platinium taq dna polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Platinum Taq DNA Polymerase
    Description:
    Invitrogen Platinum Taq DNA Polymerase is a convenient and reliable "hot start" thermostable DNA polymerase for PCR that provides enhanced specificity over that of Taq DNA Polymerase. The "hot start" property of the enzyme is conferred by thermolabile monoclonal antibodies that render Taq DNA polymerase inactive until the initial PCR denaturation step, thus preventing the extention of nonspecifically annealed primers and improving product yield. Using Platinum Taq DNA Polymerase The hot-start property of Platinum Taq DNA Polymerase allows for convenient reaction assembly at room temperature. Just as with Taq DNA Polymerase, Platinum Taq DNA Polymerase has a non-template–dependent terminal transferase activity that adds a 3′ deoxyadenosine to product ends, and has a 5′→3′ exonuclease activity. PCR products generated with Platinum Taq DNA Polymerase may be used in the same downstream applications without protocol modifications. Use Platinum Taq DNA Polymerase for the amplification of DNA from complex genomic, viral, and plasmid templates, as well as in RT-PCR. Note: For superior PCR performance, we recommend next-generation enzyme Platinum II Taq Hot-start DNA Polymerase. Platinum II Taq Hot-Start DNA Polymerase is designed for universal primer annealing and fast, easy PCR with its unique combination of innovative buffer, high-performance engineered Taq DNA polymerase, and superior hot-start technology.
    Catalog Number:
    10966018
    Price:
    None
    Applications:
    Amplification of Bisulfite-Treated DNA|Chromatin Immunoprecipitation (ChIP)|Fast PCR|Hot Start PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|RNAi, Epigenetics & Non-Coding RNA Research|Routine PCR|Chromatin Biology|Methylation Analysis
    Size:
    120 reactions
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, PCR Enzymes & Kits
    Score:
    85
    Buy from Supplier
    Name:
    Platinum Taq DNA Polymerase High Fidelity
    Description:
    Platinum Taq DNA Polymerase, High Fidelity, is ideal for amplification of DNA fragments when high yields and robust amplification are required. High fidelity is provided by a mixture of Platinum Taq DNA Polymerase and the proofreading (3´→5´ exonuclease activity) enzyme Pyrococcus species GB-D polymerase. PCR specificity is improved with the incorporation of Platinum automatic "hot-start" technology. Features of Platinum Taq DNA Polymerase, High Fidelity:• Fidelity—greater than six times higher fidelity than Taq DNA polymerase• Amplicon size—amplification of fragments up to 15 kb (see figure)• Convenience—room temperature reaction assembly• Applications—amplification of DNA from complex genomic, viral, and plasmid templates; and RT-PCRUnit definitionOne unit of Platinum Taq DNA Polymerase, High Fidelity, is the amount of enzyme required to incorporate 10 nmoles of deoxyribonucleotide into DNA in 30 min at 74°C.
    Catalog Number:
    11304011
    Price:
    None
    Applications:
    Amplification of Bisulfite-Treated DNA|Chromatin Immunoprecipitation (ChIP)|High Fidelity PCR|Hot Start PCR|Kits & Reagents for Sanger Sequencing|Long Fragment PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|RNAi, Epigenetics & Non-Coding RNA Research|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Chromatin Biology|Methylation Analysis|Sequencing
    Size:
    100 reactions
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, PCR Enzymes & Kits
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher platinium taq dna polymerase
    MNN2 gene amplification efficiency on modified strain colonies picked from Petri dishes or micro-plate cultures. A ) 3 independent assays carried out on 23 colonies for each condition. Dark grey: Petri dishes cultures, light grey: liquid cultures. B ) Average of the 3 assays presented in A (standard deviation=19.55). C ) PCR product visualized on a 1% agarose gel stained with SYBR safe. Left panel (1): Petri dishes, right panel (2): micro-plate cultures, ML: Molecular ladder. All amplifications have been carried out with the <t>Platinium</t> <t>Taq.</t>
    Platinum Taq DNA Polymerase, High Fidelity, is ideal for amplification of DNA fragments when high yields and robust amplification are required. High fidelity is provided by a mixture of Platinum Taq DNA Polymerase and the proofreading (3´→5´ exonuclease activity) enzyme Pyrococcus species GB-D polymerase. PCR specificity is improved with the incorporation of Platinum automatic "hot-start" technology. Features of Platinum Taq DNA Polymerase, High Fidelity:• Fidelity—greater than six times higher fidelity than Taq DNA polymerase• Amplicon size—amplification of fragments up to 15 kb (see figure)• Convenience—room temperature reaction assembly• Applications—amplification of DNA from complex genomic, viral, and plasmid templates; and RT-PCRUnit definitionOne unit of Platinum Taq DNA Polymerase, High Fidelity, is the amount of enzyme required to incorporate 10 nmoles of deoxyribonucleotide into DNA in 30 min at 74°C.
    https://www.bioz.com/result/platinium taq dna polymerase/product/Thermo Fisher
    Average 94 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    platinium taq dna polymerase - by Bioz Stars, 2020-01
    94/100 stars

    Images

    1) Product Images from "PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae"

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-6-201

    MNN2 gene amplification efficiency on modified strain colonies picked from Petri dishes or micro-plate cultures. A ) 3 independent assays carried out on 23 colonies for each condition. Dark grey: Petri dishes cultures, light grey: liquid cultures. B ) Average of the 3 assays presented in A (standard deviation=19.55). C ) PCR product visualized on a 1% agarose gel stained with SYBR safe. Left panel (1): Petri dishes, right panel (2): micro-plate cultures, ML: Molecular ladder. All amplifications have been carried out with the Platinium Taq.
    Figure Legend Snippet: MNN2 gene amplification efficiency on modified strain colonies picked from Petri dishes or micro-plate cultures. A ) 3 independent assays carried out on 23 colonies for each condition. Dark grey: Petri dishes cultures, light grey: liquid cultures. B ) Average of the 3 assays presented in A (standard deviation=19.55). C ) PCR product visualized on a 1% agarose gel stained with SYBR safe. Left panel (1): Petri dishes, right panel (2): micro-plate cultures, ML: Molecular ladder. All amplifications have been carried out with the Platinium Taq.

