Review
Similar Products
90
|
Thermo Fisher
cytotune-ips 2.0 sendai reprogramming vectors containing polycistronic hklf4–hoct3/4–hsox2 (hkos), hcmyc, and hklf4 Cytotune Ips 2.0 Sendai Reprogramming Vectors Containing Polycistronic Hklf4–Hoct3/4–Hsox2 (Hkos), Hcmyc, And Hklf4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pm40490530-41-15-16?v=Thermo+Fisher Average 90 stars, based on 1 article reviews
cytotune-ips 2.0 sendai reprogramming vectors containing polycistronic hklf4–hoct3/4–hsox2 (hkos), hcmyc, and hklf4 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Medicago
polycistronic trna grna ptg Polycistronic Trna Grna Ptg, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pmc13126311-226-2-7?v=Medicago Average 86 stars, based on 1 article reviews
polycistronic trna grna ptg - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
94
|
Addgene inc
polycistronic cassette Polycistronic Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/bio_rxiv__2025__10__17__683097-247-45-48?v=Addgene+inc Average 94 stars, based on 1 article reviews
polycistronic cassette - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
93
|
Addgene inc
acccattctagctaaaaaga Acccattctagctaaaaaga, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pm40975050-956-70-95?v=Addgene+inc Average 93 stars, based on 1 article reviews
acccattctagctaaaaaga - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
gfp msfgfp addgene 48287 pam095 pet28b vector encoding iptg Gfp Msfgfp Addgene 48287 Pam095 Pet28b Vector Encoding Iptg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pmc11573504__pnas__2413673121__sapp-49-47-49?v=Addgene+inc Average 93 stars, based on 1 article reviews
gfp msfgfp addgene 48287 pam095 pet28b vector encoding iptg - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
polycistronic pbig1a plasmid Polycistronic Pbig1a Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pmc12094234-326-63-66?v=GenScript+corporation Average 90 stars, based on 1 article reviews
polycistronic pbig1a plasmid - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
ampr addgene plasmid Ampr Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pmc12107188__pnas%2E2422424122%2Esapp-198-61-62?v=Addgene+inc Average 93 stars, based on 1 article reviews
ampr addgene plasmid - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
90
|
VectorBuilder GmbH
custom polycistronic plasmid (ef1a > hrunx3 [nm_001320672.1] : ires : hnr3c1 [nm_001364185.1] : ires : egfp) Custom Polycistronic Plasmid (Ef1a > Hrunx3 [Nm 001320672.1] : Ires : Hnr3c1 [Nm 001364185.1] : Ires : Egfp), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/bio_rxiv__2025__04__30__651472-222-16-22?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
custom polycistronic plasmid (ef1a > hrunx3 [nm_001320672.1] : ires : hnr3c1 [nm_001364185.1] : ires : egfp) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Novartis
recombinant self-replicating polycistronic rna molecules  Recombinant Self Replicating Polycistronic Rna Molecules, supplied by Novartis, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/pmc12027115-4-12-6?v=Novartis Average 90 stars, based on 1 article reviews
recombinant self-replicating polycistronic rna molecules - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
polycistronic aav 8 capsid genes Polycistronic Aav 8 Capsid Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/polycistronic/bio_rxiv__2025__02__19__639178-210-14-25?v=Addgene+inc Average 93 stars, based on 1 article reviews
polycistronic aav 8 capsid genes - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Genes
Article Title: The Bright Future of mRNA as a Therapeutic Molecule
doi: 10.3390/genes16040376
Figure Lengend Snippet: Relevant mRNA vaccines in infectious diseases.
Article Snippet: WO 2013/055905 , April 2013 ,
Techniques: Vaccines, Recombinant, Bioprocessing, Virus, Modification, Sequencing, Mutagenesis, Infection