each of the nested S2 primer set, and omitting the Hin dIII.

Article Title: Whole genome characterization of non-tissue culture adapted HRSV strains in severely infected children
Article Snippet: .. Briefly, 1 µl cDNA was added to PCR mixture containing 39.75 µl of distilled water, 5µl of 10X PCR buffer, 1.25µl of 10 mM dNTPs, 1 µl each of 20 µM forward and reverse primer and 1U of pfu Ultra II fusion HS DNA polymerase (Stratagene, USA). .. Initial denaturation at 95°C for 1 min was followed by 40 cycles of PCR with each cycle of denaturation for 20 sec at 95°C, annealing for 20 sec at 55°C and elongation for 45 sec at 72°C, with a final extension cycle of 5 min at 72°C.

Article Title: Estrogen receptors activate atrial natriuretic peptide in the rat heart
Article Snippet: .. Ten microliters of first-strand cDNA was added to a PCR mixture and amplified for 25–33 cycles by incubation at 95°C for 1 min, 57o C for 1 min, and 72°C for 1.5 min, with a final incubation at 72°C for 3 min, all in a Robocycler gradient 40 thermocycler (Stratagene). .. The methodology of semiquantitative RT-PCR and primer selection for ERα and ERβ transcript amplifications was adapted from Kuiper et al. ( ).

Article Title: Mitogen‐Activated Protein Kinase and Intracellular Polyamine Signaling Is Involved in TRPV1 Activation–Induced Cardiac Hypertrophy
Article Snippet: .. The polymerase chain reaction mixture was incubated in a DNA Thermal Cycler (Stratagene). .. The resulting relative increase in reporter fluorescent dye (SYBR green) emission was monitored with the use of the ABI PRISM7700 sequence detector (Applied Biosystems).

Plasmid Preparation:

Article Title: Site-specific interaction of the murine pre-replicative complex with origin DNA: assembly and disassembly during cell cycle transit and differentiation
Article Snippet: .. Site-directed mutagenesis The PCR mixture contained 20 ng template plasmid DNA (1545 bp rDNA fragment from −3476 to −1931 cloned into pUC18), 15 pmol of each oligonucleotide, 200 µM dNTPs, 2.5 U Pfu DNA polymerase (Stratagene) and buffer in a total volume of 50 µl. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Stratagene brilliant sybr green qrt pcr master mix
    ATM characterization. Upper panel: ATMs of SEKO or control mice were stained with F4/80, CD11b, CD11c, and CD206 and analyzed by flow cytometry; M1 (F4/80 + CD11b + CD11c + CD206 − ) or M2 (F4/80 + CD11b + CD11c − CD206 + ). Macrophage number was normalized to adipose tissue mass. Lower panel: Pro- and anti-inflammatory ATM gene expression was analyzed by <t>qRT-PCR</t> as described in the Methods. Results are the mean ± SD of five mice per group (male, 8 weeks old). * P
    Brilliant Sybr Green Qrt Pcr Master Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 89/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant sybr green qrt pcr master mix/product/Stratagene
    Average 89 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    brilliant sybr green qrt pcr master mix - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    89
    Agilent technologies brilliant ii sybr green qrt pcr master mix
    Immunoprecipitation of actively translated Prm1 mRNA from Rpl22 ha -expressing homozygous mouse testis. ( A ) <t>qRT-PCR</t> Taqman assay using a probe specific for Prm1 mRNA comparing input (total RNA) and HA-immunoprecipitated (polysome-associated RNA) from P25,
    Brilliant Ii Sybr Green Qrt Pcr Master Mix, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 89/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant ii sybr green qrt pcr master mix/product/Agilent technologies
    Average 89 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    brilliant ii sybr green qrt pcr master mix - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    92
    Stratagene pcr mix
    A2A activation affects the action of PTX in attenuating lung injury. Rats were pre-administered with vehicle, PTX (50 mg/Kg), PTX + ZM-241385 (ZM) or PTX + CGS-21680 (CGS), and then underwent IAC. A. The expression of A2A receptor mRNA was examined by <t>qRT-PCR,</t> and the level of mRNA from sham-operated rats was defined as 1. B. The expression of A2A receptor protein was detected by Western blot analysis. The density of each band was normalized to GAPDH. C. MPO activity in lung tissues was measured. D. Protein concentrations in BAL fluids were measured. E. Cell numbers in BAL fluids were counted. F. Numbers of neutrophils, macrophages/monocytes and lymphocytes in BAL fluids were counted. *P
    Pcr Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Stratagene
    Average 92 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    Image Search Results


    ATM characterization. Upper panel: ATMs of SEKO or control mice were stained with F4/80, CD11b, CD11c, and CD206 and analyzed by flow cytometry; M1 (F4/80 + CD11b + CD11c + CD206 − ) or M2 (F4/80 + CD11b + CD11c − CD206 + ). Macrophage number was normalized to adipose tissue mass. Lower panel: Pro- and anti-inflammatory ATM gene expression was analyzed by qRT-PCR as described in the Methods. Results are the mean ± SD of five mice per group (male, 8 weeks old). * P

    Journal: Journal of Lipid Research

    Article Title: Selective suppression of adipose tissue apoE expression impacts systemic metabolic phenotype and adipose tissue inflammation

    doi: 10.1194/jlr.M050567

    Figure Lengend Snippet: ATM characterization. Upper panel: ATMs of SEKO or control mice were stained with F4/80, CD11b, CD11c, and CD206 and analyzed by flow cytometry; M1 (F4/80 + CD11b + CD11c + CD206 − ) or M2 (F4/80 + CD11b + CD11c − CD206 + ). Macrophage number was normalized to adipose tissue mass. Lower panel: Pro- and anti-inflammatory ATM gene expression was analyzed by qRT-PCR as described in the Methods. Results are the mean ± SD of five mice per group (male, 8 weeks old). * P

    Article Snippet: Reactions were carried out in a total volume of 25 μl using Brilliant SYBR Green QRT-PCR Master Mix (Stratagene).

