pmal c2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    New England Biolabs pmal c2
    Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmal c2/product/New England Biolabs
    Average 88 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pmal c2 - by Bioz Stars, 2020-05
    88/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Synaptic ribbons foster active zone stability and illumination-dependent active zone enrichment of RIM2 and Cav1.4 in photoreceptor synapses
    Article Snippet: .. For this purpose, the corresponding cDNA was amplified via PCR with forward primer TTTGGATCCATGTCGGCTCCACTCGG, reverse primer TAAAAG CTTCTATCTCCTTTGTCTTTCATATT and RIM2 cDNA as template and cloned into the Bam HI/Hin dIII sites of pMal C2 (NEB) using standard methods. .. The purified fusion protein was used for subcutaneous immunization of rabbits (Pineda Antikörper-Service, Berlin).

    Article Title: The N-Glycan Cluster from Xanthomonas campestris pv. campestris
    Article Snippet: .. For protein expression, we cloned nixE to nixL without the sequence encoding the N-terminal signal sequence into pMAL-c2 in frame with malE , which encodes the maltose-binding protein (MBP, translational fusion at the N-terminal end of Nix proteins; New England Biolabs, Inc.). ..

    Article Title: Operon Structure and Regulation of the nos Gene Region of Pseudomonas stutzeri, Encoding an ABC-Type ATPase for Maturation of Nitrous Oxide Reductase
    Article Snippet: .. The plasmids used in this study were BRH97 for nnrS promoter analysis ( ); pBTE1, carrying a 1.017-kb fragment with tatE cloned into pBluescript II SK(+) ( ); cDEN1, a pJA1 cosmid clone of a Sau 3A genomic library with the nos genes ( ); pMal-c2, an expression vector based on malE of E. coli under the control of ptac (New England Biolabs) ( ); and pNS200, a pBR325 derivative carrying the maturation genes of the nos gene region ( ). ..

    Article Title: The Sda1 Protein Is Required for Passage through Start
    Article Snippet: .. An identical fragment of Sda1 was cloned into the Bam HI and Eco RI sites of pMAL-c2 to create pZZ6, which expresses the COOH-terminal fragment as an MBP fusion ( New England Biolabs , Beverly, MA). .. Sda1 antibodies were affinity purified from serum by using the purified Sda1-MBP fusion protein coupled to Affi-gel 10 ( Bio-Rad Laboratories , Hercules, CA) as previously described ( ).

    Amplification:

    Article Title: Synaptic ribbons foster active zone stability and illumination-dependent active zone enrichment of RIM2 and Cav1.4 in photoreceptor synapses
    Article Snippet: .. For this purpose, the corresponding cDNA was amplified via PCR with forward primer TTTGGATCCATGTCGGCTCCACTCGG, reverse primer TAAAAG CTTCTATCTCCTTTGTCTTTCATATT and RIM2 cDNA as template and cloned into the Bam HI/Hin dIII sites of pMal C2 (NEB) using standard methods. .. The purified fusion protein was used for subcutaneous immunization of rabbits (Pineda Antikörper-Service, Berlin).

    Binding Assay:

    Article Title: Rho3 of Saccharomyces cerevisiae, Which Regulates the Actin Cytoskeleton and Exocytosis, Is a GTPase Which Interacts with Myo2 and Exo70
    Article Snippet: .. Maltose binding protein (MBP)-RBP4 was constructed by inserting a Bgl II (blunt-ended)-to- Sal I fragment of RBP4 into the Bam HI (blunt-ended) and Sal I sites of pMAL-c2, an MBP vector (New England Biolabs). .. MBP-Exo70 was constructed by inserting a Sma I-to- Pst I full-length fragment of EXO70 into the Bam HI (blunt-ended) and Pst I sites of pMAL-c2.

