platinum taq polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher platinum taq polymerase
    Platinum Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1172 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 1172 article reviews
    Price from $9.99 to $1999.99
    platinum taq polymerase - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. The three constructs were cloned in mammalian expression vector pcDNA4/HisMax-TOPO TA (Invitrogen) and checked by sequencing.

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs. .. Transfecting HBoV2 genomic recombinant plasmids into HEK293 cells HEK293 cells grown in 24-well plates were transfected with 1.5 µg of recombinant pBlueScript plasmid DNAs, using the empty pBlueScript vector or lipofectamine reagent as the controls.

    Centrifugation:

    Article Title: Diagnostic Assessment of Mycoplasma genitalium in Culture-Positive Women
    Article Snippet: The supernatants were discarded, and the individual pellets were resuspended in 1 ml of OmniPur sterile water (EM Science) and incubated for 20 min on ice, followed by another centrifugation. .. Each 50-μl reaction mixture contained 37.25 μl of extracted sample; 150 μM (each) dATP, dCTP, dGTP, and dTTP; 0.1 μM each primer, and 5.0 U of Platinum Taq DNA polymerase (Invitrogen) in 1× PCR buffer containing 5 mM MgCl2.

    Amplification:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: .. After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. The PCR mixture was incubated for 5 min at 95°C, subjected to 35 cycles consisting of a 20 s denaturing phase at 94°C, a 30 s annealing phase, a 30 s extension phase at 72°C, and a final extension phase of 7 min at 72°C.

    Article Title: Development of RT-qPCR and semi-nested RT-PCR assays for molecular diagnosis of hantavirus pulmonary syndrome
    Article Snippet: .. For the first round of PCR amplification, 5 μL of cDNA was mixed with 45 μL of a mixture containing PCR buffer (250mM Tris-HCl pH 8.3, 100mM NaCl, and 0.1mM EDTA), magnesium chloride (1.5mM), dNTPs (0.2mM), 1μM of each HTN_73F and HTN 963R primers and 2.5U of Platinum Taq Polymerase (Invitrogen, Thermo-Fisher Scientific, Waltham, USA). ..

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: There are no other Acc III and Kpn I sites in the amplified fragments. .. Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme.

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: .. Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany). ..

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen). .. All reactions were conducted under the following thermal cycling conditions: Taq activation; 95 °C for 5 min, PCR amplification; 36 cycles at 95 °C for 30 s, at 57 °C for 30 s, and at 72 °C for 30 s, final extension; 1 cycle 72 °C for 5 min. For the study of rat Fas siRNA selection under normoxic conditions, the number of amplification cycles was increased from 36 to 40.

    Article Title: ANALYSIS OF HUMAN T-CELL LYMPHOTROPIC VIRUS IN CD25-POSITIVE-ANAPLASTIC LARGE CELL LYMPHOMAS IN CHILDREN
    Article Snippet: PCR was carried out for NPM-ALK translocation in a total volume of 25 μL containing 2 μL of cDNA, 0.3 μM of 5' and 3' oligonucleotide primers (NPM.s - 5' GCTTTGAAATAACACCACCAG - 3' and ALK.a 5' - TAGTTGGGGTTGTAGTCGGT - 3'), 0.2 mM dNTP, 1X PCR buffer, 1.25U Platinum Taq DNA polymerase (Invitrogen®) and 3.0 mM MgCl2 . .. The quality of the synthesized cDNA was investigated prior to PCR for the t(2;5) amplification ( ).

    Article Title: Multiplex amplification enabled by selective circularization of large sets of genomic DNA fragments
    Article Snippet: .. To enrich for circularized DNA by degrading linear strands including selectors, 10 μl of the circularization mixtures (0.4 μg DNA) were then added to a 10 μl mixture of 5 U Exonuclease I (New England Biolabs), 110 mM Tris–HCl, pH 9.0, 3 mM MgCl2 and 0.2 μg BSA and incubated for 2 h at 37°C, followed by 95°C for 10 min. Amplification was performed using 4 μl of each exonuclease-treated circularization reaction (80 ng DNA each) added to 17 μl mixture of 1× PCR buffer (Invitrogen), supplemented with 0.5 U Platinum Taq DNA polymerase (Invitrogen), 0.25 mM dNTP, 0.4 μM Cy-3-labeled forward and reverse primer, respectively, and 2 mM MgCl2 . .. Array hybridization cDNA arrays were obtained from the microarray core facility at Uppsala University.

