pmal c2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pmal c2
    Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control <t>pMAL-c2</t> (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.
    Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmal c2/product/New England Biolabs
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pmal c2 - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases"

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases

    Journal:

    doi: 10.1128/JVI.02040-14

    Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control pMAL-c2 (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.
    Figure Legend Snippet: Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control pMAL-c2 (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.

    Techniques Used: Construct, Sequencing, Expressing, Western Blot, Mutagenesis, Derivative Assay, Marker, Purification, Produced, Chromatography

    2) Product Images from "Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion"

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion

    Journal:

    doi: 10.1107/S1744309108021118

    SDS–PAGE gel showing total cell extract (lane A ), soluble fraction (lane B ) and insoluble fraction (lane C ) from IPTG-based induction of the RNase HI-MBP fusion protein in pMAL-C2.
    Figure Legend Snippet: SDS–PAGE gel showing total cell extract (lane A ), soluble fraction (lane B ) and insoluble fraction (lane C ) from IPTG-based induction of the RNase HI-MBP fusion protein in pMAL-C2.

    Techniques Used: SDS Page

    Related Articles

    Clone Assay:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: It was cloned using the Gateway system (Invitrogen) into the His6 -tagged vector pDEST17 with gene-specific primers for the sense strand of bases 1–15 and antisense strand of bases 385–390. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning. .. The sense primer 5-GTGAA­AGTTGTCATCGAA and antisense primer 5-AATCGGCTGGC­GGCGGATTAGAAGCTTCGGG corresponding to bases 1–18 and 404–420 of the gene sequence at the Xmn I and Hin dIII sites, respectively, were used for insertion into the vector.

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively. .. The phat-5 promoter sequence in pGD48 provided from J. Gaudet (personal communication) was cloned in pPD122.56 to generate the Pphat-5 ∷gfp transgene.

    Article Title: ATPase-Dependent Quality Control of DNA Replication Origin Licensing
    Article Snippet: Furthermore, a C- terminal 3xFLAG tag was added to the endogenous copy of ORC6 , using pBP83. .. MCM3 mutants were cloned into two different vectors: (a) pMAL-C2P to purify recombinant proteins and (b) pRS306 for complementation studies in yeast. (a) pMAL-C2P was a gift from Satoru Mochida and was derived from pMAL-C2 (NEB) by introducing a PreScission protease site before the EcoRI site in the polylinker region . .. MCM3 was amplified from S.cerevisiae genomic DNA using AM51 and AM52 and cloned into pMAL-C2P using XbaI and SalI sites (pAM5).

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The primer set for hTERT was as follows: 5′-AAGGATTTCAGAATTCGAAGCCACCTCTTTGGA-3′ (forward) and 5′-TGCCGTCTCCGAATTCCGCCACAGAGCCCTGGG-3′ (reverse). .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. Competent Escherichia coli (E . coli ) TOP-10 cells (Thermo Fisher Scientific) were transformed with the plasmid, pMAL-c2MAPhPAter/TERTepi.

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: The resulting product was purified, subcloned into pGEMT-vector, and sequenced as described above. .. Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA). .. Maltose binding protein (MBP)-C. sinensis PK fusion protein was expressed in E. coli TB1 cells by induction with 1 mM IPTG at 25°C for 24 h. The cells were resuspended and sonicated in 5× TE buffer.

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: The ZmCCA1a or ZmCCA1b cDNA fragment was cloned into a pGEM-T (Promega, Madison, Wisconsin). .. After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively.

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids pMAL-C2-Hof1-N-term (1–340), -Hof1-F-BAR (1–275), and -Hof1-CC2 (276–340) expressing MBP-fusions were described previously [ ]. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. The PCR condition for a 100 μl reaction is: 2 μl PfuUltra-II fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA), 200 ng genomic DNA from wild-type yeast strain YEF473A (see ), 0.2 μM for each of the forward and reverse primers (see ), PfuUltra-II Hotstart PCR Master Mix (0.25 mM for each dNTP, 2 mM MgCl2 ) (Agilent Technologies) and distilled water (to fill to 100 μl), 30 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 15 sec per kb fragment.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: The structure shows that functionally the Asp insertion comes after Asp346, as the first Asp of the pair retains its interaction with Ser363, while the second Asp points directly toward the β-lactam-binding site where it interferes with binding of the antibiotic or the chemistry of acylation. .. Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. This construct fuses PBP2 to maltose-binding protein (MBP) containing a hexahistidine tag at its N-terminus and an intervening tobacco etch virus (TEV) protease site between the two proteins.

    Article Title: Antagonistic roles of Drosophila Tctp and Brahma in chromatin remodelling and stabilizing repeated sequences
    Article Snippet: After selecting yeast colonies on uracil-deficient media, these URA+ colonies were re-selected on adenosine-deficient media (SD-LWA). .. MBP-tagged Tctp and GST-tagged Brm fragments (GST::Brm 1-311, 304-747, 748-1638, Δ304-500, Δ574-648, Δ694-747, ΔHSA, ΔBRK, and ΔHSA, ΔBRK) were cloned into pMAL-c2 (NEB) and pGEX5X-1 (GE healthcare), respectively. .. In-Fusion system (Clontech) was used for cloning.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: A similar strategy was used to clone MBP into pEGFP‐C2 vector to generate GFP‐MBP control. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs). .. To generate GST‐SIM1, Nup358‐SIM1 oligos were annealed and cloned into EcoRI/XhoI sites of pGEX‐6P1 vector (GE healthcare).

    Centrifugation:

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively. .. E . coli strain Rosetta-gami B competent cells (Novagen, Madison, WI) was used to transform empty pMAL (expressing maltose-binding protein, MBP), pMAL-ZmCCA1a or pMAL-ZmCCA1b, which were grown in 4 ml of Luria-Bertani (LB) media with Carbenicillin (100 mg/L) at 37°C for 18 h. The overnight cultures of Rosetta-gami B cells containing pMAL, pMAL-ZmCCA1a or pMAL-ZmCCA1b construct were diluted into 1:100 in 80 ml LB media with Carbinicillin (100 mg/L) and grown at 37°C to an OD600 value of 0.5, when isopropyl-β-D-thiogalactoside (IPTG) (0.1 mM) was added.

    Amplification:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: To generate pMAL-c2-[pp1a-1343-1720-His6 ], the coding sequence of the putative 3CLpro domain with flanking sequences (CavV pp1a/1ab amino acid residues Ala-1343 to Asp-1720) was amplified by PCR from cDNA using oligonucleotides LT-1 and LT-2. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. Subsequently, the reaction mixture was digested with DpnI (Life Technologies) to remove any remaining (methylated) pMAL-c2 template DNA.