    Ligation:

    Article Title: X-linked Sideroblastic Anemia Due to Carboxyl-terminal ALAS2 Mutations That Cause Loss of Binding to the ?-Subunit of Succinyl-CoA Synthetase (SUCLA2) *
    Article Snippet: .. The pMAL-c2 and c4X prokaryotic expression vectors, maltose-binding protein (MBP), factor Xa, amylose resin, 100-bp DNA ladder, T4-DNA-ligase, the Quick Ligation Kit, and restriction enzymes were purchased from New England Biolabs. .. Plasmid mini and midi prep kits, the DNA gel extraction kit, and HotStarTaq® master mix were from Qiagen.

    Construct:

    Article Title: Rho3 of Saccharomyces cerevisiae, Which Regulates the Actin Cytoskeleton and Exocytosis, Is a GTPase Which Interacts with Myo2 and Exo70
    Article Snippet: .. Maltose binding protein (MBP)-RBP4 was constructed by inserting a Bgl II (blunt-ended)-to- Sal I fragment of RBP4 into the Bam HI (blunt-ended) and Sal I sites of pMAL-c2, an MBP vector (New England Biolabs). .. MBP-Exo70 was constructed by inserting a Sma I-to- Pst I full-length fragment of EXO70 into the Bam HI (blunt-ended) and Pst I sites of pMAL-c2.

    Purification:

    Article Title: Characterization of a PDK1 Homologue from the Moss Physcomitrella patens 1 1 [C] 1 [C] [W] 1 [C] [W] [OA]
    Article Snippet: .. PpPDK1-6His, Pp2411, AtPDK1-6His, SlPDK1-6His, Pp2411, and Adi3 were expressed as MBP fusion proteins using pMAL-c2 in Escherichia coli BL21(DE3) and purified with amylose resin (New England Biolabs) according to the manufacturer’s instructions. .. In vitro kinase assays were performed by combining the purified proteins in a 30-μL final volume of kinase buffer containing 10 m m Tris, pH 7.5, 10 m m MgCl2 or 10 m m MnCl2 , and 1 m m dithiothreitol.

    Polymerase Chain Reaction:

    Article Title: Synaptic ribbons foster active zone stability and illumination-dependent active zone enrichment of RIM2 and Cav1.4 in photoreceptor synapses
    Article Snippet: .. For this purpose, the corresponding cDNA was amplified via PCR with forward primer TTTGGATCCATGTCGGCTCCACTCGG, reverse primer TAAAAG CTTCTATCTCCTTTGTCTTTCATATT and RIM2 cDNA as template and cloned into the Bam HI/Hin dIII sites of pMal C2 (NEB) using standard methods. .. The purified fusion protein was used for subcutaneous immunization of rabbits (Pineda Antikörper-Service, Berlin).

    Expressing:

    Article Title: X-linked Sideroblastic Anemia Due to Carboxyl-terminal ALAS2 Mutations That Cause Loss of Binding to the ?-Subunit of Succinyl-CoA Synthetase (SUCLA2) *
    Article Snippet: .. The pMAL-c2 and c4X prokaryotic expression vectors, maltose-binding protein (MBP), factor Xa, amylose resin, 100-bp DNA ladder, T4-DNA-ligase, the Quick Ligation Kit, and restriction enzymes were purchased from New England Biolabs. .. Plasmid mini and midi prep kits, the DNA gel extraction kit, and HotStarTaq® master mix were from Qiagen.

    Article Title: The N-Glycan Cluster from Xanthomonas campestris pv. campestris
    Article Snippet: .. For protein expression, we cloned nixE to nixL without the sequence encoding the N-terminal signal sequence into pMAL-c2 in frame with malE , which encodes the maltose-binding protein (MBP, translational fusion at the N-terminal end of Nix proteins; New England Biolabs, Inc.). ..