    Techniques Used: Amplification, Modification, Standard Deviation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    Efficiency of MNN5 gene amplification from wild type and modified strains. A ) Percentage of colonies picked from Petri dishes that amplified MNN5. The experiment was carried out on 47 colonies for each strain. Dark grey: BY4742; light grey: YiMMOgène. Amplification was carried out using the DreamTaq or the Platinium Taq. B ). PCR product visualisation, after amplification with the Platinium Taq, on a 1% agarose gel stained with SYBR safe. Left panel (1): BY4742, right panel (2): YiMMOgène, ML: Molecular ladder.
    Figure Legend Snippet: Efficiency of MNN5 gene amplification from wild type and modified strains. A ) Percentage of colonies picked from Petri dishes that amplified MNN5. The experiment was carried out on 47 colonies for each strain. Dark grey: BY4742; light grey: YiMMOgène. Amplification was carried out using the DreamTaq or the Platinium Taq. B ). PCR product visualisation, after amplification with the Platinium Taq, on a 1% agarose gel stained with SYBR safe. Left panel (1): BY4742, right panel (2): YiMMOgène, ML: Molecular ladder.

    Techniques Used: Amplification, Modification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    Efficiency of MNN5 gene amplification from liquid culture of modified strain. A ) Percentage of MNN5 amplification from 47 colonies picked on Petri dishes and 47 colonies picked from liquid cultures in micro-plates. B ) Growth curve in micro-plate (YPD medium), average of two colonies of YiMMOgène. The OD 600 was measured in a micro-plate reader. ♦: OD 600 after 6 hour culture (early exponential phase). ●: OD 600 after 17 hour culture (late exponential phase). ▄: OD 600 after 24 hour culture (early stationary phase). C ) Percentage amplification of MNN5 from 47 YiMMOgène after different culture times in micro-plate. All amplifications have been carried out with the Platinium Taq.
    Figure Legend Snippet: Efficiency of MNN5 gene amplification from liquid culture of modified strain. A ) Percentage of MNN5 amplification from 47 colonies picked on Petri dishes and 47 colonies picked from liquid cultures in micro-plates. B ) Growth curve in micro-plate (YPD medium), average of two colonies of YiMMOgène. The OD 600 was measured in a micro-plate reader. ♦: OD 600 after 6 hour culture (early exponential phase). ●: OD 600 after 17 hour culture (late exponential phase). ▄: OD 600 after 24 hour culture (early stationary phase). C ) Percentage amplification of MNN5 from 47 YiMMOgène after different culture times in micro-plate. All amplifications have been carried out with the Platinium Taq.

    Techniques Used: Amplification, Modification

    MNN5 gene amplification efficiency on modified strain colonies picked from Petri dishes or micro-plate cultures. A ) 3 independent assays carried out on 47 colonies for each condition. Dark grey: Petri dishes cultures, light grey: micro-plate cultures. B ) Average of the 3 assays presented in A (standard deviation =22.07). C) PCR product visualised on a 1% agarose gel stained with SYBR safe. Left panel (1): Petri dishes, right panel (2): micro-plate cultures, ML: Molecular ladder. All amplifications were carried out using Platinium Taq.
    Figure Legend Snippet: MNN5 gene amplification efficiency on modified strain colonies picked from Petri dishes or micro-plate cultures. A ) 3 independent assays carried out on 47 colonies for each condition. Dark grey: Petri dishes cultures, light grey: micro-plate cultures. B ) Average of the 3 assays presented in A (standard deviation =22.07). C) PCR product visualised on a 1% agarose gel stained with SYBR safe. Left panel (1): Petri dishes, right panel (2): micro-plate cultures, ML: Molecular ladder. All amplifications were carried out using Platinium Taq.

    Techniques Used: Amplification, Modification, Standard Deviation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    Related Articles

    Methylation Sequencing:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Paragraph title: Bisulfite sequencing ... Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Paragraph title: 2.1. DNA methylation analysis using bisulfite sequencing ... Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Clone Assay:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Amplification:

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae
    Article Snippet: Paragraph title: PCR amplification ... With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL.

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Bisulfite-treated unmethylated DNA from human peripheral blood (Promega) was used as control. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Primer pairs P-F1L/P-F1R, P-F2L/P-F2R and P-F3L/P-F3R were used to amplify CAMP-F1, CAMP-F2 and CAMP-F3 fragments in human CAMP promoter region, respectively (Table ).

    Article Title: EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco
    Article Snippet: The EGRF gene was amplified as follows: 2 minutes at 50°C; 15 minutes at 95°C; 40 cycles of 95°C for 15 seconds; and 60°C for 1 minute. .. PCR was performed using Platinium® Taq DNA polymerase (Invitrogen).

    Article Title: Formaldehyde Crosses the Human Placenta and Affects Human Trophoblast Differentiation and Hormonal Functions
    Article Snippet: Trophoblasts were exposed to formaldehyde, Nac or both for 24 h, and total RNA was then extracted. .. RT-PCR was performed with the RT2 profiler PCR array (SABioscience) or with Superscript III reverse transcriptase followed by amplification with Platinium Taq polymerase (Life Technologies), according to the manufacturers' protocols and as previously described [ ]. .. The RT2 profiler PCR array contains an RT2 First Strand kit for RT assays and the RT2 SYBR Green/ROX qPCR Master mix.

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: Total nucleic acids were extracted from 100 μl of serum using an automated BioRobot MDx extraction platform using the QIAamp® Virus BioRobot® MDx Kit (QIAGEN, Valencia, CA, USA). .. HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. The amplification conditions were as follows: 53°C for 30 minutes (for reverse transcription) and 94°C for 2 minutes for Taq DNA polymerase activation, followed by 40 cycles at 94°C for 15 s, 55°C for 30 s, and 68°C for 4 min. Nested amplification was performed using the Expand™ High Fidelity PCR System kit (Roche Diagnostics, Indianapolis, USA) as described by the manufacturer.