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: It was cloned using the Gateway system (Invitrogen) into the His6 -tagged vector pDEST17 with gene-specific primers for the sense strand of bases 1–15 and antisense strand of bases 385–390. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning. .. The sense primer 5-GTGAA­AGTTGTCATCGAA and antisense primer 5-AATCGGCTGGC­GGCGGATTAGAAGCTTCGGG corresponding to bases 1–18 and 404–420 of the gene sequence at the Xmn I and Hin dIII sites, respectively, were used for insertion into the vector.

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: Full-length or truncated derivatives of the OsHRZ1 (AK288394 ), OsHRZ2 (AK068028 ) and BTS (At3g18290 ) coding regions were amplified by PCR using a complementary DNA pool of the rice cultivar Tsukinohikari or A. thaliana ecotype Columbia (Col-0) and ligated into pENTR/D-TOPO (Invitrogen, Carlsbad, CA); the sequence was verified. .. The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP .

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: The amplified products were purified using QIA quick PCR purification columns (QIAGEN GmbH, Hilden, Germany). .. Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: The full-length ZmCCA1b (ZM2G014902 ) CDS was amplified from B73 cDNA by the primer pair 5’- GGATCC ATGGAGGTGAATTCCTCTGGC-3’ (Bam HІ) and 5’- GTCGAC TTATGTGGATGCTTCGCTATC-3’ (Sal І). .. After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export
    Article Snippet: The pMal-PP expression vector was produced by exchanging the Factor Xa site from pMal-C2 (New England BioLabs) to a recognition site for the PreScission protease by PCR using the oligonucleotides 5′-aaaCCATGGaaaacgcccagaaaggtgaaa-3′ and 5′-tttgaattcGGGCCCCTGGAACAGAACTTCCAGcccgaggttgttgttattgtt-3′. .. A SET exon7-Nup214 exon18 fusion as described previously ( ) was generated by overlap extension PCR.

    Article Title: Zebrafish Tsc1 reveals functional interactions between the cilium and the TOR pathway
    Article Snippet: Morpholinos targeted to translational start sites include the following: standard control morpholino: 5′-CCTCTTACCTCAGTTACAATTTATA-3′; Tsc1a: 5′-CCATAGTTGTGCAGGACAGTGGGCA-3′; 5′-AGAGATCAGTCCTCACCTTCACCAC-3′; Tsc1a mismatch control: 5′-CCATACTTCTGCAGCACACTGGCCAA-3′; Ift81: 5′-CGATAAATTTAAGCTGTTCGCTCAT-3′ and Ift172: 5′-GACTCAGGGCAGTTATAAGAACGTA-3′. .. Base pairs 1879–2373 (amplified using primers 5′-CAGAATTCCCGAAGGTGGCATCTCTGTTTTT-3′ and 5′-GCTCTAGATTAATGGTGATGGTGATGGTGCTCTCTGTCTTCCTGTATGTGC-3′) or 3079–3496 (using primers 5′-CAGAATTCTCTCTACCGGCTGACCTGA-3′ and 5′-GCTCTAGATTAATGGTGATGGTGATGGTGGTCCTGATGCCTCCTACTCTG-3′) from the Tsc1a-coding region were subcloned into the Eco RI and Xba I sites of pMAL C2 (New England Biolabs, Inc.) to generate MBP fusion proteins with 3′ 6x His tags. .. Over-produced proteins were purified on amylose columns and used as antigens to generate polyclonal antisera TSC1-1 and TSC1-2, respectively.

    Construct:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: GORAB scaffolds COPI at the trans-Golgi for efficient enzyme recycling and correct protein glycosylation
    Article Snippet: Using standard molecular biology techniques full-length and truncated GORAB and Scyl1 sequences were subcloned into pEGFP-C3 (Clontech Laboratories), pGADT7 and pGBKT7 (BD Biosciences), pFAT2 (a modified pGAT2 vector) and pMAL-C2 (New England Biolabs) for mammalian expression, yeast two-hybrid analysis, and bacterial expression, respectively. .. Missense patient mutations were introduced by site-directed mutagenesis performed using PfuTurbo DNA polymerase adapted from the Quikchange site-directed mutagenesis method (Agilent Technologies).

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids pMAL-C2-Hof1-N-term (1–340), -Hof1-F-BAR (1–275), and -Hof1-CC2 (276–340) expressing MBP-fusions were described previously [ ]. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. The PCR condition for a 100 μl reaction is: 2 μl PfuUltra-II fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA), 200 ng genomic DNA from wild-type yeast strain YEF473A (see ), 0.2 μM for each of the forward and reverse primers (see ), PfuUltra-II Hotstart PCR Master Mix (0.25 mM for each dNTP, 2 mM MgCl2 ) (Agilent Technologies) and distilled water (to fill to 100 μl), 30 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 15 sec per kb fragment.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: The structure shows that functionally the Asp insertion comes after Asp346, as the first Asp of the pair retains its interaction with Ser363, while the second Asp points directly toward the β-lactam-binding site where it interferes with binding of the antibiotic or the chemistry of acylation. .. Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. This construct fuses PBP2 to maltose-binding protein (MBP) containing a hexahistidine tag at its N-terminus and an intervening tobacco etch virus (TEV) protease site between the two proteins.

    Article Title: Zebrafish Tsc1 reveals functional interactions between the cilium and the TOR pathway
    Article Snippet: Paragraph title: Constructs, morpholinos and mRNAs ... Base pairs 1879–2373 (amplified using primers 5′-CAGAATTCCCGAAGGTGGCATCTCTGTTTTT-3′ and 5′-GCTCTAGATTAATGGTGATGGTGATGGTGCTCTCTGTCTTCCTGTATGTGC-3′) or 3079–3496 (using primers 5′-CAGAATTCTCTCTACCGGCTGACCTGA-3′ and 5′-GCTCTAGATTAATGGTGATGGTGATGGTGGTCCTGATGCCTCCTACTCTG-3′) from the Tsc1a-coding region were subcloned into the Eco RI and Xba I sites of pMAL C2 (New England Biolabs, Inc.) to generate MBP fusion proteins with 3′ 6x His tags.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: Paragraph title: Plasmid constructs ... For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Incubation:

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively. .. E . coli strain Rosetta-gami B competent cells (Novagen, Madison, WI) was used to transform empty pMAL (expressing maltose-binding protein, MBP), pMAL-ZmCCA1a or pMAL-ZmCCA1b, which were grown in 4 ml of Luria-Bertani (LB) media with Carbenicillin (100 mg/L) at 37°C for 18 h. The overnight cultures of Rosetta-gami B cells containing pMAL, pMAL-ZmCCA1a or pMAL-ZmCCA1b construct were diluted into 1:100 in 80 ml LB media with Carbinicillin (100 mg/L) and grown at 37°C to an OD600 value of 0.5, when isopropyl-β-D-thiogalactoside (IPTG) (0.1 mM) was added.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. The final purified constructs encoded proteins of 331 (termed PBP2-t3-wt) and 332 amino acids (termed PBP2-t3-6140).