    Article Title: Incidence of invasive Ureaplasma in VLBW infants: relationship to severe intraventricular hemorrhage
    Article Snippet: This included prepping the cord and skin sites with betadine; physical separation of areas for sample preparation, amplification and product detection; use of filter-plugged tips; and inclusions of water, extracted with the specimens, as a negative control in each PCR run. .. The 50 µl reaction mixture consisted of 10 µl 10× Opti-prime buffer #11 (Stratagene, La Jolla, CA, USA), 30 pmol each of the primers UMS-125 (GTATTTGCAATCTTTATATGTTTTCG) and UMA 226 (CAGCTGATGTAAGTGCAGCATTAAATT), 200 µ m each dNTP, 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 10 µl sample template.

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: Paragraph title: 2.2. DNA Extraction and Amplification ... A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: .. Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: For amplification of MCP-1, RANTES, IL-6, TNF-α, μ-opioid receptor and β-actin genes, the following primer combinations were used, TNF-α (5′-ATGAGCACAGAAAGCATGATC-3′) (5′-TACAGGCTTGTCACTCGAATT-3′), RANTES (5′-CAGCTGCCCTCACCATCATCCTCA-3′) (5′-GCTGGTTTCTTGGGTTTGCTGTGC-3′) MCP-1 (5′-GGGTCTTTGGGAATATAATGTGTA-3′) (5′-AGCCCTGTGCCTCTTCTTCT-3′) MU-OR (5′-CCCCTGCCTGTATTTGTGGTTT-3′) (5′-CATGGCCCTCTATTCTATCGTGTG-3′) IL-6 (5′-TGGAAATTGGGGTAGGAAGGA-3′) (5′-GTTGCCTTCTTGGGACTGATG-3′) and β-actin (5′-TGTGATGGTGGGAATGGGTCAG-3′) (5′-TTTGATGTCACGCACGATTTCC-3′). .. The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl.

    Article Title: Multiplex PCR: Rapid DNA cycling in a conventional thermal cycler
    Article Snippet: It appears that when six target sequences are simultaneously amplified in multiplex PCR, extension time is a critical parameter. .. Using a PCR protocol of 0 sec at 95°C, 0 sec at 60°C, and 0 sec at 74°C with Platinum Taq DNA polymerase (Life Technologies, Gaithersburg, MD), we were able to reduce the total cycling time of the multiplex PCR assay to as little as 55 min, without affecting the yield of PCR products or the specificity of the assay.

    Synthesized:

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: Complementary DNA was synthesized from 1 µg of total RNA per sample with a 60-minute incubation at 42°C, using the Moloney murine leukemia virus reverse transcriptase (Invitrogen, Karlsruhe, Germany) and oligo-(dT) priming (Boehringer Mannheim). .. Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany).

    Article Title: ANALYSIS OF HUMAN T-CELL LYMPHOTROPIC VIRUS IN CD25-POSITIVE-ANAPLASTIC LARGE CELL LYMPHOMAS IN CHILDREN
    Article Snippet: PCR was carried out for NPM-ALK translocation in a total volume of 25 μL containing 2 μL of cDNA, 0.3 μM of 5' and 3' oligonucleotide primers (NPM.s - 5' GCTTTGAAATAACACCACCAG - 3' and ALK.a 5' - TAGTTGGGGTTGTAGTCGGT - 3'), 0.2 mM dNTP, 1X PCR buffer, 1.25U Platinum Taq DNA polymerase (Invitrogen®) and 3.0 mM MgCl2 . .. The quality of the synthesized cDNA was investigated prior to PCR for the t(2;5) amplification ( ).

    Construct:

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Primer pairs used for each construct are given in . .. Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme.

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: Construction of HBoV2 genomic recombinant plasmids Primers were designed against the episomal NCR sequences from HBoV2-C1 ( ) to construct the HBoV2 genomic clones. .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs.

    SYBR Green Assay:

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Incubation:

    Article Title: Diagnostic Assessment of Mycoplasma genitalium in Culture-Positive Women
    Article Snippet: The supernatants were discarded, and the individual pellets were resuspended in 1 ml of OmniPur sterile water (EM Science) and incubated for 20 min on ice, followed by another centrifugation. .. Each 50-μl reaction mixture contained 37.25 μl of extracted sample; 150 μM (each) dATP, dCTP, dGTP, and dTTP; 0.1 μM each primer, and 5.0 U of Platinum Taq DNA polymerase (Invitrogen) in 1× PCR buffer containing 5 mM MgCl2.

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. The PCR mixture was incubated for 5 min at 95°C, subjected to 35 cycles consisting of a 20 s denaturing phase at 94°C, a 30 s annealing phase, a 30 s extension phase at 72°C, and a final extension phase of 7 min at 72°C.