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: The Mα4-Promoter of Atp1a4 was amplified, in three overlapping fragments using the primers listed in . .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Article Title: Kaempferol Suppresses Transforming Growth Factor-β1–Induced Epithelial-to-Mesenchymal Transition and Migration of A549 Lung Cancer Cells by Inhibiting Akt1-Mediated Phosphorylation of Smad3 at Threonine-179
    Article Snippet: The primer used for detection of Snail promoter sequence as follows: forward primer, 5ʹ-CGCTCCGTAAACACTGGATAA-3ʹ; reverse primer, 5ʹ-GAAGCGAGGAAAGGGACAC-3ʹ. .. The samples were amplified by conventional polymerase chain reaction (PCR) using the above Smad3 Snail promoter-specific forward and reverse primers and Platinium Taq DNA polymerase (Invitrogen). .. Total cellular RNA was extracted from cells using the phenol-guanidinium isothiocyanate method .

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: Bisulfite-modified DNA was then used as a template for PCR amplification. .. PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA).

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Probes were amplified by RT-PCR using specific primers: Reverse transcription was performed using random primers and GenAmp (Roche, Basel, Switzerland) RT-PCR kit. .. The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction.

    Article Title: Cannabinoid receptor 1 signaling in embryo neurodevelopment
    Article Snippet: The RT-PCR profile used was as follows: 1 cycle (50°C, 30 minutes) for cDNA synthesis, followed by 35 cycles of PCR amplification: denaturation (94°C, 15 seconds), annealing (55°C 30 seconds) and extention (72°C 30 seconds), followed by 1 cycle of 72°C for 5 minutes for extension. .. Instead, 2 units Platinium Taq DNA polymerase (Invitrogen) was added per 50 μl reaction volume.

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA. .. Amplification was performed in a T100 Thermal Cycler (BioRad) with following thermal program: 2 min at 95 °C, followed by 14 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 210 s. A nested PCR targeting the Gag gene was performed using the following reaction mix: 1 X PCR buffer, 1.5 mM MgCl2 , 0.5 mM dNTPs, 0.5 μM AluGag For and AluGag Rev. primers, 0.15 μM AluGag probe (FAM-AAAATTCGGTTAAGGCCAGGGGGAAAGAA-BHQ1), 1 U Platinium Taq polymerase and 3 ng of genomic DNA or 2 μl of Alu-Gag PCR product.

    Positive Control:

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. As negative control, DNA was replaced with sterile deionized water.

    Article Title: vacA s1m1 genotype and cagA EPIYA-ABC pattern are predominant among Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), in a final volume of 15 µl. .. As a negative control, DNA was replaced with sterile deionized water.

    Synthesized:

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA). .. Initial denaturing for 3 min at 94°C was followed by 50 cycles, starting with a step at 94°C for 20 s. Different annealing temperatures were used according to the primers for 20 s , followed by a 30-45 s step at 72° C, with a final extension at 72° C for 7 min. Primers used for PCR and sequencing are listed in .

    Article Title: NLS-tagging: an alternative strategy to tag nuclear proteins
    Article Snippet: First-strand cDNA was synthesized using the SuperScript II First Strand Synthesis System (Invitrogen) and oligo-dT primers (Invitrogen). .. Real-time PCR was performed using Platinium Taq Polymerase and SYBR green (Invitrogen) cDNA on a Bio-Rad CFX96 PCR System.

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Cells or muscles were lysed in TRIZOL reagent (Invitrogen), and total RNAs were isolated according to the manufacturer’s recommendations and loaded on eukaryote total RNA 6000 nano chips (Agilent) to verify quality. cDNAs were synthesized from 1 µg of total RNA using random hexamers and SuperScript III Reverse transcription (Invitrogen). .. Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization.

    TA Cloning:

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Quantitative RT-PCR:

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Paragraph title: RNA Extraction and RT-qPCR. ... Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization.

    SYBR Green Assay:

    Article Title: NLS-tagging: an alternative strategy to tag nuclear proteins
    Article Snippet: First-strand cDNA was synthesized using the SuperScript II First Strand Synthesis System (Invitrogen) and oligo-dT primers (Invitrogen). .. Real-time PCR was performed using Platinium Taq Polymerase and SYBR green (Invitrogen) cDNA on a Bio-Rad CFX96 PCR System. .. Ribonuclease/angiogenin 1 (Rnh1 ) was amplified in parallel for normalization purposes.

    Article Title: Kinetic Hairpin Oligonucleotide Blockers for Selective Amplification of Rare Mutations
    Article Snippet: All experiments were carried out in a Stratagene MX3005P PCR machine. .. LATE-PCR amplifications were performed using 25 μl reaction mixtures containing 1× PCR buffer (Invitrogen, Carlsbad, CA), 3 mM MgCl2, 200 nM dNTPs, 0.24× SYBR Green (Invitrogen, Carlsbad, CA), 50 nM limiting primer LP, 1000 nM excess primer XP/mmXP, 500 nM blocker B5/Off62, 100 nM molecular beacon probes LTprb/On68, 1 unit of Platinium Taq DNA polymerase (Invitrogen, Carlsbad, CA), and different concentrations of DNA target variants in the range of 1 to 10,000 copies, as determined by serial dilutions. .. Amplification reactions were run in duplicates.

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Cells or muscles were lysed in TRIZOL reagent (Invitrogen), and total RNAs were isolated according to the manufacturer’s recommendations and loaded on eukaryote total RNA 6000 nano chips (Agilent) to verify quality. cDNAs were synthesized from 1 µg of total RNA using random hexamers and SuperScript III Reverse transcription (Invitrogen). .. Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization. .. Primers sequences were as follows: E4f1 : Fwd, 5′-CTCAAGGCCCACATGGTAA and Rev, 5′-CACACTTGGCACATTTGTAGG; Dlat: Fwd, 5′- TTGGCCTGTCTGAAAGTTCC and Rev, 5′-TTACCCTCTCTCGCTTTGGA; Dld : Fwd, 5′-TGGAGTCGTGTGTACCGCTCCTT and Rev, 5′-GGAACTGAAGAAACTCCTTGTAGGCCA; Slc25a19 : Fwd, 5′-TCAGTGTCAGGATTTGTCACCCGT and Rev, 5′- AGAATGCTCTTGGGCCTTCCTCTT; Brp44L : Fwd, 5′- TCCAGAGATTATCAGTGGGCGGAT and Rev, 5′-GCCAGTTTCGAGGTTGTACCTTGT; Pdpr : Fwd, 5′- GAACAAGAAACAGGGATCCAAAC and Rev, 5′-CTTGAGTTGATACGCTTCAGAGA; Pdha1 : Fwd, 5′- GCTGGTTGCTTCCCGTAAT and Rev, 5′-TAGTACTTGAGCCCATCCTCTC CS : Fwd, 5′- TCTACTCACTGCAGCAACC and Rev, 5′-TGGAAGAAGCACTGGCAT.

