plasmid dna  (Stratagene)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Stratagene plasmid dna
    <t>HAVCR1</t> expression in transfected HEK-293 cells. A . Expression of HAVCR1 in ACHN, HEK-293, and HEK-293 cells transfected with plasmid <t>DNA</t> expressing HAVCR1a from ACHN cells was detected by a cell-surface ELISA [43] . Representative results are presented as the mean and standard deviation of triplicate samples. The asterisk denotes results that are significantly less than the signal from toxin-sensitive ACHN cells (p
    Plasmid Dna, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna/product/Stratagene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid dna - by Bioz Stars, 2021-03
    86/100 stars

    Images

    1) Product Images from "Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin"

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0017787

    HAVCR1 expression in transfected HEK-293 cells. A . Expression of HAVCR1 in ACHN, HEK-293, and HEK-293 cells transfected with plasmid DNA expressing HAVCR1a from ACHN cells was detected by a cell-surface ELISA [43] . Representative results are presented as the mean and standard deviation of triplicate samples. The asterisk denotes results that are significantly less than the signal from toxin-sensitive ACHN cells (p
    Figure Legend Snippet: HAVCR1 expression in transfected HEK-293 cells. A . Expression of HAVCR1 in ACHN, HEK-293, and HEK-293 cells transfected with plasmid DNA expressing HAVCR1a from ACHN cells was detected by a cell-surface ELISA [43] . Representative results are presented as the mean and standard deviation of triplicate samples. The asterisk denotes results that are significantly less than the signal from toxin-sensitive ACHN cells (p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Standard Deviation

    2) Product Images from "Identification of a novel vertebrate circadian clock-regulated gene encoding the protein nocturnin"

    Article Title: Identification of a novel vertebrate circadian clock-regulated gene encoding the protein nocturnin

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    ( A ) Deduced amino acid sequence of nocturnin. Single letter amino acid abbreviations are used. The asterisk (∗) indicates the position of the stop codon. The leucine zipper motif is underlined, with leucines in bold type. ( B ) Nocturnin gene structure. The horizontal line represents the genomic DNA. The boxes indicate the relative size and position of the exons. The vertical lines represent restriction endonuclease cleavage sites: X, Xba I; E, Eco RI; S, Sac I. ▪, the coding portions of the gene; ▨, the 3′-untranslated regions common to both mRNAs, and , the 3′-untranslated sequence specific to the larger message. The compositions of the two resulting nocturnin mRNAs are diagrammed.
    Figure Legend Snippet: ( A ) Deduced amino acid sequence of nocturnin. Single letter amino acid abbreviations are used. The asterisk (∗) indicates the position of the stop codon. The leucine zipper motif is underlined, with leucines in bold type. ( B ) Nocturnin gene structure. The horizontal line represents the genomic DNA. The boxes indicate the relative size and position of the exons. The vertical lines represent restriction endonuclease cleavage sites: X, Xba I; E, Eco RI; S, Sac I. ▪, the coding portions of the gene; ▨, the 3′-untranslated regions common to both mRNAs, and , the 3′-untranslated sequence specific to the larger message. The compositions of the two resulting nocturnin mRNAs are diagrammed.

    Techniques Used: Sequencing

    3) Product Images from "Cytoplasmic Filament-Deficient Mutant of Treponema denticola Has Pleiotropic Defects"

    Article Title: Cytoplasmic Filament-Deficient Mutant of Treponema denticola Has Pleiotropic Defects

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.183.3.1078-1084.2001

    Chromosomal DNA visualization and localization with Hoechst 33342 dye. (A) Dark-field microscopy of wild-type T. denticola and (B) the corresponding image by fluorescence. (C) Group of wild-type T. denticola cells showing a similar uniform DNA distribution. (D) Dark-field microscopy of T. denticola CfpA-deficient cells and (E) corresponding image by fluorescence. Arrows indicate condensed DNA areas. (F) T. denticola CfpA-deficient mutant cells, showing a typical pattern of distribution. Arrows indicate condensed DNA areas. Bars, 10 μm.
    Figure Legend Snippet: Chromosomal DNA visualization and localization with Hoechst 33342 dye. (A) Dark-field microscopy of wild-type T. denticola and (B) the corresponding image by fluorescence. (C) Group of wild-type T. denticola cells showing a similar uniform DNA distribution. (D) Dark-field microscopy of T. denticola CfpA-deficient cells and (E) corresponding image by fluorescence. Arrows indicate condensed DNA areas. (F) T. denticola CfpA-deficient mutant cells, showing a typical pattern of distribution. Arrows indicate condensed DNA areas. Bars, 10 μm.