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: Complementary DNA was synthesized from 1 µg of total RNA per sample with a 60-minute incubation at 42°C, using the Moloney murine leukemia virus reverse transcriptase (Invitrogen, Karlsruhe, Germany) and oligo-(dT) priming (Boehringer Mannheim). .. Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany).

    Article Title: Multiplex amplification enabled by selective circularization of large sets of genomic DNA fragments
    Article Snippet: .. To enrich for circularized DNA by degrading linear strands including selectors, 10 μl of the circularization mixtures (0.4 μg DNA) were then added to a 10 μl mixture of 5 U Exonuclease I (New England Biolabs), 110 mM Tris–HCl, pH 9.0, 3 mM MgCl2 and 0.2 μg BSA and incubated for 2 h at 37°C, followed by 95°C for 10 min. Amplification was performed using 4 μl of each exonuclease-treated circularization reaction (80 ng DNA each) added to 17 μl mixture of 1× PCR buffer (Invitrogen), supplemented with 0.5 U Platinum Taq DNA polymerase (Invitrogen), 0.25 mM dNTP, 0.4 μM Cy-3-labeled forward and reverse primer, respectively, and 2 mM MgCl2 . .. Array hybridization cDNA arrays were obtained from the microarray core facility at Uppsala University.

    Expressing:

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. The three constructs were cloned in mammalian expression vector pcDNA4/HisMax-TOPO TA (Invitrogen) and checked by sequencing.

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: Paragraph title: mRNA Expression of CXCR4 ... Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany).

    Modification:

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL. .. Thermocycling conditions were modified from Hebert et al. [ ] and consisted of one cycle of 1 min at 94 °C, six cycles of 30 s at 94 °C, 40 s at 48 °C, and 1 min at 72 °C, followed by 42 cycles of 30 s at 94 °C, 40 s at 51 °C, and 1 min at 72 °C, with a final extension step of 1 min at 72 °C.

    Translocation Assay:

    Article Title: ANALYSIS OF HUMAN T-CELL LYMPHOTROPIC VIRUS IN CD25-POSITIVE-ANAPLASTIC LARGE CELL LYMPHOMAS IN CHILDREN
    Article Snippet: .. PCR was carried out for NPM-ALK translocation in a total volume of 25 μL containing 2 μL of cDNA, 0.3 μM of 5' and 3' oligonucleotide primers (NPM.s - 5' GCTTTGAAATAACACCACCAG - 3' and ALK.a 5' - TAGTTGGGGTTGTAGTCGGT - 3'), 0.2 mM dNTP, 1X PCR buffer, 1.25U Platinum Taq DNA polymerase (Invitrogen®) and 3.0 mM MgCl2 . .. After an initial denaturizing of cDNA for 5 min at 94°C, PCR was carried out for 40 cycles.

    Transfection:

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. Plasmids were introduced into HEK293 cells using the Superfect transfection kit (Qiagen).

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: Total RNA was isolated from the transfected H9C2 cells using the RNeasy® Mini Kit (Qiagen, Valencia, CA), according to the manufacturer's recommendation. .. PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen).

    Sequencing:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. The resulting DNA products were resolved on 1-2% agarose gels containing 0.5 mg/ml ethidium bromide, and product identities were confirmed by dideoxy sequencing (ACGT Laboratories, Toronto, Ontario, Canada).

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. The three constructs were cloned in mammalian expression vector pcDNA4/HisMax-TOPO TA (Invitrogen) and checked by sequencing.

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: The COI barcoding gene was chosen because reference sequences were available for vouchered specimen of C. thomasi bethunebakeri enabling us to confidently confirm species identity via sequencing. .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Activation Assay:

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen). .. All reactions were conducted under the following thermal cycling conditions: Taq activation; 95 °C for 5 min, PCR amplification; 36 cycles at 95 °C for 30 s, at 57 °C for 30 s, and at 72 °C for 30 s, final extension; 1 cycle 72 °C for 5 min. For the study of rat Fas siRNA selection under normoxic conditions, the number of amplification cycles was increased from 36 to 40.

    Northern Blot:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. Band densities were measured using the Northern Eclipse 6.0 software (Empix Imaging, Mississauga, Ontario, Canada) and normalized to each internal control [β actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH)].

    Infection:

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: .. Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Imaging:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. Band densities were measured using the Northern Eclipse 6.0 software (Empix Imaging, Mississauga, Ontario, Canada) and normalized to each internal control [β actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH)].