    Expressing:

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: mRNA expression was evaluated in tMEFs and muscles by RT-qPCR. .. Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization.

    Modification:

    Article Title: TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma
    Article Snippet: Primers used for GSTP1 , RASSF1 , RIZ1 , and hTERT analyses have been previously published [ - ]. .. PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France). .. A volume of 15 μl of PCR products was then digested with suitable restriction enzymes (Fermentas, Life Technologies, Illkirch, France, Additional file : Table S5).

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: DNA samples (100-500 ng), including positive controls for methylated and unmethylated status (EpiTect PCR control DNA ; Qiagen , Hilden, Germany), were modified by sodium bisulfite treatment, using the Epitect bisulfite Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. .. PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA).

    Article Title: Beyond the 3? end: experimental validation of extended transcript isoforms
    Article Snippet: cDNAs were prepared from 1 μg total RNAs with an equimolar pool of three modified poly(T) primers: 5′-TTCTAGAATTCAGCATTCGCTTCTTTTTTTTTTTTTTTTTA-3′, 5′-TTCTAGAATTCAGCATTCGCTTCTTTTTTTTTTTTTTTTTG-3′, 5′-TTCTAGAATTCAGCATTCGCTTCTTTTTTTTTTTTTTTTTC-3′ using the superscript II reverse transcriptase (Invitrogen). .. To validate transcripts with long distance between two poly(A) sites or long 3′ UTR, the Platinium Taq DNA polymerase (Invitrogen) was used and an annealing temperature between 55 and 62°C was chosen depending on the T m of the reverse primers.

    Sequencing:

    Article Title: EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco
    Article Snippet: Besides, PCR, purification, and sequencing techniques were used to detect punctual mutations in IDH1 and IDH2 genes. .. PCR was performed using Platinium® Taq DNA polymerase (Invitrogen).

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: Paragraph title: Amplification and sequencing ... HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ].

    Article Title: Kaempferol Suppresses Transforming Growth Factor-β1–Induced Epithelial-to-Mesenchymal Transition and Migration of A549 Lung Cancer Cells by Inhibiting Akt1-Mediated Phosphorylation of Smad3 at Threonine-179
    Article Snippet: The primer used for detection of Snail promoter sequence as follows: forward primer, 5ʹ-CGCTCCGTAAACACTGGATAA-3ʹ; reverse primer, 5ʹ-GAAGCGAGGAAAGGGACAC-3ʹ. .. The samples were amplified by conventional polymerase chain reaction (PCR) using the above Smad3 Snail promoter-specific forward and reverse primers and Platinium Taq DNA polymerase (Invitrogen).

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA). .. Initial denaturing for 3 min at 94°C was followed by 50 cycles, starting with a step at 94°C for 20 s. Different annealing temperatures were used according to the primers for 20 s , followed by a 30-45 s step at 72° C, with a final extension at 72° C for 7 min. Primers used for PCR and sequencing are listed in .

    Northern Blot:

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Paragraph title: RNA Isolation, Northern Blot and RT-PCR ... The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction.

    Article Title: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells
    Article Snippet: The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction. .. The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction.

    Infection:

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: Ninety six hours after infection, the GFP negative cell population was sorted using a FACSAria II cell sorter (Becton Dickinson) and treated with PMA. .. The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA.

    Generated:

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. The amplification conditions were: 94°C for 2 min, followed by 45 cycles at 94°C for 15 s, 55°C for 30 s, and 68°C for 2 min. PCR products were visualized by agarose gel electrophoresis and purified using the QIAquick 96 PCR Purification Kit from QIAGEN (QIAGEN, Valencia, CA, USA).

    DNA Sequencing:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Formaldehyde Crosses the Human Placenta and Affects Human Trophoblast Differentiation and Hormonal Functions
    Article Snippet: Trophoblasts were exposed to formaldehyde, Nac or both for 24 h, and total RNA was then extracted. .. RT-PCR was performed with the RT2 profiler PCR array (SABioscience) or with Superscript III reverse transcriptase followed by amplification with Platinium Taq polymerase (Life Technologies), according to the manufacturers' protocols and as previously described [ ]. .. The RT2 profiler PCR array contains an RT2 First Strand kit for RT assays and the RT2 SYBR Green/ROX qPCR Master mix.

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: Total nucleic acids were extracted from 100 μl of serum using an automated BioRobot MDx extraction platform using the QIAamp® Virus BioRobot® MDx Kit (QIAGEN, Valencia, CA, USA). .. HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. The amplification conditions were as follows: 53°C for 30 minutes (for reverse transcription) and 94°C for 2 minutes for Taq DNA polymerase activation, followed by 40 cycles at 94°C for 15 s, 55°C for 30 s, and 68°C for 4 min. Nested amplification was performed using the Expand™ High Fidelity PCR System kit (Roche Diagnostics, Indianapolis, USA) as described by the manufacturer.

    Article Title: NLS-tagging: an alternative strategy to tag nuclear proteins
    Article Snippet: Paragraph title: Quantitative reverse transcriptase-PCR (RT-PCR) ... Real-time PCR was performed using Platinium Taq Polymerase and SYBR green (Invitrogen) cDNA on a Bio-Rad CFX96 PCR System.

    Article Title: Beyond the 3? end: experimental validation of extended transcript isoforms
    Article Snippet: Paragraph title: RT-PCR ... To validate transcripts with long distance between two poly(A) sites or long 3′ UTR, the Platinium Taq DNA polymerase (Invitrogen) was used and an annealing temperature between 55 and 62°C was chosen depending on the T m of the reverse primers.

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Paragraph title: RNA Isolation, Northern Blot and RT-PCR ... The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction.