    Activity Assay:

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA). .. Soluble recombinant fusion protein was purified by affinity chromatography using amylose resin (New England Biolabs, Ipswich, MA, USA).

    Infection:

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Cells were harvested 48 hr post infection and lysed in 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 10 mM Imidazole. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Expressing:

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: Paragraph title: 2.1. Cloning and expression ... The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning.

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The primer set for hTERT was as follows: 5′-AAGGATTTCAGAATTCGAAGCCACCTCTTTGGA-3′ (forward) and 5′-TGCCGTCTCCGAATTCCGCCACAGAGCCCTGGG-3′ (reverse). .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. Competent Escherichia coli (E . coli ) TOP-10 cells (Thermo Fisher Scientific) were transformed with the plasmid, pMAL-c2MAPhPAter/TERTepi.

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Paragraph title: Expression and purification of truncated and contiguous two-domain C. sinensis PKs ... Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: GORAB scaffolds COPI at the trans-Golgi for efficient enzyme recycling and correct protein glycosylation
    Article Snippet: All amino acid positions of GORAB mentioned in this study refer to the 369 amino acid protein, which originates from the ENST00000367763.7 transcript using the second predicted start codon, which is the correct translation start site , . .. Using standard molecular biology techniques full-length and truncated GORAB and Scyl1 sequences were subcloned into pEGFP-C3 (Clontech Laboratories), pGADT7 and pGBKT7 (BD Biosciences), pFAT2 (a modified pGAT2 vector) and pMAL-C2 (New England Biolabs) for mammalian expression, yeast two-hybrid analysis, and bacterial expression, respectively. .. Missense patient mutations were introduced by site-directed mutagenesis performed using PfuTurbo DNA polymerase adapted from the Quikchange site-directed mutagenesis method (Agilent Technologies).

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids pMAL-C2-Hof1-N-term (1–340), -Hof1-F-BAR (1–275), and -Hof1-CC2 (276–340) expressing MBP-fusions were described previously [ ]. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA).

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of a Truncated PBP2 Construct ... Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA).

    Article Title: The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export
    Article Snippet: Horseradish peroxidase- and fluorophore-coupled secondary antibodies for Western blotting were obtained from Jackson ImmunoResearch and LI-COR Biosciences, respectively. .. The pMal-PP expression vector was produced by exchanging the Factor Xa site from pMal-C2 (New England BioLabs) to a recognition site for the PreScission protease by PCR using the oligonucleotides 5′-aaaCCATGGaaaacgcccagaaaggtgaaa-3′ and 5′-tttgaattcGGGCCCCTGGAACAGAACTTCCAGcccgaggttgttgttattgtt-3′. .. A SET exon7-Nup214 exon18 fusion as described previously ( ) was generated by overlap extension PCR.

    Modification:

    Article Title: GORAB scaffolds COPI at the trans-Golgi for efficient enzyme recycling and correct protein glycosylation
    Article Snippet: All amino acid positions of GORAB mentioned in this study refer to the 369 amino acid protein, which originates from the ENST00000367763.7 transcript using the second predicted start codon, which is the correct translation start site , . .. Using standard molecular biology techniques full-length and truncated GORAB and Scyl1 sequences were subcloned into pEGFP-C3 (Clontech Laboratories), pGADT7 and pGBKT7 (BD Biosciences), pFAT2 (a modified pGAT2 vector) and pMAL-C2 (New England Biolabs) for mammalian expression, yeast two-hybrid analysis, and bacterial expression, respectively. .. Missense patient mutations were introduced by site-directed mutagenesis performed using PfuTurbo DNA polymerase adapted from the Quikchange site-directed mutagenesis method (Agilent Technologies).

    Transformation Assay:

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. The final purified constructs encoded proteins of 331 (termed PBP2-t3-wt) and 332 amino acids (termed PBP2-t3-6140).

    Derivative Assay:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: ATPase-Dependent Quality Control of DNA Replication Origin Licensing
    Article Snippet: Furthermore, a C- terminal 3xFLAG tag was added to the endogenous copy of ORC6 , using pBP83. .. MCM3 mutants were cloned into two different vectors: (a) pMAL-C2P to purify recombinant proteins and (b) pRS306 for complementation studies in yeast. (a) pMAL-C2P was a gift from Satoru Mochida and was derived from pMAL-C2 (NEB) by introducing a PreScission protease site before the EcoRI site in the polylinker region . .. MCM3 was amplified from S.cerevisiae genomic DNA using AM51 and AM52 and cloned into pMAL-C2P using XbaI and SalI sites (pAM5).

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: Human TERT (hTERT) cDNA (Accession number NM_001193376.1) encoding a specific peptide composed of Glu281-Ala436 amino acid residues was obtained by PCR using a cDNA derived from the LC-AI or HT1080 cell line as a template. .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit.

    Sequencing:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: To generate pMAL-c2-[pp1a-1343-1720-His6 ], the coding sequence of the putative 3CLpro domain with flanking sequences (CavV pp1a/1ab amino acid residues Ala-1343 to Asp-1720) was amplified by PCR from cDNA using oligonucleotides LT-1 and LT-2. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: Full-length or truncated derivatives of the OsHRZ1 (AK288394 ), OsHRZ2 (AK068028 ) and BTS (At3g18290 ) coding regions were amplified by PCR using a complementary DNA pool of the rice cultivar Tsukinohikari or A. thaliana ecotype Columbia (Col-0) and ligated into pENTR/D-TOPO (Invitrogen, Carlsbad, CA); the sequence was verified. .. The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP .

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: The ZmCCA1a or ZmCCA1b cDNA fragment was cloned into a pGEM-T (Promega, Madison, Wisconsin). .. After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively. .. E . coli strain Rosetta-gami B competent cells (Novagen, Madison, WI) was used to transform empty pMAL (expressing maltose-binding protein, MBP), pMAL-ZmCCA1a or pMAL-ZmCCA1b, which were grown in 4 ml of Luria-Bertani (LB) media with Carbenicillin (100 mg/L) at 37°C for 18 h. The overnight cultures of Rosetta-gami B cells containing pMAL, pMAL-ZmCCA1a or pMAL-ZmCCA1b construct were diluted into 1:100 in 80 ml LB media with Carbinicillin (100 mg/L) and grown at 37°C to an OD600 value of 0.5, when isopropyl-β-D-thiogalactoside (IPTG) (0.1 mM) was added.

