polymerase chain reaction mixture (Stratagene)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Stratagene polymerase chain reaction mixture
Polymerase Chain Reaction Mixture, supplied by Stratagene, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction mixture/product/Stratagene
Average 89 stars, based on 1 article reviews
Price from $9.99 to $1999.99

polymerase chain reaction mixture - by Bioz Stars, 2021-01

89/100 stars

Related Products / Commonly Used Together

dna thermal cycler
mgcl2
m-mlv reverse transcriptase
iq sybr green supermix
dntps
hot master taq dna polymerase
tris-hcl
nmol/l
taq dna polymerase
kcl
dna/rna template
quantitect probe pcr master mix
dna template
template dna
dntp

Images

Clone Assay:

Article Title: Site-specific interaction of the murine pre-replicative complex with origin DNA: assembly and disassembly during cell cycle transit and differentiation
Article Snippet: .. Site-directed mutagenesis The PCR mixture contained 20 ng template plasmid DNA (1545 bp rDNA fragment from −3476 to −1931 cloned into pUC18), 15 pmol of each oligonucleotide, 200 µM dNTPs, 2.5 U Pfu DNA polymerase (Stratagene) and buffer in a total volume of 50 µl. ..

Amplification:

Article Title: Estrogen receptors activate atrial natriuretic peptide in the rat heart
Article Snippet: .. Ten microliters of first-strand cDNA was added to a PCR mixture and amplified for 25–33 cycles by incubation at 95°C for 1 min, 57o C for 1 min, and 72°C for 1.5 min, with a final incubation at 72°C for 3 min, all in a Robocycler gradient 40 thermocycler (Stratagene). .. The methodology of semiquantitative RT-PCR and primer selection for ERα and ERβ transcript amplifications was adapted from Kuiper et al. ( ).

Ligation:

Article Title: Hepatocyte turnover during resolution of a transient hepadnaviral infection
Article Snippet: .. Approximately 0.4 ml from each well of the ligation plate was transferred to a third PCR microplate whose wells each contained 10 μl of the PCR mix consisting of Herculase Hotstart DNA Polymerase (25 units/ml, from Stratagene), Herculase buffer supplemented to contain 2.5 mM MgCl2 , 200 μM each dNTP, 100 nM each S1 primer set, and 100 units/ml Hin dIII. .. Finally, ≈0.1 μl from each well was transferred to a fourth PCR microplate whose wells each contained 10 μl of the Herculase PCR mix above, but with 100 nM each of the nested S2 primer set, and omitting the Hin dIII.

Mutagenesis:

Quantitative RT-PCR:

Article Title: Pentoxifylline inhibits pulmonary inflammation induced by infrarenal aorticcross-clamping dependent of adenosine receptor A2A
Article Snippet: .. The qRT-PCR reaction mixtures containing cDNA, PCR mix and A2A primers (5’-GAAGCAGATGGAGAGCCAAC-3’ and 5’-GAGAGGATGATGGCCAGGTA-3’) were prepared, and analyzed by MX3000P Real-time PCR systems (Stratagen, USA). ..

Real-time Polymerase Chain Reaction:

Incubation:

Article Title: Mitogen‐Activated Protein Kinase and Intracellular Polyamine Signaling Is Involved in TRPV1 Activation–Induced Cardiac Hypertrophy
Article Snippet: .. The polymerase chain reaction mixture was incubated in a DNA Thermal Cycler (Stratagene). .. The resulting relative increase in reporter fluorescent dye (SYBR green) emission was monitored with the use of the ABI PRISM7700 sequence detector (Applied Biosystems).

Polymerase Chain Reaction:

Article Title: A Novel Gene, erm(41), Confers Inducible Macrolide Resistance to Clinical Isolates of Mycobacterium abscessus but Is Absent from Mycobacterium chelonae ▿
Article Snippet: .. The basic 50-μl PCR mixture comprised 2 μl DNA, 1 μl Herculase II fusion DNA polymerase (Stratagene, La Jolla, California), 200 μM deoxynucleoside triphosphate, 1 μM each primer, 5% dimethyl sulfoxide, 1× Herculase II PCR buffer (Stratagene). .. Reactions were run for 2 min at 95°C, followed by 30 to 35 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. For cloning of the resistance element, M. abscessus DNA was amplified with primers MC8-22bam (ACGTTGGATCCGAGCGCCGTCACAAGATGCACA) and MC8-23hind (GCGAGAAGCTTGACTTCCCCGCACCGATTCCAC).

Article Title: The RNA Editing Pattern of cox2 mRNA Is Affected by Point Mutations in Plant Mitochondria
Article Snippet: .. The PCR mixture contained 1 µM of each primer, 200 µM of each dNTP and 2.5 units of Pfu DNA polymerase (Stratagene) in a final volume of 50 µl, according to the supplier's protocol. .. Parameters for amplification were 95°C for 2 min, 20 cycles at 95°C for 30 s, 48°C for 30 s and 68°C for 14 min, and finally 68°C for 10 min. After amplification, 10 units of DpnI endonuclease (Promega) were directly added to the PCR reaction for 3 hours at 37°C to eliminate the original DNA template.

Article Title: Whole genome characterization of non-tissue culture adapted HRSV strains in severely infected children
Article Snippet: .. Briefly, 1 µl cDNA was added to PCR mixture containing 39.75 µl of distilled water, 5µl of 10X PCR buffer, 1.25µl of 10 mM dNTPs, 1 µl each of 20 µM forward and reverse primer and 1U of pfu Ultra II fusion HS DNA polymerase (Stratagene, USA). .. Initial denaturation at 95°C for 1 min was followed by 40 cycles of PCR with each cycle of denaturation for 20 sec at 95°C, annealing for 20 sec at 55°C and elongation for 45 sec at 72°C, with a final extension cycle of 5 min at 72°C.