    Article Title: Cannabinoid receptor 1 signaling in embryo neurodevelopment
    Article Snippet: Paragraph title: 2.4. End point RT-PCR ... Instead, 2 units Platinium Taq DNA polymerase (Invitrogen) was added per 50 μl reaction volume.

    Cellular Antioxidant Activity Assay:

    Article Title: EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco
    Article Snippet: PCR primers were used as follows: IDH1 Forward primer 5′-AGA AGA GGG TTG AGG AGT TCA A-3′ with reverse primer 5′-CAC ATA CAA GTT GGA AAT TTC TGG-3′ and for IDH2 5′-TTG GCA GAC TCC AGA GCC CA-3′ with reverse primer 5′-GCC CGG TCT GCC ACA AAG TC-3′. .. PCR was performed using Platinium® Taq DNA polymerase (Invitrogen).

    DNA Extraction:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Genomic DNAs from HaCaT, TR146, HSC-3 and HSC-4 cells were isolated using the genomic DNA extraction kit (TianGen, Beijing, China), and then the purified genomic DNAs were bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's recommendations. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: For Alu-PCR, 2–5 ∙ 106 cells were subjected to genomic DNA isolation using DNeasy Blood & Tissue Kit (Qiagen, Hilden, The Netherlands). .. The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA.

    Combined Bisulfite Restriction Analysis Assay:

    Article Title: TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma
    Article Snippet: Paragraph title: Combined bisulfite restriction assay (COBRA) ... PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France).

    Methylation:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Genomic DNAs from HaCaT, TR146, HSC-3 and HSC-4 cells were isolated using the genomic DNA extraction kit (TianGen, Beijing, China), and then the purified genomic DNAs were bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's recommendations. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: Paragraph title: 4. Promoter methylation analysis by pyrosequencing ... PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA).

    Multiple Displacement Amplification:

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Total RNA was isolated from MDA-MB-231 cells using the TRIzol reagent from Life Technologies (Rockville, MA) as described by the manufacturer. .. The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction.

    Isolation:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Genomic DNAs from HaCaT, TR146, HSC-3 and HSC-4 cells were isolated using the genomic DNA extraction kit (TianGen, Beijing, China), and then the purified genomic DNAs were bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's recommendations. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: Genomic DNA was isolated using a standard phenol-chloroform extraction protocol. .. PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA).

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Paragraph title: RNA Isolation, Northern Blot and RT-PCR ... The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction.

    Article Title: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells
    Article Snippet: Total RNA was isolated with TRIzol reagent (Invitrogen) as described by the manufacturer. .. The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction.

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Cells or muscles were lysed in TRIZOL reagent (Invitrogen), and total RNAs were isolated according to the manufacturer’s recommendations and loaded on eukaryote total RNA 6000 nano chips (Agilent) to verify quality. cDNAs were synthesized from 1 µg of total RNA using random hexamers and SuperScript III Reverse transcription (Invitrogen). .. Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization.

    Negative Control:

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. The amplification conditions were: 1 cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2% agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Article Title: vacA s1m1 genotype and cagA EPIYA-ABC pattern are predominant among Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), in a final volume of 15 µl. .. The amplification conditions were: one cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2 % agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Size-exclusion Chromatography:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Purification:

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Genomic DNAs from HaCaT, TR146, HSC-3 and HSC-4 cells were isolated using the genomic DNA extraction kit (TianGen, Beijing, China), and then the purified genomic DNAs were bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's recommendations. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco
    Article Snippet: Besides, PCR, purification, and sequencing techniques were used to detect punctual mutations in IDH1 and IDH2 genes. .. PCR was performed using Platinium® Taq DNA polymerase (Invitrogen).

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ].

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Polymerase Chain Reaction:

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae
    Article Snippet: Primers were added to a final concentration of 0.5 μM and H2 O up to 25 μL. .. With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL. .. The PCR was set up with yeast cells picked from liquid culture in micro-plate or agar plate culture.

    Article Title: TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma
    Article Snippet: Primers used for GSTP1 , RASSF1 , RIZ1 , and hTERT analyses have been previously published [ - ]. .. PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France). .. A volume of 15 μl of PCR products was then digested with suitable restriction enzymes (Fermentas, Life Technologies, Illkirch, France, Additional file : Table S5).

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Bisulfite-treated unmethylated DNA from human peripheral blood (Promega) was used as control. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Primer pairs P-F1L/P-F1R, P-F2L/P-F2R and P-F3L/P-F3R were used to amplify CAMP-F1, CAMP-F2 and CAMP-F3 fragments in human CAMP promoter region, respectively (Table ).

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA − strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides (Table ), which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL. .. The amplification conditions were: 1 cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2% agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Article Title: EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco
    Article Snippet: PCR primers were used as follows: IDH1 Forward primer 5′-AGA AGA GGG TTG AGG AGT TCA A-3′ with reverse primer 5′-CAC ATA CAA GTT GGA AAT TTC TGG-3′ and for IDH2 5′-TTG GCA GAC TCC AGA GCC CA-3′ with reverse primer 5′-GCC CGG TCT GCC ACA AAG TC-3′. .. PCR was performed using Platinium® Taq DNA polymerase (Invitrogen). .. PCR conditions were 94°C for 5 minutes; 40 cycles of 94°C for 30 seconds, 60°C for 45 seconds, and 72°C for 1 minute; and extension at 72°C for 10 minutes.

    Article Title: vacA s1m1 genotype and cagA EPIYA-ABC pattern are predominant among Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA - strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides , which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), in a final volume of 15 µl. .. The amplification conditions were: one cycle at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 61 °C for 30 s and 72 °C for 45 s; and one final extension cycle at 72 °C for 7 min. PCR products were subjected to 2 % agarose gel electrophoresis, followed by ethidium bromide staining and UV light observation.

    Article Title: Formaldehyde Crosses the Human Placenta and Affects Human Trophoblast Differentiation and Hormonal Functions
    Article Snippet: Trophoblasts were exposed to formaldehyde, Nac or both for 24 h, and total RNA was then extracted. .. RT-PCR was performed with the RT2 profiler PCR array (SABioscience) or with Superscript III reverse transcriptase followed by amplification with Platinium Taq polymerase (Life Technologies), according to the manufacturers' protocols and as previously described [ ]. .. The RT2 profiler PCR array contains an RT2 First Strand kit for RT assays and the RT2 SYBR Green/ROX qPCR Master mix.