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: All these AD-HOF* constructs were confirmed by sequencing. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA).

    Article Title: Functional Complementation Assay for 47 MUTYH Variants in a MutY-Disrupted Escherichia Coli Strain
    Article Snippet: Human cDNA encoding MUTYH (type 2, isoform 4) cDNA was subcloned into pMAL-c2 (NEB, Ipswich, MA) to generate pMAL-cY2. .. CC104mutY was transformed with pMAL-cY2 or the empty pMAL-c2 vector [Takao et al., ].

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: To construct plasmids pCR8GW-HOF1-3GFP and pCR8GW-CYK3-2GFP, a 9–base pair sequence (GGCGGCCGC) containing a Not I site was introduced immediately before the stop codons of the HOF1 and CYK3 ORFs in plasmids pCR8GW-HOF1 and pCR8GW-CYK3 using the QuickChange II Site-Directed Mutagenesis kit (Stratagene) and primers CYK3-C-NotI-QCF, CYK3-C-NotI-QCR, HOF1-C-NotI-QCF, and HOF1-C-NotI-QCR. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: To construct plasmids pCR8GW-HOF1-3GFP and pCR8GW-CYK3-2GFP, a 9–base pair sequence (GGCGGCCGC) containing a Not I site was introduced immediately before the stop codons of the HOF1 and CYK3 ORFs in plasmids pCR8GW-HOF1 and pCR8GW-CYK3 using the QuickChange II Site-Directed Mutagenesis kit (Stratagene) and primers CYK3-C-NotI-QCF, CYK3-C-NotI-QCR, HOF1-C-NotI-QCF, and HOF1-C-NotI-QCR. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs). .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Chromatography:

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP . .. The purity of the recombinant proteins was assessed by SDS–PAGE followed by Coomassie brilliant blue staining.

    Cell Culture:

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP . .. The resulting plasmids, as well as pMAL-c2 itself (which expresses a MBP-LacZ fusion) as a negative control, were introduced into the E . coli strain BL21(DE3)pLysS.

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. Competent Escherichia coli (E . coli ) TOP-10 cells (Thermo Fisher Scientific) were transformed with the plasmid, pMAL-c2MAPhPAter/TERTepi.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. The final purified constructs encoded proteins of 331 (termed PBP2-t3-wt) and 332 amino acids (termed PBP2-t3-6140).

    Hemagglutination Assay:

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: To generate HA‐MBP control, MBP ORF was PCR‐amplified from pMAL‐p2 (New England Biolabs) as the template, and the product was cloned at EcoRI/SmaI sites of pCI‐neo‐N‐HA. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Generated:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Mutant versions of HOF1 and CYK3 (used both for plasmid constructions and for replacement of the wild-type chromosomal genes as described above) were generated in the pCR8GW-based plasmids by site-directed mutagenesis using the QuickChange kit and the primers described in Supplemental Table 1. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Mutant versions of HOF1 and CYK3 (used both for plasmid constructions and for replacement of the wild-type chromosomal genes as described above) were generated in the pCR8GW-based plasmids by site-directed mutagenesis using the QuickChange kit and the primers described in Supplemental Table 1. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: The structure shows that functionally the Asp insertion comes after Asp346, as the first Asp of the pair retains its interaction with Ser363, while the second Asp points directly toward the β-lactam-binding site where it interferes with binding of the antibiotic or the chemistry of acylation. .. Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA). .. This construct fuses PBP2 to maltose-binding protein (MBP) containing a hexahistidine tag at its N-terminus and an intervening tobacco etch virus (TEV) protease site between the two proteins.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: A similar strategy was used to clone MBP into pEGFP‐C2 vector to generate GFP‐MBP control. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs). .. To generate GST‐SIM1, Nup358‐SIM1 oligos were annealed and cloned into EcoRI/XhoI sites of pGEX‐6P1 vector (GE healthcare).

    Imaging:

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. This plasmid was digested with NheI and then integrated at the CHS4 locus to generate the yeast strains carrying GFP-CHS4 .

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Sonication:

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit.

    Binding Assay:

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Cellular Antioxidant Activity Assay:

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: The reaction mixture contained cDNA of D1D2, 10 pmol of csPKXbaI forward primer ( 5′-TCT AGA ATG CAG GTC GAA CCA CTG AAA TC-3′ ), 10 pmol of csPKPstI reverse primer ( 5′-CTG CAG CTA TGG CAA GGA TTT TTC AAT AGC -3′ ), 1 U of KOD Plus DNA polymerase (Toyobo Co., Ltd., Tokyo, Japan), 5 µl of 10× KOD Plus buffer, 5 µl of 2 mM KOD dNTPs, and 4 µl of 25 mM MgSO4 . .. Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    In Vivo:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Fluorescence:

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Protein expression was monitored by YFP fluorescence and confirmed by SDS-PAGE. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Magnetic Beads:

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Mutagenesis:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: A list of oligonucleotides used for PCR amplification or mutagenesis is available upon request. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Article Title: ATPase-Dependent Quality Control of DNA Replication Origin Licensing
    Article Snippet: MCM3 mutants were cloned into two different vectors: (a) pMAL-C2P to purify recombinant proteins and (b) pRS306 for complementation studies in yeast. (a) pMAL-C2P was a gift from Satoru Mochida and was derived from pMAL-C2 (NEB) by introducing a PreScission protease site before the EcoRI site in the polylinker region . .. MCM3 mutants were cloned into two different vectors: (a) pMAL-C2P to purify recombinant proteins and (b) pRS306 for complementation studies in yeast. (a) pMAL-C2P was a gift from Satoru Mochida and was derived from pMAL-C2 (NEB) by introducing a PreScission protease site before the EcoRI site in the polylinker region .

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Mutant versions of HOF1 and CYK3 (used both for plasmid constructions and for replacement of the wild-type chromosomal genes as described above) were generated in the pCR8GW-based plasmids by site-directed mutagenesis using the QuickChange kit and the primers described in Supplemental Table 1. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Mutant versions of HOF1 and CYK3 (used both for plasmid constructions and for replacement of the wild-type chromosomal genes as described above) were generated in the pCR8GW-based plasmids by site-directed mutagenesis using the QuickChange kit and the primers described in Supplemental Table 1. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Isolation:

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: The QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) was used to generate the pig-1 Δ71bp construct lacking the SPTF-3-bound region, the pig-1 mut.1 construct mutated in the consensus SPTF-3 binding motif, the egl-1 Δ30bp construct and the egl-1 mut.1 to mut.5 constructs. sptf-3 cDNA was isolated by RT-PCR. .. The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Subcloning:

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: HA‐AGO2 was generated by subcloning hAGO2 open reading frame (ORF) from pCMV‐SPORT‐hAGO2 (a gift from Shigeyuki Yokoyama, RIKEN Genomic Sciences Center, Yokohama, Japan) into pcDNA‐HA vector using appropriate restriction sites. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Bimolecular Fluorescence Complementation Assay:

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. This plasmid was digested with NheI and then integrated at the CHS4 locus to generate the yeast strains carrying GFP-CHS4 .