    Article Title: Operon Structure and Regulation of the nos Gene Region of Pseudomonas stutzeri, Encoding an ABC-Type ATPase for Maturation of Nitrous Oxide Reductase
    Article Snippet: .. The plasmids used in this study were BRH97 for nnrS promoter analysis ( ); pBTE1, carrying a 1.017-kb fragment with tatE cloned into pBluescript II SK(+) ( ); cDEN1, a pJA1 cosmid clone of a Sau 3A genomic library with the nos genes ( ); pMal-c2, an expression vector based on malE of E. coli under the control of ptac (New England Biolabs) ( ); and pNS200, a pBR325 derivative carrying the maturation genes of the nos gene region ( ). ..

    Sequencing:

    Article Title: The N-Glycan Cluster from Xanthomonas campestris pv. campestris
    Article Snippet: .. For protein expression, we cloned nixE to nixL without the sequence encoding the N-terminal signal sequence into pMAL-c2 in frame with malE , which encodes the maltose-binding protein (MBP, translational fusion at the N-terminal end of Nix proteins; New England Biolabs, Inc.). ..

    Affinity Purification:

    Article Title: CAND1 regulates lunapark for the proper tubular network of the endoplasmic reticulum
    Article Snippet: .. Recombinant proteins MBP-CAND1 and MBP alone were expressed in Escherichia coli (E . coli ) Rosetta-Gami harbouring pMAL-C2-CAND1 and pMAL-C2, respectively, and extracted with buffer A [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1 mM ZnSO4 , 1 mM DTT] supplemented with 10 μM APMSF, 10 μg/ml leupeptin, and 5 μg/ml aprotinin, followed by affinity purification with amylose resin (New England BioLabs). ..

    Recombinant:

    Article Title: CAND1 regulates lunapark for the proper tubular network of the endoplasmic reticulum
    Article Snippet: .. Recombinant proteins MBP-CAND1 and MBP alone were expressed in Escherichia coli (E . coli ) Rosetta-Gami harbouring pMAL-C2-CAND1 and pMAL-C2, respectively, and extracted with buffer A [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1 mM ZnSO4 , 1 mM DTT] supplemented with 10 μM APMSF, 10 μg/ml leupeptin, and 5 μg/ml aprotinin, followed by affinity purification with amylose resin (New England BioLabs). ..

    Plasmid Preparation:

    Article Title: Rho3 of Saccharomyces cerevisiae, Which Regulates the Actin Cytoskeleton and Exocytosis, Is a GTPase Which Interacts with Myo2 and Exo70
    Article Snippet: .. Maltose binding protein (MBP)-RBP4 was constructed by inserting a Bgl II (blunt-ended)-to- Sal I fragment of RBP4 into the Bam HI (blunt-ended) and Sal I sites of pMAL-c2, an MBP vector (New England Biolabs). .. MBP-Exo70 was constructed by inserting a Sma I-to- Pst I full-length fragment of EXO70 into the Bam HI (blunt-ended) and Pst I sites of pMAL-c2.