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ].

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Article Title: Kaempferol Suppresses Transforming Growth Factor-β1–Induced Epithelial-to-Mesenchymal Transition and Migration of A549 Lung Cancer Cells by Inhibiting Akt1-Mediated Phosphorylation of Smad3 at Threonine-179
    Article Snippet: The primer used for detection of Snail promoter sequence as follows: forward primer, 5ʹ-CGCTCCGTAAACACTGGATAA-3ʹ; reverse primer, 5ʹ-GAAGCGAGGAAAGGGACAC-3ʹ. .. The samples were amplified by conventional polymerase chain reaction (PCR) using the above Smad3 Snail promoter-specific forward and reverse primers and Platinium Taq DNA polymerase (Invitrogen). .. Total cellular RNA was extracted from cells using the phenol-guanidinium isothiocyanate method .

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: Bisulfite-modified DNA was then used as a template for PCR amplification. .. PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA). .. Initial denaturing for 3 min at 94°C was followed by 50 cycles, starting with a step at 94°C for 20 s. Different annealing temperatures were used according to the primers for 20 s , followed by a 30-45 s step at 72° C, with a final extension at 72° C for 7 min. Primers used for PCR and sequencing are listed in .

    Article Title: NLS-tagging: an alternative strategy to tag nuclear proteins
    Article Snippet: First-strand cDNA was synthesized using the SuperScript II First Strand Synthesis System (Invitrogen) and oligo-dT primers (Invitrogen). .. Real-time PCR was performed using Platinium Taq Polymerase and SYBR green (Invitrogen) cDNA on a Bio-Rad CFX96 PCR System. .. Ribonuclease/angiogenin 1 (Rnh1 ) was amplified in parallel for normalization purposes.

    Article Title: Beyond the 3? end: experimental validation of extended transcript isoforms
    Article Snippet: For individual poly(A) site validation, PCR was performed with the Phusion high fidelity PCR mix (Finnzymes) with an annealing temperature of 60°C and a 30 s extension at 72°C for all experiments. .. To validate transcripts with long distance between two poly(A) sites or long 3′ UTR, the Platinium Taq DNA polymerase (Invitrogen) was used and an annealing temperature between 55 and 62°C was chosen depending on the T m of the reverse primers.

    Article Title: ER? inhibits proliferation and invasion of breast cancer cells
    Article Snippet: Probes were amplified by RT-PCR using specific primers: Reverse transcription was performed using random primers and GenAmp (Roche, Basel, Switzerland) RT-PCR kit. .. The PCR was performed with Platinium Taq polymerase (Life Technologies) and 1:40 of reverse transcription reaction. .. A tenth of each PCR was electrophoresed on agarose gel.

    Article Title: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells
    Article Snippet: Reverse transcription was performed using random primers and Superscript II enzyme (Invitrogen). .. The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction. .. Cycles of 30 s at 94 °C, 1 min at 60 °C, and 1 min 30s at 72 °C were done 29 times (ERα, rS9, IL-8, CXCR2) or 35 times (ERβ).

    Article Title: Cannabinoid receptor 1 signaling in embryo neurodevelopment
    Article Snippet: The RT-PCR profile used was as follows: 1 cycle (50°C, 30 minutes) for cDNA synthesis, followed by 35 cycles of PCR amplification: denaturation (94°C, 15 seconds), annealing (55°C 30 seconds) and extention (72°C 30 seconds), followed by 1 cycle of 72°C for 5 minutes for extension. .. Instead, 2 units Platinium Taq DNA polymerase (Invitrogen) was added per 50 μl reaction volume.

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: For Alu-PCR, 2–5 ∙ 106 cells were subjected to genomic DNA isolation using DNeasy Blood & Tissue Kit (Qiagen, Hilden, The Netherlands). .. The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA. .. Amplification was performed in a T100 Thermal Cycler (BioRad) with following thermal program: 2 min at 95 °C, followed by 14 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 210 s. A nested PCR targeting the Gag gene was performed using the following reaction mix: 1 X PCR buffer, 1.5 mM MgCl2 , 0.5 mM dNTPs, 0.5 μM AluGag For and AluGag Rev. primers, 0.15 μM AluGag probe (FAM-AAAATTCGGTTAAGGCCAGGGGGAAAGAA-BHQ1), 1 U Platinium Taq polymerase and 3 ng of genomic DNA or 2 μl of Alu-Gag PCR product.

    Article Title: Kinetic Hairpin Oligonucleotide Blockers for Selective Amplification of Rare Mutations
    Article Snippet: All experiments were carried out in a Stratagene MX3005P PCR machine. .. LATE-PCR amplifications were performed using 25 μl reaction mixtures containing 1× PCR buffer (Invitrogen, Carlsbad, CA), 3 mM MgCl2, 200 nM dNTPs, 0.24× SYBR Green (Invitrogen, Carlsbad, CA), 50 nM limiting primer LP, 1000 nM excess primer XP/mmXP, 500 nM blocker B5/Off62, 100 nM molecular beacon probes LTprb/On68, 1 unit of Platinium Taq DNA polymerase (Invitrogen, Carlsbad, CA), and different concentrations of DNA target variants in the range of 1 to 10,000 copies, as determined by serial dilutions. .. Amplification reactions were run in duplicates.

    Staining:

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae
    Article Snippet: With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL. .. With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL.

    Article Title: TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma
    Article Snippet: PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France). .. PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France).

    Article Title: Cannabinoid receptor 1 signaling in embryo neurodevelopment
    Article Snippet: Instead, 2 units Platinium Taq DNA polymerase (Invitrogen) was added per 50 μl reaction volume. .. Instead, 2 units Platinium Taq DNA polymerase (Invitrogen) was added per 50 μl reaction volume.