    Nickel Column:

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Recombinant His6-Mps1WT/KD was purified by affinity chromatography in a His-TrapTM -HP nickel-column (Amersham, Little Chalfon, United-Kingdom). .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Purification:

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP . .. The resulting plasmids, as well as pMAL-c2 itself (which expresses a MBP-LacZ fusion) as a negative control, were introduced into the E . coli strain BL21(DE3)pLysS.

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Paragraph title: Expression and purification of truncated and contiguous two-domain C. sinensis PKs ... Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Recombinant His6-Mps1WT/KD was purified by affinity chromatography in a His-TrapTM -HP nickel-column (Amersham, Little Chalfon, United-Kingdom). .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: Paragraph title: Purification of recombinant ZmCCA1b and ZmCCA1a proteins ... After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively.

    Article Title: Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of a Truncated PBP2 Construct ... Truncated constructs comprising only the TPase/β-lactam-binding domain of PBP2 (residues 237–581) were generated by cloning nucleotides 709–1746 of the wild-type penA gene from FA19 or nucleotides 709–1749 of the penA gene from the N. gonorrhoeae penicillin-resistant strain 6140 into pMALC2KV, a derivative of pMAL-C2 (New England Biolabs, Beverly, MA).

    Polymerase Chain Reaction:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: To generate pMAL-c2-[pp1a-1343-1720-His6 ], the coding sequence of the putative 3CLpro domain with flanking sequences (CavV pp1a/1ab amino acid residues Ala-1343 to Asp-1720) was amplified by PCR from cDNA using oligonucleotides LT-1 and LT-2. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. Subsequently, the reaction mixture was digested with DpnI (Life Technologies) to remove any remaining (methylated) pMAL-c2 template DNA.

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: The gene product corresponding to the RNase HI domain (residues 1–140) of Rv2228c was amplified from genomic DNA from the H37Rv strain of M. tuberculosis using the polymerase chain reaction. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning.

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: Full-length or truncated derivatives of the OsHRZ1 (AK288394 ), OsHRZ2 (AK068028 ) and BTS (At3g18290 ) coding regions were amplified by PCR using a complementary DNA pool of the rice cultivar Tsukinohikari or A. thaliana ecotype Columbia (Col-0) and ligated into pENTR/D-TOPO (Invitrogen, Carlsbad, CA); the sequence was verified. .. The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP .

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The primer set for hTERT was as follows: 5′-AAGGATTTCAGAATTCGAAGCCACCTCTTTGGA-3′ (forward) and 5′-TGCCGTCTCCGAATTCCGCCACAGAGCCCTGGG-3′ (reverse). .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. Competent Escherichia coli (E . coli ) TOP-10 cells (Thermo Fisher Scientific) were transformed with the plasmid, pMAL-c2MAPhPAter/TERTepi.

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: A-tailing was done in a total volume of 30 µl containing purified KOD PCR product, 15 U of Gene Taq DNA polymerase (Wako Nippon Gene), 3 µl of 10× Gene Taq buffer and 1.2 µl of 5 mM dNTP. .. Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids pMAL-C2-Hof1-N-term (1–340), -Hof1-F-BAR (1–275), and -Hof1-CC2 (276–340) expressing MBP-fusions were described previously [ ]. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. The PCR condition for a 100 μl reaction is: 2 μl PfuUltra-II fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA), 200 ng genomic DNA from wild-type yeast strain YEF473A (see ), 0.2 μM for each of the forward and reverse primers (see ), PfuUltra-II Hotstart PCR Master Mix (0.25 mM for each dNTP, 2 mM MgCl2 ) (Agilent Technologies) and distilled water (to fill to 100 μl), 30 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 15 sec per kb fragment.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3. .. Plasmids pMALC2-CYK3 and pCOLADuet-His6 -HOF1341–669 ( ) were subjected to site-directed mutagenesis using the QuickChange kit to generate mutations in the Cyk3 proline-rich sequence and the Hof1 SH3 domain, which were confirmed by sequencing.

    Article Title: The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export
    Article Snippet: Horseradish peroxidase- and fluorophore-coupled secondary antibodies for Western blotting were obtained from Jackson ImmunoResearch and LI-COR Biosciences, respectively. .. The pMal-PP expression vector was produced by exchanging the Factor Xa site from pMal-C2 (New England BioLabs) to a recognition site for the PreScission protease by PCR using the oligonucleotides 5′-aaaCCATGGaaaacgcccagaaaggtgaaa-3′ and 5′-tttgaattcGGGCCCCTGGAACAGAACTTCCAGcccgaggttgttgttattgtt-3′. .. A SET exon7-Nup214 exon18 fusion as described previously ( ) was generated by overlap extension PCR.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: To generate HA‐MBP control, MBP ORF was PCR‐amplified from pMAL‐p2 (New England Biolabs) as the template, and the product was cloned at EcoRI/SmaI sites of pCI‐neo‐N‐HA. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Positron Emission Tomography:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. E. coli clones containing the desired recombinant plasmid DNA were identified by restriction and sequence analysis. pMAL-c2-[pp1a-1343-1720-His6 ]-derived constructs were generated by PCR-based methods using suitable primers and in vivo recombination.

    Staining:

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP . .. Recombinant proteins were obtained and purified using the MBP fusion system (New England Biolabs) according to the manufacturer’s instructions except that E . coli was cultured at 22–25 °C, and EDTA was omitted from the column buffer.

    Liquid Chromatography:

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: Human TERT (hTERT) cDNA (Accession number NM_001193376.1) encoding a specific peptide composed of Glu281-Ala436 amino acid residues was obtained by PCR using a cDNA derived from the LC-AI or HT1080 cell line as a template. .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit.

    Plasmid Preparation:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: To generate pMAL-c2-[pp1a-1343-1720-His6 ], the coding sequence of the putative 3CLpro domain with flanking sequences (CavV pp1a/1ab amino acid residues Ala-1343 to Asp-1720) was amplified by PCR from cDNA using oligonucleotides LT-1 and LT-2. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. Subsequently, the reaction mixture was digested with DpnI (Life Technologies) to remove any remaining (methylated) pMAL-c2 template DNA.