    Article Title: Operon Structure and Regulation of the nos Gene Region of Pseudomonas stutzeri, Encoding an ABC-Type ATPase for Maturation of Nitrous Oxide Reductase
    Article Snippet: .. The plasmids used in this study were BRH97 for nnrS promoter analysis ( ); pBTE1, carrying a 1.017-kb fragment with tatE cloned into pBluescript II SK(+) ( ); cDEN1, a pJA1 cosmid clone of a Sau 3A genomic library with the nos genes ( ); pMal-c2, an expression vector based on malE of E. coli under the control of ptac (New England Biolabs) ( ); and pNS200, a pBR325 derivative carrying the maturation genes of the nos gene region ( ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    New England Biolabs expression vector pmal c2
    Protein Gel Blot Analysis of the MBP-AtIpk2β Fusion Protein. E. coli cells were transformed with either the empty vector <t>pMAL-c2</t> (lane C) or plasmid pMAL-c2–AtIpk2β (lanes 1 and 2). Protein extracts were obtained from noninduced (−) or IPTG-induced (+) cells. Proteins (45 μg per lane) were detected using an antiserum that recognizes the MBP portion of the proteins. The positions of MBP (42 kD) and the MBP-AtIpk2β fusion protein (75 kD) are indicated by arrows.
    Expression Vector Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pmal c2/product/New England Biolabs
    Average 88 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    expression vector pmal c2 - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    92
    New England Biolabs plasmid dna
    Proposed mechanism for the regulation of Wss1 protease activity by cysteine switch mechanism. ( I ) Mechanism of Wss1 activation by thiol-reactive electrophiles. (a) Modification of the regulatory cysteine by thiram (Th) or APMA displaces the cysteine from the active site Zn, activates the metalloprotease and induces in-cis Wss1 cleavage. (b) Activated Wss1 may also proteolyze other Wss1 molecules acting in-trans as endopeptidase or caboxypeptidase. (c) In-trans proteolysis results in gradual degradation of Wss1 pool, the most persistent fragment being a compact WLM domain. ( II ) Activation of Wss1 proteolysis by <t>ssDNA.</t> The <t>DNA</t> may act in two ways. (a) First, interaction of a positively charged WLM domain with DNA may induce conformational changes facilitating displacement of the negatively charged C-terminal peptide with an inhibitory cysteine from the active site. This may promote the initial event of Wss1 activation. The process is not efficient and can be reversed by thiols such as DTT and glutathione ( Figure 3D ). (b) Then, DNA may facilitate Wss1 intermolecular interaction and greatly promote in-trans proteolysis. (c) This results in rapid propagation of proteolytic activity and degradation of the Wss1 pool. ( III ) Cooperative mechanism. The DNA may induce Wss1 oligomerization (a), whereby initial in-cis cleavage (b) is followed by in-trans proteolysis of the whole oligomer (c). DOI: http://dx.doi.org/10.7554/eLife.06763.010
    Plasmid Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 528 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna/product/New England Biolabs
    Average 92 stars, based on 528 article reviews
    Price from $9.99 to $1999.99
    plasmid dna - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    88
    New England Biolabs plasmid pmal c2
    (A) Diagrammatic representation of the successive clones obtained during the cloning of the chimeric gene. The <t>pMAL-c2</t> polylinker restriction enzyme cut sites employed in the cloning strategy are indicated. The asterisks at the Xmn I sites indicate that these restriction sites were lost after cloning. nt, nucleotides. (B) Deduced amino acid sequence of the chimeric protein. Regions encoded by the linker sequences are underlined. The position of the maltose-binding fusion protein (MBP) is also indicated.
    Plasmid Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pmal c2/product/New England Biolabs
    Average 88 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    plasmid pmal c2 - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    Image Search Results


    Protein Gel Blot Analysis of the MBP-AtIpk2β Fusion Protein. E. coli cells were transformed with either the empty vector pMAL-c2 (lane C) or plasmid pMAL-c2–AtIpk2β (lanes 1 and 2). Protein extracts were obtained from noninduced (−) or IPTG-induced (+) cells. Proteins (45 μg per lane) were detected using an antiserum that recognizes the MBP portion of the proteins. The positions of MBP (42 kD) and the MBP-AtIpk2β fusion protein (75 kD) are indicated by arrows.

    Journal: The Plant Cell

    Article Title: Arabidopsis Inositol Polyphosphate 6-/3-Kinase Is a Nuclear Protein That Complements a Yeast Mutant Lacking a Functional ArgR-Mcm1 Transcription Complex

    doi: 10.1105/tpc.006676

    Figure Lengend Snippet: Protein Gel Blot Analysis of the MBP-AtIpk2β Fusion Protein. E. coli cells were transformed with either the empty vector pMAL-c2 (lane C) or plasmid pMAL-c2–AtIpk2β (lanes 1 and 2). Protein extracts were obtained from noninduced (−) or IPTG-induced (+) cells. Proteins (45 μg per lane) were detected using an antiserum that recognizes the MBP portion of the proteins. The positions of MBP (42 kD) and the MBP-AtIpk2β fusion protein (75 kD) are indicated by arrows.