    Chromatin Immunoprecipitation:

    Article Title: Kaempferol Suppresses Transforming Growth Factor-β1–Induced Epithelial-to-Mesenchymal Transition and Migration of A549 Lung Cancer Cells by Inhibiting Akt1-Mediated Phosphorylation of Smad3 at Threonine-179
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation (ChIP) Assay ... The samples were amplified by conventional polymerase chain reaction (PCR) using the above Smad3 Snail promoter-specific forward and reverse primers and Platinium Taq DNA polymerase (Invitrogen).

    Plasmid Preparation:

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Software:

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Methyl Primer Express® Software v1.0 (Applied Biosystems Life technologies) was used to design primers for amplification of bisulfite treated DNA. .. Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA). .. Initial denaturing for 3 min at 94°C was followed by 50 cycles, starting with a step at 94°C for 20 s. Different annealing temperatures were used according to the primers for 20 s , followed by a 30-45 s step at 72° C, with a final extension at 72° C for 7 min. Primers used for PCR and sequencing are listed in .

    Real-time Polymerase Chain Reaction:

    Article Title: NLS-tagging: an alternative strategy to tag nuclear proteins
    Article Snippet: First-strand cDNA was synthesized using the SuperScript II First Strand Synthesis System (Invitrogen) and oligo-dT primers (Invitrogen). .. Real-time PCR was performed using Platinium Taq Polymerase and SYBR green (Invitrogen) cDNA on a Bio-Rad CFX96 PCR System. .. Ribonuclease/angiogenin 1 (Rnh1 ) was amplified in parallel for normalization purposes.

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA. .. Amplification was performed in a T100 Thermal Cycler (BioRad) with following thermal program: 2 min at 95 °C, followed by 14 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 210 s. A nested PCR targeting the Gag gene was performed using the following reaction mix: 1 X PCR buffer, 1.5 mM MgCl2 , 0.5 mM dNTPs, 0.5 μM AluGag For and AluGag Rev. primers, 0.15 μM AluGag probe (FAM-AAAATTCGGTTAAGGCCAGGGGGAAAGAA-BHQ1), 1 U Platinium Taq polymerase and 3 ng of genomic DNA or 2 μl of Alu-Gag PCR product.

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Cells or muscles were lysed in TRIZOL reagent (Invitrogen), and total RNAs were isolated according to the manufacturer’s recommendations and loaded on eukaryote total RNA 6000 nano chips (Agilent) to verify quality. cDNAs were synthesized from 1 µg of total RNA using random hexamers and SuperScript III Reverse transcription (Invitrogen). .. Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization. .. Primers sequences were as follows: E4f1 : Fwd, 5′-CTCAAGGCCCACATGGTAA and Rev, 5′-CACACTTGGCACATTTGTAGG; Dlat: Fwd, 5′- TTGGCCTGTCTGAAAGTTCC and Rev, 5′-TTACCCTCTCTCGCTTTGGA; Dld : Fwd, 5′-TGGAGTCGTGTGTACCGCTCCTT and Rev, 5′-GGAACTGAAGAAACTCCTTGTAGGCCA; Slc25a19 : Fwd, 5′-TCAGTGTCAGGATTTGTCACCCGT and Rev, 5′- AGAATGCTCTTGGGCCTTCCTCTT; Brp44L : Fwd, 5′- TCCAGAGATTATCAGTGGGCGGAT and Rev, 5′-GCCAGTTTCGAGGTTGTACCTTGT; Pdpr : Fwd, 5′- GAACAAGAAACAGGGATCCAAAC and Rev, 5′-CTTGAGTTGATACGCTTCAGAGA; Pdha1 : Fwd, 5′- GCTGGTTGCTTCCCGTAAT and Rev, 5′-TAGTACTTGAGCCCATCCTCTC CS : Fwd, 5′- TCTACTCACTGCAGCAACC and Rev, 5′-TGGAAGAAGCACTGGCAT.

    RNA Extraction:

    Article Title: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells
    Article Snippet: Paragraph title: RNA Extraction and Reverse Transcriptase PCR ... The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction.

    Article Title: E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity
    Article Snippet: Paragraph title: RNA Extraction and RT-qPCR. ... Real-time qPCR was performed on a LightCycler 480SW 1.5 apparatus (Roche) with Platinium Taq DNA polymerase (Invitrogen) and an SYBR Green mix containing 3 mM MgCl2 , and dNTPs 30 µM each; 45 cycles of 95 °C for 4 s, 65 °C for 10 s, and 72 °C for 30 s. Rpl13a transcripts were used for normalization.

    Agarose Gel Electrophoresis:

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae
    Article Snippet: With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL. .. With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL.

    Article Title: DNA methylation directly downregulates human cathelicidin antimicrobial peptide gene (CAMP) promoter activity
    Article Snippet: Platinium Taq polymerase (Life technologies) was used for PCR amplification. .. Platinium Taq polymerase (Life technologies) was used for PCR amplification.

    Article Title: HIV-1 envelope sequence-based diversity measures for identifying recent infections
    Article Snippet: HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ]. .. HIV-1 RNA was amplified using the Superscript III One-Step RT-PCR system with Platinium® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and the primers env-up forward (5’-GTTTCTTTTAGGCATCTCCTATGGCAGGAAGAAG-3’, HXB2 positions 5957–5983) and env-lo reverse (5’-GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG-3’, HXB2 positions 9063–9088) [ ].

    Article Title: IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells
    Article Snippet: The PCR was performed with Platinium Taq polymerase (Invitrogen) and 1:40 of reverse transcription reaction. .. Cycles of 30 s at 94 °C, 1 min at 60 °C, and 1 min 30s at 72 °C were done 29 times (ERα, rS9, IL-8, CXCR2) or 35 times (ERβ).

    Electron Paramagnetic Resonance:

    Article Title: CagL polymorphisms D58/K59 are predominant in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA − strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides (Table ), which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, USA), in a final volume of 15 μL.

    Article Title: vacA s1m1 genotype and cagA EPIYA-ABC pattern are predominant among Helicobacter pylori strains isolated from Mexican patients with chronic gastritis
    Article Snippet: The absence of cagA and the pathogenicity island cag PAI in the cagA - strains was confirmed by the empty-site assay by conventional PCR, using the ESf and ESr oligonucleotides , which bind upstream and downstream, respectively, of the region where the cag PAI is inserted in the genome of the reference strain NCTC 12455 (NCTC: National Collection of Type Culture) [ ]. .. The PCR mixture contained 50 ng of DNA, 0.08 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 mM MgCl2 , 5 pmol of each oligonucleotide and 1 U of Platinium Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), in a final volume of 15 µl.