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: It was cloned using the Gateway system (Invitrogen) into the His6 -tagged vector pDEST17 with gene-specific primers for the sense strand of bases 1–15 and antisense strand of bases 385–390. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning.

    Article Title: An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways
    Article Snippet: Paragraph title: Plasmid construction ... The sptf-3 cDNA fragment corresponding to amino acids 1–79 or 192–275 was cloned in pGEX-4T-3 (GE Healthcare Life Sciences) and pMAL-c2 (New England BioLabs) to express SPTF-3 protein fragments fused with GST or MBP, respectively.

    Article Title: Elevated TERT Expression in TERT-Wildtype Adult Diffuse Gliomas: Histological Evaluation with a Novel TERT-Specific Antibody
    Article Snippet: The primer set for hTERT was as follows: 5′-AAGGATTTCAGAATTCGAAGCCACCTCTTTGGA-3′ (forward) and 5′-TGCCGTCTCCGAATTCCGCCACAGAGCCCTGGG-3′ (reverse). .. The hTERT-specific peptide was subcloned into an expression vector, pMAL-c2 (New England Biolabs, Beverly, MA) with MAP tag (GDGMVPPGIEDK) [ ], and PA tag (GVAMPGAEDDVV) [ ] using In-Fusion PCR cloning kit. .. Competent Escherichia coli (E . coli ) TOP-10 cells (Thermo Fisher Scientific) were transformed with the plasmid, pMAL-c2MAPhPAter/TERTepi.

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: The protein was eluted with 250 mM Imidazole and dialysed against 20 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM DTT. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector. .. Recombinant constructs were used to transform BL21-star competent cells and protein expression induced with 0.1 mM IPTG at 15°C, overnight.

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: The observed P-value less than 0.05 were considered statistically significant. .. Vectors: pGADT7 (Takara Bio USA, Inc., 630442), pMal-C2 (New England Biolabs, current version of this vector, pMal-c5X, N8108), and tagCFP (EVROGEN, FP111). .. Restriction enzymes: BamHI (New England Biolabs, R0136S) and SalI (New England Biolabs, R0138S).

    Article Title: GORAB scaffolds COPI at the trans-Golgi for efficient enzyme recycling and correct protein glycosylation
    Article Snippet: All amino acid positions of GORAB mentioned in this study refer to the 369 amino acid protein, which originates from the ENST00000367763.7 transcript using the second predicted start codon, which is the correct translation start site , . .. Using standard molecular biology techniques full-length and truncated GORAB and Scyl1 sequences were subcloned into pEGFP-C3 (Clontech Laboratories), pGADT7 and pGBKT7 (BD Biosciences), pFAT2 (a modified pGAT2 vector) and pMAL-C2 (New England Biolabs) for mammalian expression, yeast two-hybrid analysis, and bacterial expression, respectively. .. Missense patient mutations were introduced by site-directed mutagenesis performed using PfuTurbo DNA polymerase adapted from the Quikchange site-directed mutagenesis method (Agilent Technologies).

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids pMAL-C2-Hof1-N-term (1–340), -Hof1-F-BAR (1–275), and -Hof1-CC2 (276–340) expressing MBP-fusions were described previously [ ]. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA). .. The PCR condition for a 100 μl reaction is: 2 μl PfuUltra-II fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA), 200 ng genomic DNA from wild-type yeast strain YEF473A (see ), 0.2 μM for each of the forward and reverse primers (see ), PfuUltra-II Hotstart PCR Master Mix (0.25 mM for each dNTP, 2 mM MgCl2 ) (Agilent Technologies) and distilled water (to fill to 100 μl), 30 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 15 sec per kb fragment.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Paragraph title: Plasmid constructions ... A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export
    Article Snippet: Horseradish peroxidase- and fluorophore-coupled secondary antibodies for Western blotting were obtained from Jackson ImmunoResearch and LI-COR Biosciences, respectively. .. The pMal-PP expression vector was produced by exchanging the Factor Xa site from pMal-C2 (New England BioLabs) to a recognition site for the PreScission protease by PCR using the oligonucleotides 5′-aaaCCATGGaaaacgcccagaaaggtgaaa-3′ and 5′-tttgaattcGGGCCCCTGGAACAGAACTTCCAGcccgaggttgttgttattgtt-3′. .. A SET exon7-Nup214 exon18 fusion as described previously ( ) was generated by overlap extension PCR.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: Paragraph title: Plasmid constructs ... For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs).

    Software:

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: Vectors: pGADT7 (Takara Bio USA, Inc., 630442), pMal-C2 (New England Biolabs, current version of this vector, pMal-c5X, N8108), and tagCFP (EVROGEN, FP111). .. Vectors: pGADT7 (Takara Bio USA, Inc., 630442), pMal-C2 (New England Biolabs, current version of this vector, pMal-c5X, N8108), and tagCFP (EVROGEN, FP111).

    Affinity Chromatography:

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA). .. Maltose binding protein (MBP)-C. sinensis PK fusion protein was expressed in E. coli TB1 cells by induction with 1 mM IPTG at 25°C for 24 h. The cells were resuspended and sonicated in 5× TE buffer.

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Recombinant His6-Mps1WT/KD was purified by affinity chromatography in a His-TrapTM -HP nickel-column (Amersham, Little Chalfon, United-Kingdom). .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    In Vitro:

    Article Title: Hof1 and Chs4 interact via F-BAR domain and Sel1-like repeats to control extracellular matrix deposition during cytokinesis
    Article Snippet: Plasmids for in vitro protein-interaction assays were constructed as follows. .. Plasmid pMAL-C2-chs4-SLR (220–610) was constructed by cloning a Bam HI and Sal I (both sites introduced in PCR primers)–digested CHS4 fragment into the corresponding sites of pMAL-C2 (New England BioLabs, Ipswich, MA).

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Antagonistic roles of Drosophila Tctp and Brahma in chromatin remodelling and stabilizing repeated sequences
    Article Snippet: Paragraph title: In vitro GST-pull down assay ... MBP-tagged Tctp and GST-tagged Brm fragments (GST::Brm 1-311, 304-747, 748-1638, Δ304-500, Δ574-648, Δ694-747, ΔHSA, ΔBRK, and ΔHSA, ΔBRK) were cloned into pMAL-c2 (NEB) and pGEX5X-1 (GE healthcare), respectively.