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Development of RT-qPCR and semi-nested RT-PCR assays for molecular diagnosis of hantavirus pulmonary syndrome
    Article Snippet: Paragraph title: Semi-nested RT-PCR reactions ... For the first round of PCR amplification, 5 μL of cDNA was mixed with 45 μL of a mixture containing PCR buffer (250mM Tris-HCl pH 8.3, 100mM NaCl, and 0.1mM EDTA), magnesium chloride (1.5mM), dNTPs (0.2mM), 1μM of each HTN_73F and HTN 963R primers and 2.5U of Platinum Taq Polymerase (Invitrogen, Thermo-Fisher Scientific, Waltham, USA).

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. Splice variants were examined by RT-PCR using the plasmid-specific primers Xpress and BGH, which allowed discrimination from endogenously expressed APP -isoforms.

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: mRNA expression of CXCR and CXCL was evaluated by reverse transcriptase polymerase chain reaction (RT-PCR). .. Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany).

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: Paragraph title: 2.6. RT-PCR analysis ... PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen).

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: .. Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl.

    Recombinant:

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs. .. Transfecting HBoV2 genomic recombinant plasmids into HEK293 cells HEK293 cells grown in 24-well plates were transfected with 1.5 µg of recombinant pBlueScript plasmid DNAs, using the empty pBlueScript vector or lipofectamine reagent as the controls.

    DNA Extraction:

    Article Title: Incidence of invasive Ureaplasma in VLBW infants: relationship to severe intraventricular hemorrhage
    Article Snippet: A stringent protocol for the processing of blood and CSF samples, DNA extraction and PCR was followed to prevent contamination and hence false-positives. .. The 50 µl reaction mixture consisted of 10 µl 10× Opti-prime buffer #11 (Stratagene, La Jolla, CA, USA), 30 pmol each of the primers UMS-125 (GTATTTGCAATCTTTATATGTTTTCG) and UMA 226 (CAGCTGATGTAAGTGCAGCATTAAATT), 200 µ m each dNTP, 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 10 µl sample template.

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: Paragraph title: 2.2. DNA Extraction and Amplification ... A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Isolation:

    Article Title: Diagnostic Assessment of Mycoplasma genitalium in Culture-Positive Women
    Article Snippet: Each 50-μl reaction mixture contained 37.25 μl of extracted sample; 150 μM (each) dATP, dCTP, dGTP, and dTTP; 0.1 μM each primer, and 5.0 U of Platinum Taq DNA polymerase (Invitrogen) in 1× PCR buffer containing 5 mM MgCl2. .. Stringent precautions were taken during extraction and preparation to prevent contamination, which included use of an isolated and dedicated room for M. genitalium PCR assays.

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: One microgram of the isolated RNA was reverse transcribed using SuperScript™ III (Invitrogen, Carlsbad, CA) and random hexamers, according to the manufacturer's protocol. .. PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen).

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: .. Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl.

    Silver Staining:

    Article Title: ANALYSIS OF HUMAN T-CELL LYMPHOTROPIC VIRUS IN CD25-POSITIVE-ANAPLASTIC LARGE CELL LYMPHOMAS IN CHILDREN
    Article Snippet: PCR was carried out for NPM-ALK translocation in a total volume of 25 μL containing 2 μL of cDNA, 0.3 μM of 5' and 3' oligonucleotide primers (NPM.s - 5' GCTTTGAAATAACACCACCAG - 3' and ALK.a 5' - TAGTTGGGGTTGTAGTCGGT - 3'), 0.2 mM dNTP, 1X PCR buffer, 1.25U Platinum Taq DNA polymerase (Invitrogen®) and 3.0 mM MgCl2 . .. The PCR product (198bp) was analyzed on a 7% polyacrylamide gel with silver staining.

    Negative Control:

    Article Title: Incidence of invasive Ureaplasma in VLBW infants: relationship to severe intraventricular hemorrhage
    Article Snippet: This included prepping the cord and skin sites with betadine; physical separation of areas for sample preparation, amplification and product detection; use of filter-plugged tips; and inclusions of water, extracted with the specimens, as a negative control in each PCR run. .. The 50 µl reaction mixture consisted of 10 µl 10× Opti-prime buffer #11 (Stratagene, La Jolla, CA, USA), 30 pmol each of the primers UMS-125 (GTATTTGCAATCTTTATATGTTTTCG) and UMA 226 (CAGCTGATGTAAGTGCAGCATTAAATT), 200 µ m each dNTP, 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 10 µl sample template.

    Size-exclusion Chromatography:

    Article Title: Multiplex PCR: Rapid DNA cycling in a conventional thermal cycler
    Article Snippet: .. Using a PCR protocol of 0 sec at 95°C, 0 sec at 60°C, and 0 sec at 74°C with Platinum Taq DNA polymerase (Life Technologies, Gaithersburg, MD), we were able to reduce the total cycling time of the multiplex PCR assay to as little as 55 min, without affecting the yield of PCR products or the specificity of the assay. ..