    Pyromark Assay:

    Article Title: Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas
    Article Snippet: PCR was carried out as follows: 1X PCR buffer, 200 μM of each dNTP, 1.5 to 2.5 mM MgCl2 , 10-50 ng DNA, 200 nM of each primer, and 2 units Platinium Taq Polymerase (Invitrogen, CA). .. Initial denaturing for 3 min at 94°C was followed by 50 cycles, starting with a step at 94°C for 20 s. Different annealing temperatures were used according to the primers for 20 s , followed by a 30-45 s step at 72° C, with a final extension at 72° C for 7 min. Primers used for PCR and sequencing are listed in .

    DNA Methylation Assay:

    Article Title: Methylation-dependent and independent regulatory regions in the Na,K-ATPase alpha4 gene (Atp1a4) may impact its testis-specific expression
    Article Snippet: Paragraph title: 2.1. DNA methylation analysis using bisulfite sequencing ... Platinium Taq DNA polymerase (Life technologies) with high fidelity was used to amply DNA fragments containing Mα4-CGI and the Mα4-Promoter region.

    Concentration Assay:

    Article Title: PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae
    Article Snippet: Primers were added to a final concentration of 0.5 μM and H2 O up to 25 μL. .. With the Platinium Taq DNA polymerase (Invitrogen), the PCR mix was performed with final concentrations of: 1x manufacturer-supplied buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.3 mM primers, 2.4% DMSO, 0.5 U of the Hot Start enzyme, H2 O to 20 μL.

    Restriction Assay:

    Article Title: TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma
    Article Snippet: Paragraph title: Combined bisulfite restriction assay (COBRA) ... PCR reactions were performed as described in MSP method with modification of Taq DNA polymerase using Platinium® Taq DNA Polymerase (Life Technologies, Illkirch, France).

    FACS:

    Article Title: Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal
    Article Snippet: Percentage of GFP positive (latent) infections was determined by FACS analysis 48 h after PMA stimulation. .. The following reaction mix was used for the first round PCR: 1X PCR buffer (Life Technologies), 1.5 mM MgCl2 (Life Technologies), 0.5 mM dNTPs (Thermo Scientific, Waltham, MA USA) 1 μM Alu forward primer, 6 μM Gag reverse primer, 2.5 U of Platinium Taq polymerase (Life Technologies) and 150 ng of genomic DNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher superscript iii rt pcr platinum taq high fidelity kit
    ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all <t>three</t> of the cell populations were subjected to <t>RT-PCR</t> to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).
    Superscript Iii Rt Pcr Platinum Taq High Fidelity Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii rt pcr platinum taq high fidelity kit/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii rt pcr platinum taq high fidelity kit - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher platinum taq dna polymerase high fidelity
    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by <t>DNA</t> sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the <t>Taq</t> DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.
    Platinum Taq Dna Polymerase High Fidelity, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq dna polymerase high fidelity/product/Thermo Fisher
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    platinum taq dna polymerase high fidelity - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher one step rt pcr
    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by <t>DNA</t> sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the <t>Taq</t> DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.
    One Step Rt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr/product/Thermo Fisher
    Average 95 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    Image Search Results


    ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all three of the cell populations were subjected to RT-PCR to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).

    Journal:

    Article Title: Transposon Mutagenesis of the Zika Virus Genome Highlights Regions Essential for RNA Replication and Restricted for Immune Evasion

    doi: 10.1128/JVI.00698-17

    Figure Lengend Snippet: ZIKV insertional mutant library screening protocol and deep sequencing results. (A) Representative images of individual mutants from the library of ZIKV cDNA clones (blue), each bearing a single 15-nucleotide insertion, represented by a colored line (not drawn to scale). (B) 293T cells were transfected with the mutant plasmid library to select for mutant genomes that could initiate RNA replication and virus release. (C) Forty-eight hours after transfection, the supernatant was collected and passaged on Vero cells to select mutants that retained the ability to spread. (D) At 48 h postinfection, the supernatant was passaged once more on Vero cells to select for the fittest mutants. At the time of supernatant collection, RNAs from all three of the cell populations were subjected to RT-PCR to amplify the viral genomes. The subsequent RT-PCR products were then deep sequenced. (E) Raw number of deep sequence reads with inserts at each location for the input plasmid library. The ZIKV genome schematic and bars in the graph show structural genes in red, nonstructural genes in blue, UTRs in black, and the intron used to stabilize the plasmid in bacteria in yellow. This intron was not present in the rescued viruses. Alternating gray and white shading within each graph differentiates the genomic regions. (F to H) Frequencies of insertions at each location following normalization to the representation in the input library after plasmid DNA transfection (F), infected cell passage 1 (G), and infected cell passage 2 (H), with a schematic of the genome shown below. Numbering along the x axis indicates the nucleotide position in the ZIKV genome, while the y axis gives the log raw number of reads (E) or the log fold change over input (F to H), with horizontal dotted lines representing the cutoff of the mutants enriched two standard deviations above the average. Values are averages for three independent screens (see Materials and Methods for details).

    Article Snippet: The viral RNA was then amplified in three segments by utilizing a SuperScript III RT-PCR Platinum Taq High Fidelity kit (Thermo Fisher Scientific).

    Techniques: Mutagenesis, Library Screening, Sequencing, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Infection

    Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of the Lra I cleavage site 5′-G/AATTC-3′ of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt SK+ predigested with Lra I restriction enzyme and (b) with Eco RI obtained using M13R primer. The colour-coded sequence traces are A (green), T (red), C (blue), and G (black). The extra A base was added at the end of the cleaved template by the Taq DNA polymerase used for sequencing due to template-independent terminal nucleotide transferase activity of Taq DNA polymerase.

    Article Snippet: Platinum™ Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) was used to amplify DNA fragments by PCR in GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA).

    Techniques: DNA Sequencing, Sequencing, Activity Assay