    Article Snippet: The AtIpk2 β coding sequence was excised from plasmid pCR-K-2 using EcoRI-XhoI restriction enzymes and subcloned into the expression vector pMAL-c2 (New England Biolabs, Schwalbach, Germany), which had been cut previously with EcoRI and SalI.

    Techniques: Western Blot, Transformation Assay, Plasmid Preparation

    Protein splicing of R. marinus DnaB. The R. marinus dnaB gene (complete or partial) was inserted into the expression plasmid vector pMAL-c2 to produce corresponding recombinant fusion proteins and to observe protein splicing. ( A ) Illustration of recombinant fusion proteins. Each fusion protein consists of the maltose-binding protein (MBP), the DnaB intein (solid box), and the DnaB exteins (hatched boxes) of different lengths, and some vector-encoded sequences (open boxs). Calculated molecular masses for the predicted protein products are listed. ( B ) Production and splicing of recombinant DnaB proteins. E. coli cells containing individual recombinant plasmids described above were induced by IPTG to produce the corresponding protein products. Total cellular proteins from induced cells were resolved by electrophoresis on SDS/polyacrylamide gels and visualized by Coomassie blue staining. Lane 1, cells transformed with pMAL and producing a 51-kDa protein, as a control. Lane 2, cells transformed with pMR1, but before IPTG induction. Lanes 3, 4, and 5, cells transformed with pMR1, pMR2, and pMR3, respectively, after IPTG induction. Lanes 6 and 7, same as lanes 3 and 4, respectively, but electrophoresed for a longer period of time. Letters S1, S2, and S3 mark positions of putative spliced proteins produced from pMR1, pMR2, and pMR3, respectively. Letter I marks position of putative excised intein. Letter P marks protein bands that may include precursor proteins and protein splicing intermediates.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A DnaB intein in Rhodothermus marinus: Indication of recent intein homing across remotely related organisms

    doi:

    Figure Lengend Snippet: Protein splicing of R. marinus DnaB. The R. marinus dnaB gene (complete or partial) was inserted into the expression plasmid vector pMAL-c2 to produce corresponding recombinant fusion proteins and to observe protein splicing. ( A ) Illustration of recombinant fusion proteins. Each fusion protein consists of the maltose-binding protein (MBP), the DnaB intein (solid box), and the DnaB exteins (hatched boxes) of different lengths, and some vector-encoded sequences (open boxs). Calculated molecular masses for the predicted protein products are listed. ( B ) Production and splicing of recombinant DnaB proteins. E. coli cells containing individual recombinant plasmids described above were induced by IPTG to produce the corresponding protein products. Total cellular proteins from induced cells were resolved by electrophoresis on SDS/polyacrylamide gels and visualized by Coomassie blue staining. Lane 1, cells transformed with pMAL and producing a 51-kDa protein, as a control. Lane 2, cells transformed with pMR1, but before IPTG induction. Lanes 3, 4, and 5, cells transformed with pMR1, pMR2, and pMR3, respectively, after IPTG induction. Lanes 6 and 7, same as lanes 3 and 4, respectively, but electrophoresed for a longer period of time. Letters S1, S2, and S3 mark positions of putative spliced proteins produced from pMR1, pMR2, and pMR3, respectively. Letter I marks position of putative excised intein. Letter P marks protein bands that may include precursor proteins and protein splicing intermediates.

    Article Snippet: Recombinant plasmid pMR1 was constructed by cloning the 2.9-kbp Nco I– Bsi W I DNA fragment (blunt ended) into the expression plasmid vector pMAL-c2 (New England Biolabs) at its Sal I site (blunt ended).