    Mouse Assay:

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: .. Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Polymerase Chain Reaction:

    Article Title: Diagnostic Assessment of Mycoplasma genitalium in Culture-Positive Women
    Article Snippet: .. Each 50-μl reaction mixture contained 37.25 μl of extracted sample; 150 μM (each) dATP, dCTP, dGTP, and dTTP; 0.1 μM each primer, and 5.0 U of Platinum Taq DNA polymerase (Invitrogen) in 1× PCR buffer containing 5 mM MgCl2. .. Test samples were placed in a PE 9700 automated DNA thermal cycler (Perkin-Elmer) and held at 95°C for 5 min. Then, samples were denatured at 95°C for 1 min and the primers were annealed at 55°C for 1 min and extended at 72°C for 1 min for a total of 40 cycles.

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: .. After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. The PCR mixture was incubated for 5 min at 95°C, subjected to 35 cycles consisting of a 20 s denaturing phase at 94°C, a 30 s annealing phase, a 30 s extension phase at 72°C, and a final extension phase of 7 min at 72°C.

    Article Title: Development of RT-qPCR and semi-nested RT-PCR assays for molecular diagnosis of hantavirus pulmonary syndrome
    Article Snippet: .. For the first round of PCR amplification, 5 μL of cDNA was mixed with 45 μL of a mixture containing PCR buffer (250mM Tris-HCl pH 8.3, 100mM NaCl, and 0.1mM EDTA), magnesium chloride (1.5mM), dNTPs (0.2mM), 1μM of each HTN_73F and HTN 963R primers and 2.5U of Platinum Taq Polymerase (Invitrogen, Thermo-Fisher Scientific, Waltham, USA). ..

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: After PCR, products were digested with Acc III and Kpn I, and ligated using T4 ligase. .. Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme.

    Article Title: CXCR4 Chemokine Receptor Mediates Prostate Tumor Cell Adhesion through ?5 and ?3 Integrins 1
    Article Snippet: mRNA expression of CXCR and CXCL was evaluated by reverse transcriptase polymerase chain reaction (RT-PCR). .. Amplification was carried out using gene-specific primers and Platinum-Taq polymerase (Invitrogen) in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany).

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: .. PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen). .. All reactions were conducted under the following thermal cycling conditions: Taq activation; 95 °C for 5 min, PCR amplification; 36 cycles at 95 °C for 30 s, at 57 °C for 30 s, and at 72 °C for 30 s, final extension; 1 cycle 72 °C for 5 min. For the study of rat Fas siRNA selection under normoxic conditions, the number of amplification cycles was increased from 36 to 40.

    Article Title: ANALYSIS OF HUMAN T-CELL LYMPHOTROPIC VIRUS IN CD25-POSITIVE-ANAPLASTIC LARGE CELL LYMPHOMAS IN CHILDREN
    Article Snippet: .. PCR was carried out for NPM-ALK translocation in a total volume of 25 μL containing 2 μL of cDNA, 0.3 μM of 5' and 3' oligonucleotide primers (NPM.s - 5' GCTTTGAAATAACACCACCAG - 3' and ALK.a 5' - TAGTTGGGGTTGTAGTCGGT - 3'), 0.2 mM dNTP, 1X PCR buffer, 1.25U Platinum Taq DNA polymerase (Invitrogen®) and 3.0 mM MgCl2 . .. After an initial denaturizing of cDNA for 5 min at 94°C, PCR was carried out for 40 cycles.

    Article Title: Multiplex amplification enabled by selective circularization of large sets of genomic DNA fragments
    Article Snippet: .. To enrich for circularized DNA by degrading linear strands including selectors, 10 μl of the circularization mixtures (0.4 μg DNA) were then added to a 10 μl mixture of 5 U Exonuclease I (New England Biolabs), 110 mM Tris–HCl, pH 9.0, 3 mM MgCl2 and 0.2 μg BSA and incubated for 2 h at 37°C, followed by 95°C for 10 min. Amplification was performed using 4 μl of each exonuclease-treated circularization reaction (80 ng DNA each) added to 17 μl mixture of 1× PCR buffer (Invitrogen), supplemented with 0.5 U Platinum Taq DNA polymerase (Invitrogen), 0.25 mM dNTP, 0.4 μM Cy-3-labeled forward and reverse primer, respectively, and 2 mM MgCl2 . .. Array hybridization cDNA arrays were obtained from the microarray core facility at Uppsala University.