    Article Title: Nup358 binds to AGO proteins through its SUMO‐interacting motifs and promotes the association of target mRNA with miRISC
    Article Snippet: A similar strategy was used to clone MBP into pEGFP‐C2 vector to generate GFP‐MBP control. .. For in vitro interactions, pMAL‐AGO2 was generated by cloning the BamH1 fragment having AGO2 ORF from pCMV‐SPORT‐hAGO2 into pMAL‐c2 (New England Biolabs). .. To generate GST‐SIM1, Nup358‐SIM1 oligos were annealed and cloned into EcoRI/XhoI sites of pGEX‐6P1 vector (GE healthcare).

    Protein Binding:

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Article Title: Role of the Hof1–Cyk3 interaction in cleavage-furrow ingression and primary-septum formation during yeast cytokinesis
    Article Snippet: Plasmids for in vitro protein-binding assays were constructed as follows. .. A DNA fragment encoding full-length CYK3 was PCR amplified using primers CYK3_1004F+RI and CYK3_3658R+Pst, digested with Eco RI and Pst I, and cloned into pMAL-c2 (New England Biolabs) to create pMALC2-CYK3.

    Produced:

    Article Title: The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export
    Article Snippet: Horseradish peroxidase- and fluorophore-coupled secondary antibodies for Western blotting were obtained from Jackson ImmunoResearch and LI-COR Biosciences, respectively. .. The pMal-PP expression vector was produced by exchanging the Factor Xa site from pMal-C2 (New England BioLabs) to a recognition site for the PreScission protease by PCR using the oligonucleotides 5′-aaaCCATGGaaaacgcccagaaaggtgaaa-3′ and 5′-tttgaattcGGGCCCCTGGAACAGAACTTCCAGcccgaggttgttgttattgtt-3′. .. A SET exon7-Nup214 exon18 fusion as described previously ( ) was generated by overlap extension PCR.

    Concentration Assay:

    Article Title: Cloning, expression, purification and preliminary crystallographic analysis of the RNase HI domain of the Mycobacterium tuberculosis protein Rv2228c as a maltose-binding protein fusion
    Article Snippet: The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning. .. The amplified gene was also cloned into pMAL-c2 (New England Biolabs) containing an MBP tag followed by a factor Xa cleavage site by restriction enzyme-based cloning.

    CTG Assay:

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: The reaction mixture contained cDNA of D1D2, 10 pmol of csPKXbaI forward primer ( 5′-TCT AGA ATG CAG GTC GAA CCA CTG AAA TC-3′ ), 10 pmol of csPKPstI reverse primer ( 5′-CTG CAG CTA TGG CAA GGA TTT TTC AAT AGC -3′ ), 1 U of KOD Plus DNA polymerase (Toyobo Co., Ltd., Tokyo, Japan), 5 µl of 10× KOD Plus buffer, 5 µl of 2 mM KOD dNTPs, and 4 µl of 25 mM MgSO4 . .. Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA).

    Recombinant:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases
    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4. .. In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Article Title: ATPase-Dependent Quality Control of DNA Replication Origin Licensing
    Article Snippet: Furthermore, a C- terminal 3xFLAG tag was added to the endogenous copy of ORC6 , using pBP83. .. MCM3 mutants were cloned into two different vectors: (a) pMAL-C2P to purify recombinant proteins and (b) pRS306 for complementation studies in yeast. (a) pMAL-C2P was a gift from Satoru Mochida and was derived from pMAL-C2 (NEB) by introducing a PreScission protease site before the EcoRI site in the polylinker region . .. MCM3 was amplified from S.cerevisiae genomic DNA using AM51 and AM52 and cloned into pMAL-C2P using XbaI and SalI sites (pAM5).

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: Paragraph title: Metal-binding analysis of recombinant proteins ... The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP .

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA). .. Maltose binding protein (MBP)-C. sinensis PK fusion protein was expressed in E. coli TB1 cells by induction with 1 mM IPTG at 25°C for 24 h. The cells were resuspended and sonicated in 5× TE buffer.

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Paragraph title: Recombinant proteins ... To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Article Title: Temporal Shift of Circadian-Mediated Gene Expression and Carbon Fixation Contributes to Biomass Heterosis in Maize Hybrids
    Article Snippet: Paragraph title: Purification of recombinant ZmCCA1b and ZmCCA1a proteins ... After sequence verification, the ZmCCA1a or ZmCCA1b CDSs was subcloned into pMAL-C2 (New England BioLabs, Beverly, MA) through Eco RІ/Sal І and BamH І/Sal І restriction sites, respectively.

    SDS Page:

    Article Title: Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
    Article Snippet: The fragments were excised with restriction enzymes at the primer sites (underlined areas in ) and inserted into pMAL-c2 (New England Biolabs, Ipswich, MA), constructing the HRZ or BTS derivatives in-frame downstream of MBP . .. Recombinant proteins were obtained and purified using the MBP fusion system (New England Biolabs) according to the manufacturer’s instructions except that E . coli was cultured at 22–25 °C, and EDTA was omitted from the column buffer.

    Article Title: Molecular Cloning and Characterization of Taurocyamine Kinase from Clonorchis sinensis: A Candidate Chemotherapeutic Target
    Article Snippet: Coding region of C. sinensis PK cDNA of D1D2 was cloned into XbaI/PstI site of pMAL-c2 (New England Biolabs, Ipswich, MA, USA). .. Soluble recombinant fusion protein was purified by affinity chromatography using amylose resin (New England Biolabs, Ipswich, MA, USA).

    Article Title: Protein Phosphatase 1 inactivates Mps1 to ensure efficient Spindle Assembly Checkpoint silencing
    Article Snippet: Protein expression was monitored by YFP fluorescence and confirmed by SDS-PAGE. .. To generate MBP-PP1-87B constructs for expression in bacteria, PCR products harboring PP1-87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs pmal c2
    Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control <t>pMAL-c2</t> (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.
    Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmal c2/product/New England Biolabs
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pmal c2 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    80
    New England Biolabs prokaryotic expression plasmid pmal c2
    Specificity analysis of MAGE-D4 antiserum and immunohistochemical staining of MAGE-D4 protein. A: The antiserum can detect the precipitate from induced bacteria containing <t>pMAL-c2/MAGE-D4</t> plasmid (Lane 1) and purified recombinant MAGE-D4 protein (Lane
    Prokaryotic Expression Plasmid Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prokaryotic expression plasmid pmal c2/product/New England Biolabs
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    prokaryotic expression plasmid pmal c2 - by Bioz Stars, 2019-10
    80/100 stars
      Buy from Supplier

    79
    New England Biolabs mbp fusion expression vector pmal c2
    The maltose-binding protein <t>(MBP)-amyloid</t> precursor protein intracellular domain (AICD) fusion protein was expressed, purified and detected in vitro . (A) Whole-cell extracts from E. coli BL21 transformed with <t>AICD/pMAL-c2</t> plasmids either noninduced (lane I) or induced by isopropyl-β-D-thiogalactoside (lane II), purified MBP-AICD (lane III) and MBP (lane IV) were separated on 10% sodium dodecyl sulfate-polyacrylamide electrophoresis gels and stained with Coomassie brilliant blue. (B) MBP-AICD (lane I, corresponding to lane III in Figure 1A ) but not MBP (lane II, corresponding to lane IV in Figure 1A ) was recognized by a specific antibody against AICD in western blot analysis.
    Mbp Fusion Expression Vector Pmal C2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbp fusion expression vector pmal c2/product/New England Biolabs
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mbp fusion expression vector pmal c2 - by Bioz Stars, 2019-10
    79/100 stars
      Buy from Supplier

    Image Search Results


    Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control pMAL-c2 (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.