    Techniques: Expressing, Plasmid Preparation, Recombinant, Binding Assay, Electrophoresis, Staining, Transformation Assay, Produced

    Proposed mechanism for the regulation of Wss1 protease activity by cysteine switch mechanism. ( I ) Mechanism of Wss1 activation by thiol-reactive electrophiles. (a) Modification of the regulatory cysteine by thiram (Th) or APMA displaces the cysteine from the active site Zn, activates the metalloprotease and induces in-cis Wss1 cleavage. (b) Activated Wss1 may also proteolyze other Wss1 molecules acting in-trans as endopeptidase or caboxypeptidase. (c) In-trans proteolysis results in gradual degradation of Wss1 pool, the most persistent fragment being a compact WLM domain. ( II ) Activation of Wss1 proteolysis by ssDNA. The DNA may act in two ways. (a) First, interaction of a positively charged WLM domain with DNA may induce conformational changes facilitating displacement of the negatively charged C-terminal peptide with an inhibitory cysteine from the active site. This may promote the initial event of Wss1 activation. The process is not efficient and can be reversed by thiols such as DTT and glutathione ( Figure 3D ). (b) Then, DNA may facilitate Wss1 intermolecular interaction and greatly promote in-trans proteolysis. (c) This results in rapid propagation of proteolytic activity and degradation of the Wss1 pool. ( III ) Cooperative mechanism. The DNA may induce Wss1 oligomerization (a), whereby initial in-cis cleavage (b) is followed by in-trans proteolysis of the whole oligomer (c). DOI: http://dx.doi.org/10.7554/eLife.06763.010

    Journal: eLife

    Article Title: Wss1 metalloprotease partners with Cdc48/Doa1 in processing genotoxic SUMO conjugates

    doi: 10.7554/eLife.06763

    Figure Lengend Snippet: Proposed mechanism for the regulation of Wss1 protease activity by cysteine switch mechanism. ( I ) Mechanism of Wss1 activation by thiol-reactive electrophiles. (a) Modification of the regulatory cysteine by thiram (Th) or APMA displaces the cysteine from the active site Zn, activates the metalloprotease and induces in-cis Wss1 cleavage. (b) Activated Wss1 may also proteolyze other Wss1 molecules acting in-trans as endopeptidase or caboxypeptidase. (c) In-trans proteolysis results in gradual degradation of Wss1 pool, the most persistent fragment being a compact WLM domain. ( II ) Activation of Wss1 proteolysis by ssDNA. The DNA may act in two ways. (a) First, interaction of a positively charged WLM domain with DNA may induce conformational changes facilitating displacement of the negatively charged C-terminal peptide with an inhibitory cysteine from the active site. This may promote the initial event of Wss1 activation. The process is not efficient and can be reversed by thiols such as DTT and glutathione ( Figure 3D ). (b) Then, DNA may facilitate Wss1 intermolecular interaction and greatly promote in-trans proteolysis. (c) This results in rapid propagation of proteolytic activity and degradation of the Wss1 pool. ( III ) Cooperative mechanism. The DNA may induce Wss1 oligomerization (a), whereby initial in-cis cleavage (b) is followed by in-trans proteolysis of the whole oligomer (c). DOI: http://dx.doi.org/10.7554/eLife.06763.010

    Article Snippet: When examining the effect of various additives on Wss1 refolding and activity, all molecules, except SDS (0.1% final concentration) were added directly into protein solution before dialysis: heparin (200 μg/ml sodium salt, Sigma–Aldrich), plasmid DNA (100 μg/ml pMAL-c2), and ssDNA (100 μg/ml M13mp18 single-stranded DNA, New England Biolabs).