    Article Title: Incidence of invasive Ureaplasma in VLBW infants: relationship to severe intraventricular hemorrhage
    Article Snippet: Paragraph title: Specimen extraction and PCR ... The 50 µl reaction mixture consisted of 10 µl 10× Opti-prime buffer #11 (Stratagene, La Jolla, CA, USA), 30 pmol each of the primers UMS-125 (GTATTTGCAATCTTTATATGTTTTCG) and UMA 226 (CAGCTGATGTAAGTGCAGCATTAAATT), 200 µ m each dNTP, 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 10 µl sample template.

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL. .. Two reactions contained PCR-grade H2 O in lieu of template to serve as negative controls.

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs. .. Transfecting HBoV2 genomic recombinant plasmids into HEK293 cells HEK293 cells grown in 24-well plates were transfected with 1.5 µg of recombinant pBlueScript plasmid DNAs, using the empty pBlueScript vector or lipofectamine reagent as the controls.

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: .. The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl. .. PCR products were separated by 1.5% agarose gel electrophoresis, stained with ethidium bromide, and visualized under UV light using a Kodak 440CF Image Station (Rochester, NY).

    Article Title: Multiplex PCR: Rapid DNA cycling in a conventional thermal cycler
    Article Snippet: .. Using a PCR protocol of 0 sec at 95°C, 0 sec at 60°C, and 0 sec at 74°C with Platinum Taq DNA polymerase (Life Technologies, Gaithersburg, MD), we were able to reduce the total cycling time of the multiplex PCR assay to as little as 55 min, without affecting the yield of PCR products or the specificity of the assay. ..

    Agarose Gel Electrophoresis:

    Article Title: Development of RT-qPCR and semi-nested RT-PCR assays for molecular diagnosis of hantavirus pulmonary syndrome
    Article Snippet: For the first round of PCR amplification, 5 μL of cDNA was mixed with 45 μL of a mixture containing PCR buffer (250mM Tris-HCl pH 8.3, 100mM NaCl, and 0.1mM EDTA), magnesium chloride (1.5mM), dNTPs (0.2mM), 1μM of each HTN_73F and HTN 963R primers and 2.5U of Platinum Taq Polymerase (Invitrogen, Thermo-Fisher Scientific, Waltham, USA). .. The PCR products from the final round of amplification were submitted to agarose gel electrophoresis and stained with SYBR safe gel stain (Molecular Probes, Thermo-Fisher Scientific, Waltham, USA) for visualization of corresponding size DNA bands.

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL. .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl. .. PCR products were separated by 1.5% agarose gel electrophoresis, stained with ethidium bromide, and visualized under UV light using a Kodak 440CF Image Station (Rochester, NY).

    Purification:

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs. .. Transfecting HBoV2 genomic recombinant plasmids into HEK293 cells HEK293 cells grown in 24-well plates were transfected with 1.5 µg of recombinant pBlueScript plasmid DNAs, using the empty pBlueScript vector or lipofectamine reagent as the controls.

    Plasmid Preparation:

    Article Title: A Role for SC35 and hnRNPA1 in the Determination of Amyloid Precursor Protein Isoforms
    Article Snippet: Platinum Taq DNA Polymerase (Invitrogen) was used as the amplifying enzyme. .. The three constructs were cloned in mammalian expression vector pcDNA4/HisMax-TOPO TA (Invitrogen) and checked by sequencing.

    Article Title: Keeping all secondary structures of the non-coding region in the circular genome of human bocavirus 2 is important for DNA replication and virus assembly, as revealed by three hetero-recombinant genomic clones
    Article Snippet: .. High-fidelity long PCRs were performed using Platinum ® Taq DNA Polymerase (Invitrogen Life Technologies) using plasmid DNA pBlueScript-HBoV2 fragments 1–4 as templates, after which the PCR products were purified, cleaved, ligated and cloned into plasmid pBlueScript SKII (+) to obtain HBoV2 recombinant plasmid DNAs. .. Transfecting HBoV2 genomic recombinant plasmids into HEK293 cells HEK293 cells grown in 24-well plates were transfected with 1.5 µg of recombinant pBlueScript plasmid DNAs, using the empty pBlueScript vector or lipofectamine reagent as the controls.

    Software:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ). .. Band densities were measured using the Northern Eclipse 6.0 software (Empix Imaging, Mississauga, Ontario, Canada) and normalized to each internal control [β actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH)].