    Techniques: Mouse Assay, Staining, Flow Cytometry, Cytometry, Expressing, Quantitative RT-PCR

    Validation of the 10 differentially expressed genes obtained from microarray analysis by qRT-PCR, n = 3. The p -values of the qRT-PCR data are as follows: 0.0067 (C6ORF52), 0.3920 (CCDC84), 0.3661 (THYMOSIN), 0.8195 (PRVE), 0.3154 (HSPCB), 0.6534 (CYP2J2), 0.002 (AMPD3), 0.1622 (TOR1AIP2), 0.8329 (PTGES3), 0.8808 (ACOX3).

    Journal: PLoS ONE

    Article Title: Genome-Wide Gene Expression Profiles in Lung Tissues of Pig Breeds Differing in Resistance to Porcine Reproductive and Respiratory Syndrome Virus

    doi: 10.1371/journal.pone.0086101

    Figure Lengend Snippet: Validation of the 10 differentially expressed genes obtained from microarray analysis by qRT-PCR, n = 3. The p -values of the qRT-PCR data are as follows: 0.0067 (C6ORF52), 0.3920 (CCDC84), 0.3661 (THYMOSIN), 0.8195 (PRVE), 0.3154 (HSPCB), 0.6534 (CYP2J2), 0.002 (AMPD3), 0.1622 (TOR1AIP2), 0.8329 (PTGES3), 0.8808 (ACOX3).

    Article Snippet: The RNA samples prepared for microarray analysis were also used for real-time qRT-PCR validation. cDNA synthesis was conducted according to the manufacturer’s instruction and the primer sequences for these reactions are shown in . qRT-PCR was carried out with the Brilliant SYBR Green qRT-PCR Master Mix (Stratagene, La Jolla, CA, USA).

    Techniques: Microarray, Quantitative RT-PCR

    Immunoprecipitation of actively translated Prm1 mRNA from Rpl22 ha -expressing homozygous mouse testis. ( A ) qRT-PCR Taqman assay using a probe specific for Prm1 mRNA comparing input (total RNA) and HA-immunoprecipitated (polysome-associated RNA) from P25,

    Journal:

    Article Title: Cell-type-specific isolation of ribosome-associated mRNA from complex tissues

    doi: 10.1073/pnas.0907143106

    Figure Lengend Snippet: Immunoprecipitation of actively translated Prm1 mRNA from Rpl22 ha -expressing homozygous mouse testis. ( A ) qRT-PCR Taqman assay using a probe specific for Prm1 mRNA comparing input (total RNA) and HA-immunoprecipitated (polysome-associated RNA) from P25,

    Article Snippet: Transcript levels were assessed by one-step qRT-PCR assays using Brilliant II SYBR green qRT-PCR master mix (Stratagene) in a MX3000P PCR machine (Stratagene).

    Techniques: Immunoprecipitation, Expressing, Quantitative RT-PCR, TaqMan Assay

    A2A activation affects the action of PTX in attenuating lung injury. Rats were pre-administered with vehicle, PTX (50 mg/Kg), PTX + ZM-241385 (ZM) or PTX + CGS-21680 (CGS), and then underwent IAC. A. The expression of A2A receptor mRNA was examined by qRT-PCR, and the level of mRNA from sham-operated rats was defined as 1. B. The expression of A2A receptor protein was detected by Western blot analysis. The density of each band was normalized to GAPDH. C. MPO activity in lung tissues was measured. D. Protein concentrations in BAL fluids were measured. E. Cell numbers in BAL fluids were counted. F. Numbers of neutrophils, macrophages/monocytes and lymphocytes in BAL fluids were counted. *P

    Journal: American Journal of Translational Research

    Article Title: Pentoxifylline inhibits pulmonary inflammation induced by infrarenal aorticcross-clamping dependent of adenosine receptor A2A

    doi:

    Figure Lengend Snippet: A2A activation affects the action of PTX in attenuating lung injury. Rats were pre-administered with vehicle, PTX (50 mg/Kg), PTX + ZM-241385 (ZM) or PTX + CGS-21680 (CGS), and then underwent IAC. A. The expression of A2A receptor mRNA was examined by qRT-PCR, and the level of mRNA from sham-operated rats was defined as 1. B. The expression of A2A receptor protein was detected by Western blot analysis. The density of each band was normalized to GAPDH. C. MPO activity in lung tissues was measured. D. Protein concentrations in BAL fluids were measured. E. Cell numbers in BAL fluids were counted. F. Numbers of neutrophils, macrophages/monocytes and lymphocytes in BAL fluids were counted. *P

    Article Snippet: The qRT-PCR reaction mixtures containing cDNA, PCR mix and A2A primers (5’-GAAGCAGATGGAGAGCCAAC-3’ and 5’-GAGAGGATGATGGCCAGGTA-3’) were prepared, and analyzed by MX3000P Real-time PCR systems (Stratagen, USA).

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR, Western Blot, Activity Assay