    Techniques: Activity Assay, Activation Assay, Modification, Activated Clotting Time Assay

    SUMO-dependent extraction of proteins from the chromatin. ( A ) ssDNA-activated SUMO E3 ligase sumoylates DNA-bound protein and induces its dissociation. ( B ) Delay in dissociation results in SUMO chain formation through multiple rounds of protein sumoylation. Subsequent ubiqutylation b y STUbL promotes Cdc48/Npl4/Ufd1 loading, protein extraction and degradation via proteasome. ( C ) When the extraction is compromised (e.g., covalent protein–DNA adduct), the protein is processed by Cdc48/Wss1/Doa1 complex. Wss1 is targeted to sumoylated protein via its SIMs and promotes extension of SUMO chain that in return could further stimulate Wss1 accumulation and oligomerization at the site of DNA damage (Wss1 foci). Binding to ssDNA and oligomerization triggers metalloprotease activity of Wss1 and initiates substrate processing. The process is assisted by Cdc48 and Doa1 and finally ends in the vacuole. DOI: http://dx.doi.org/10.7554/eLife.06763.033

    Journal: eLife

    Article Title: Wss1 metalloprotease partners with Cdc48/Doa1 in processing genotoxic SUMO conjugates

    doi: 10.7554/eLife.06763

    Figure Lengend Snippet: SUMO-dependent extraction of proteins from the chromatin. ( A ) ssDNA-activated SUMO E3 ligase sumoylates DNA-bound protein and induces its dissociation. ( B ) Delay in dissociation results in SUMO chain formation through multiple rounds of protein sumoylation. Subsequent ubiqutylation b y STUbL promotes Cdc48/Npl4/Ufd1 loading, protein extraction and degradation via proteasome. ( C ) When the extraction is compromised (e.g., covalent protein–DNA adduct), the protein is processed by Cdc48/Wss1/Doa1 complex. Wss1 is targeted to sumoylated protein via its SIMs and promotes extension of SUMO chain that in return could further stimulate Wss1 accumulation and oligomerization at the site of DNA damage (Wss1 foci). Binding to ssDNA and oligomerization triggers metalloprotease activity of Wss1 and initiates substrate processing. The process is assisted by Cdc48 and Doa1 and finally ends in the vacuole. DOI: http://dx.doi.org/10.7554/eLife.06763.033

    Article Snippet: When examining the effect of various additives on Wss1 refolding and activity, all molecules, except SDS (0.1% final concentration) were added directly into protein solution before dialysis: heparin (200 μg/ml sodium salt, Sigma–Aldrich), plasmid DNA (100 μg/ml pMAL-c2), and ssDNA (100 μg/ml M13mp18 single-stranded DNA, New England Biolabs).

    Techniques: Protein Extraction, Binding Assay, Activity Assay

    (A) Diagrammatic representation of the successive clones obtained during the cloning of the chimeric gene. The pMAL-c2 polylinker restriction enzyme cut sites employed in the cloning strategy are indicated. The asterisks at the Xmn I sites indicate that these restriction sites were lost after cloning. nt, nucleotides. (B) Deduced amino acid sequence of the chimeric protein. Regions encoded by the linker sequences are underlined. The position of the maltose-binding fusion protein (MBP) is also indicated.

    Journal: Journal of Clinical Microbiology

    Article Title: Multicomponent Chimeric Antigen for Serodiagnosis of Canine Visceral Leishmaniasis

    doi:

    Figure Lengend Snippet: (A) Diagrammatic representation of the successive clones obtained during the cloning of the chimeric gene. The pMAL-c2 polylinker restriction enzyme cut sites employed in the cloning strategy are indicated. The asterisks at the Xmn I sites indicate that these restriction sites were lost after cloning. nt, nucleotides. (B) Deduced amino acid sequence of the chimeric protein. Regions encoded by the linker sequences are underlined. The position of the maltose-binding fusion protein (MBP) is also indicated.

    Article Snippet: This amplified DNA was directly cloned into the Xmn I restriction site of the plasmid pMAL-c2* and sequenced with the no. 1237 malE primer (New England Biolabs).

    Techniques: Clone Assay, Sequencing, Binding Assay