    Real-time Polymerase Chain Reaction:

    Article Title: Wnt/?-catenin Inhibits Dental Pulp Stem Cell Differentiation
    Article Snippet: Paragraph title: Quantitative Polymerase Chain-reaction (qPCR) Analysis ... The resulting cDNA was diluted 1:20 and used for 20-μL reactions containing CYBR green master mix, dNTPs, primers, and Platinum Taq DNA Polymerase (Invitrogen).

    Multiplex Assay:

    Article Title: Multiplex PCR: Rapid DNA cycling in a conventional thermal cycler
    Article Snippet: .. Using a PCR protocol of 0 sec at 95°C, 0 sec at 60°C, and 0 sec at 74°C with Platinum Taq DNA polymerase (Life Technologies, Gaithersburg, MD), we were able to reduce the total cycling time of the multiplex PCR assay to as little as 55 min, without affecting the yield of PCR products or the specificity of the assay. ..

    Selection:

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen). .. All reactions were conducted under the following thermal cycling conditions: Taq activation; 95 °C for 5 min, PCR amplification; 36 cycles at 95 °C for 30 s, at 57 °C for 30 s, and at 72 °C for 30 s, final extension; 1 cycle 72 °C for 5 min. For the study of rat Fas siRNA selection under normoxic conditions, the number of amplification cycles was increased from 36 to 40.

    Sample Prep:

    Article Title: Incidence of invasive Ureaplasma in VLBW infants: relationship to severe intraventricular hemorrhage
    Article Snippet: This included prepping the cord and skin sites with betadine; physical separation of areas for sample preparation, amplification and product detection; use of filter-plugged tips; and inclusions of water, extracted with the specimens, as a negative control in each PCR run. .. The 50 µl reaction mixture consisted of 10 µl 10× Opti-prime buffer #11 (Stratagene, La Jolla, CA, USA), 30 pmol each of the primers UMS-125 (GTATTTGCAATCTTTATATGTTTTCG) and UMA 226 (CAGCTGATGTAAGTGCAGCATTAAATT), 200 µ m each dNTP, 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 10 µl sample template.

    Electrophoresis:

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Ethanol Precipitation:

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: The RNA remains in the aqueous phase and can be subsequently recovered by 0.5 M ammonium acetate and ethanol precipitation. .. The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl.

    dsDNA Assay:

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: Total DNA from the resulting extracts was quantified using the high sensitivity Qubit dsDNA assay (Invitrogen, Carlsbad, CA, USA) per manufacture’s instructions with 2 µL of extract. .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Concentration Assay:

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: Aliquots of DNA were normalized to the lowest total DNA concentration with molecular grade water prior to PCR. .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    CTG Assay:

    Article Title: Cardiomyocyte-targeted siRNA delivery by prostaglandin E2-Fas siRNA polyplexes formulated with reducible poly(amido amine) for preventing cardiomyocyte apoptosis
    Article Snippet: PCR was performed (Invitrogen, Carlsbad, CA) on 2 µl of cDNA using Platinum Taq Polymerase (Invitrogen). .. The primers for rat Fas and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were: Fas forward, 5′-CTG CAG ATA TGC TGC TGT GGA TCA-3′; Fas reverse, 5′-TTT GGT GTT GCT GGT GCG T-3′; GAPDH forward, 5′-CAT GCC GCC TGG AGA AAC CTG CCA-3′; GAPDH reverse, 5′-TGG GCT GGG TGG TCC AGG GGT TTC-3′.

    Marker:

    Article Title: Using Noninvasive Genetic Sampling to Survey Rare Butterfly Populations
    Article Snippet: Additionally, COI is one of the most commonly sequenced barcoding genes in animals so it will therefore be a versatile marker for similar research using tissue of possibly unknown origin where species identity needs to be confirmed. .. A master mix PCR cocktail was prepared for carrying out 20 µL reactions, each containing 1 unit of Platinum Taq DNA Polymerase (Invitrogen), 1× PCR Buffer, 2.0 mM of MgCl2 , 0.4 mM dNTPs, 0.2 µM of each primer, 13.4 µL of PCR-grade H2 O, and 2 µL of DNA template normalized to 1.1 ng/µL.

    Staining:

    Article Title: Microglia Kv1.3 Channels Contribute to Their Ability to Kill Neurons
    Article Snippet: Almost all of the remaining cells were astrocytes, as indicated by staining with an antibody against glial fibrillary acidic protein; < 0.1% were microglia (OX-42 positive). .. After first-strand cDNA synthesis, PCR amplification was conducted using a Gene-Amp PCR 2400 system (PerkinElmer, Toronto, Ontario, Canada) with 1× PCR buffer (60 m m Tris-SO4 , pH 8.9, 18 m m ammonium sulfate), 2 m m MgSO4 , 0.2 m m dNTPs, and 1 U Platinum Taq DNA polymerase (Invitrogen) using gene-specific primers and conditions (see ).