    Journal:

    Article Title: Characterization of an Alphamesonivirus 3C-Like Protease Defines a Special Group of Nidovirus Main Proteases

    doi: 10.1128/JVI.02040-14

    Figure Lengend Snippet: Autocatalytic release of the putative CavV 3CLpro domain from flanking sequences and determination of the C-terminal 3CLpro autoprocessing site. (A) Schematic representation of CavV pp1a/1ab replicase polyproteins and fusion protein constructs used in this experiment. The putative 3CLpro domain is indicated in dark gray, and transmembrane domains are shown in light gray. 3CLpro mut, putative 3CLpro domain containing a Cys-1539-to-Ala change in the expressed sequence. (B and C) Expression analysis of the MBP-pp1a-1343-1720-His6 (wt) and MBP-pp1a-1343-1720_C1539A-His6 (mut) fusion proteins. Expression was induced with 1 mM IPTG for 4 h at 18°C. Cell lysates obtained from IPTG-induced and noninduced cells were analyzed in a 14% SDS-polyacrylamide gel (B) or by Western blotting using an MBP-specific monoclonal antibody. The products of the expression control pMAL-c2 (MBP-lacZα) and the mutant form of the MBP-3CLpro fusion protein (3CLpro mut) are indicated to the left. Two putative processing products derived from the MBP-3CLpro wt construct are indicated by filled circles. Molecular masses (in kDa) of prestained marker proteins are indicated to the right. (D) Purification of C-terminal (GST-containing) cleavage products produced by 3CLpro -mediated cleavage of the MBP-pp1a-1343-1720-GST fusion protein by glutathione Sepharose chromatography. GST-containing cleavage products eluted in fraction 4 (F4) were subjected to N-terminal sequence analysis by Edman degradation. All three cleavage products were shown to have the N terminus Ser-Ala-Thr-…, suggesting that cleavage occurred at 1700 Q|S1701 in the CavV pp1a/pp1ab sequence. Molecular masses (in kDa) of marker proteins are indicated to the left. SF, soluble protein fraction; IF, insoluble fraction; FT, column flowthrough fraction; W, wash fraction; F3 to F6, elution fractions 3 to 6.

    Article Snippet: In a second PCR, the pMAL-c2 (New England BioLabs) backbone was amplified from pMAL-c2 plasmid DNA using oligonucleotides LT-3 and LT-4.

    Techniques: Construct, Sequencing, Expressing, Western Blot, Mutagenesis, Derivative Assay, Marker, Purification, Produced, Chromatography

    Specificity analysis of MAGE-D4 antiserum and immunohistochemical staining of MAGE-D4 protein. A: The antiserum can detect the precipitate from induced bacteria containing pMAL-c2/MAGE-D4 plasmid (Lane 1) and purified recombinant MAGE-D4 protein (Lane

    Journal:

    Article Title: High expression and frequently humoral immune response of melanoma-associated antigen D4 in glioma

    doi:

    Figure Lengend Snippet: Specificity analysis of MAGE-D4 antiserum and immunohistochemical staining of MAGE-D4 protein. A: The antiserum can detect the precipitate from induced bacteria containing pMAL-c2/MAGE-D4 plasmid (Lane 1) and purified recombinant MAGE-D4 protein (Lane

    Article Snippet: MAGE-D4 coding region was amplified from human glioma tissue cDNA by PCR with high-fidelity PrimeSTARTM HS DNA polymerase (TaKaRa, Tokyo) and cloned into prokaryotic expression plasmid pMAL-c2 (New England Biolabs, USA) to generate recombinant fusion protein.

    Techniques: Immunohistochemistry, Staining, Plasmid Preparation, Purification, Recombinant

    The maltose-binding protein (MBP)-amyloid precursor protein intracellular domain (AICD) fusion protein was expressed, purified and detected in vitro . (A) Whole-cell extracts from E. coli BL21 transformed with AICD/pMAL-c2 plasmids either noninduced (lane I) or induced by isopropyl-β-D-thiogalactoside (lane II), purified MBP-AICD (lane III) and MBP (lane IV) were separated on 10% sodium dodecyl sulfate-polyacrylamide electrophoresis gels and stained with Coomassie brilliant blue. (B) MBP-AICD (lane I, corresponding to lane III in Figure 1A ) but not MBP (lane II, corresponding to lane IV in Figure 1A ) was recognized by a specific antibody against AICD in western blot analysis.

    Journal: Neural Regeneration Research

    Article Title: Two memory associated genes regulated by amyloid precursor protein intracellular domain

    doi: 10.3969/j.issn.1673-5374.2012.05.003

    Figure Lengend Snippet: The maltose-binding protein (MBP)-amyloid precursor protein intracellular domain (AICD) fusion protein was expressed, purified and detected in vitro . (A) Whole-cell extracts from E. coli BL21 transformed with AICD/pMAL-c2 plasmids either noninduced (lane I) or induced by isopropyl-β-D-thiogalactoside (lane II), purified MBP-AICD (lane III) and MBP (lane IV) were separated on 10% sodium dodecyl sulfate-polyacrylamide electrophoresis gels and stained with Coomassie brilliant blue. (B) MBP-AICD (lane I, corresponding to lane III in Figure 1A ) but not MBP (lane II, corresponding to lane IV in Figure 1A ) was recognized by a specific antibody against AICD in western blot analysis.

    Article Snippet: The DNA fragment encoding AICD59, modified by the addition of a Bam HI (New England Biolabs (Beijing) Ltd., Beijing, China) site at the 5′ terminus and a Hind III (New England Biolabs (Beijing) Ltd.) site at the 3′ terminus, was amplified via PCR from full-length APP695 (New England Biolabs (Beijing) Ltd.) and then cloned into the MBP fusion expression vector pMAL-c2 (New England Biolabs (Beijing) Ltd.).

    Techniques: Binding Assay, Purification, In Vitro, Transformation Assay, Electrophoresis, Staining, Western Blot