    Article Title: Development of RT-qPCR and semi-nested RT-PCR assays for molecular diagnosis of hantavirus pulmonary syndrome
    Article Snippet: For the first round of PCR amplification, 5 μL of cDNA was mixed with 45 μL of a mixture containing PCR buffer (250mM Tris-HCl pH 8.3, 100mM NaCl, and 0.1mM EDTA), magnesium chloride (1.5mM), dNTPs (0.2mM), 1μM of each HTN_73F and HTN 963R primers and 2.5U of Platinum Taq Polymerase (Invitrogen, Thermo-Fisher Scientific, Waltham, USA). .. The PCR products from the final round of amplification were submitted to agarose gel electrophoresis and stained with SYBR safe gel stain (Molecular Probes, Thermo-Fisher Scientific, Waltham, USA) for visualization of corresponding size DNA bands.

    Article Title: Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection
    Article Snippet: Total RNA was isolated from the hearts of MIF+/+ and MIF−/− T. cruzi- infected mice at 22 days postinfection by the TRIzol method (GIBCO BRL) according to the manufacturer's instructions. cDNA samples were amplified by SuperScript One-Step reverse transcription-PCR (RT-PCR) for 25 to 30 cycles, using Platinum Taq polymerase (Invitrogen) and specific primers (the sequences of the primers used are given in Table ). .. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gels containing SYBR green I, a nucleic acid gel stain used at 1,000× (Amresco), and were visualized with the FLA-5000 chemiluminescence detection system (Fujifilm).

    Article Title: Synergistic increases in intracellular Ca2+, and the release of MCP-1, RANTES, and IL-6 by astrocytes treated with opiates and HIV-1 Tat
    Article Snippet: The PCR mixture consisted of 600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulfate, 10 mM dNTP mixture, 50 mM MgSO4, 1 U Platinum Taq DNA polymerase (Invitrogen, Life Technologies), 10 pmol of primer, and reverse transcript template cDNA in a total volume of 50 μl. .. PCR products were separated by 1.5% agarose gel electrophoresis, stained with ethidium bromide, and visualized under UV light using a Kodak 440CF Image Station (Rochester, NY).

    Variant Assay:

    Article Title: Multiplex PCR: Rapid DNA cycling in a conventional thermal cycler
    Article Snippet: Multiplex polymerase chain reaction (PCR) is a variant of PCR in which two or more target sequences are simultaneously amplified in the same reaction. .. Using a PCR protocol of 0 sec at 95°C, 0 sec at 60°C, and 0 sec at 74°C with Platinum Taq DNA polymerase (Life Technologies, Gaithersburg, MD), we were able to reduce the total cycling time of the multiplex PCR assay to as little as 55 min, without affecting the yield of PCR products or the specificity of the assay.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher platinum taq dna polymerase high fidelity
    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by <t>DNA</t> sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the <t>Taq</t> DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.
    Platinum Taq Dna Polymerase High Fidelity, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 417 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq dna polymerase high fidelity/product/Thermo Fisher
    Average 90 stars, based on 417 article reviews
    Price from $9.99 to $1999.99
    platinum taq dna polymerase high fidelity - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii rt pcr platinum taq high fidelity kit
    ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all <t>three</t> of the cell populations were subjected to <t>RT-PCR</t> to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).
    Superscript Iii Rt Pcr Platinum Taq High Fidelity Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii rt pcr platinum taq high fidelity kit/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii rt pcr platinum taq high fidelity kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Article Snippet: PCR fragments of LraI operon amplified using Platinum™ Taq DNA Polymerase High Fidelity were cloned into pAZIL vector predigested with Sma I.

    Techniques: DNA Sequencing, Sequencing, Activity Assay

    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Article Snippet: Platinum™ Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) was used to amplify DNA fragments by PCR in GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA).

    Techniques: DNA Sequencing, Sequencing, Activity Assay

    ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all three of the cell populations were subjected to RT-PCR to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).

    Journal: Journal of Virology

    Article Title: Transposon Mutagenesis of the Zika Virus Genome Highlights Regions Essential for RNA Replication and Restricted for Immune Evasion

    doi: 10.1128/JVI.00698-17

    Figure Lengend Snippet: ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all three of the cell populations were subjected to RT-PCR to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).

    Article Snippet: The viral RNA was then amplified in three segments by utilizing a SuperScript III RT-PCR Platinum Taq High Fidelity kit (Thermo Fisher Scientific).

    Techniques: Mutagenesis, Library Screening, Sequencing, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Infection