    Techniques Used: Microscopy, Fluorescence, Mutagenesis

    4) Product Images from "Two Genetic Determinants Acquired Late in Mus Evolution Regulate the Inclusion of Exon 5, which Alters Mouse APOBEC3 Translation Efficiency"

    Article Title: Two Genetic Determinants Acquired Late in Mus Evolution Regulate the Inclusion of Exon 5, which Alters Mouse APOBEC3 Translation Efficiency

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002478

    The presence of exon 5 does not affect protein degradation but exhibits a profound impact on mA3 protein synthesis. (A) 293T cells were transfected with pFLAG-CMV2- mA3 d or pFLAG-CMV2- mA3 d Δ5 along with pFLAG-CMV2-GFP, which expresses green fluorescent protein (GFP) as a loading control. The cells were treated with cycloheximide for the indicated duration to stop protein synthesis and then harvested. DMSO was used as a solvent control. The FLAG-tagged mA3 and GFP were detected with the anti-FLAG antibody in immunoblotting. Endogenous IκBα expression was used as a positive control to confirm the effect of cycloheximide. (B) In vitro transcription and translation assays. DNA templates containing the entire coding region of the BALB/c full-length or Δ5 mA3 cDNA with the T7 promoter and His-tag sequence were subjected to an in vitro transcription/translation reaction by incubating for 30 or 60 min. The levels of mA3 protein synthesis and mRNA expression were evaluated by immunoblotting using the anti-His antibody and RT-PCR using the primer set a-b, respectively. Intensities of protein bands on the immunoblot membrane and DNA bands after the RT-PCR reaction and electrophoresis were measured by densitometry and are shown below each corresponding band. *, signals below detection limits.
    Figure Legend Snippet: The presence of exon 5 does not affect protein degradation but exhibits a profound impact on mA3 protein synthesis. (A) 293T cells were transfected with pFLAG-CMV2- mA3 d or pFLAG-CMV2- mA3 d Δ5 along with pFLAG-CMV2-GFP, which expresses green fluorescent protein (GFP) as a loading control. The cells were treated with cycloheximide for the indicated duration to stop protein synthesis and then harvested. DMSO was used as a solvent control. The FLAG-tagged mA3 and GFP were detected with the anti-FLAG antibody in immunoblotting. Endogenous IκBα expression was used as a positive control to confirm the effect of cycloheximide. (B) In vitro transcription and translation assays. DNA templates containing the entire coding region of the BALB/c full-length or Δ5 mA3 cDNA with the T7 promoter and His-tag sequence were subjected to an in vitro transcription/translation reaction by incubating for 30 or 60 min. The levels of mA3 protein synthesis and mRNA expression were evaluated by immunoblotting using the anti-His antibody and RT-PCR using the primer set a-b, respectively. Intensities of protein bands on the immunoblot membrane and DNA bands after the RT-PCR reaction and electrophoresis were measured by densitometry and are shown below each corresponding band. *, signals below detection limits.

    Techniques Used: Transfection, Expressing, Positive Control, In Vitro, Sequencing, Reverse Transcription Polymerase Chain Reaction, Electrophoresis

    Protein expression of the full-length and Δ5 mA3 in transiently transfected 293T cells. (A) Exon 5-containing (5+) and Δ5 mA3 cDNA were tagged with the FLAG epitope and inserted into the expression vector. The arrows indicate the positions of the PCR primers. The primer set a-b is the same as shown in Figure 1 . (B and C) 293T cells were transfected with pFLAG-CMV2- mA3 d or pFLAG-CMV2- mA3 d Δ5 in B or with pFLAG-CMV2- mA3 b or pFLAG-CMV2- mA3 b Δ5 in C, which express either the 5+ or Δ5 mA3 cDNA cloned from BALB/c or B6 mice, respectively [27] . A luciferase-expressing plasmid, p luc , was co-transfected to standardize transfection efficiencies. At 24 hours after transfection, each one-third of the transfected cells was used for immunoblotting, RNA extraction, and luciferase assays. For immunoblotting, the full-length and Δ5 mA3 proteins were detected with the anti-FLAG antibody. Quantitative real-time PCR reactions were carried out with primer set a-b and were normalized with the levels of actin transcripts expressed in 293T cells. Data shown are averages of three reaction wells and SD. (D) RT-PCR assays were performed with (RT+) or without (RT−) reverse transcription to demonstrate specific detection of expected mRNA. Both primer sets e-f and a-b were used to detect mA3 mRNA. NC, negative control transfected with the empty vector, pFLAG-CMV2. RT– samples were included to evaluate the possible contamination of transfected DNA. Specific amplification of cDNA generated in the presence of RT was observed in the cells transfected with a plasmid expressing the 5+ or Δ5 mA3 cDNA. Similar results were obtained for the corresponding B6-derived cDNA clones.
    Figure Legend Snippet: Protein expression of the full-length and Δ5 mA3 in transiently transfected 293T cells. (A) Exon 5-containing (5+) and Δ5 mA3 cDNA were tagged with the FLAG epitope and inserted into the expression vector. The arrows indicate the positions of the PCR primers. The primer set a-b is the same as shown in Figure 1 . (B and C) 293T cells were transfected with pFLAG-CMV2- mA3 d or pFLAG-CMV2- mA3 d Δ5 in B or with pFLAG-CMV2- mA3 b or pFLAG-CMV2- mA3 b Δ5 in C, which express either the 5+ or Δ5 mA3 cDNA cloned from BALB/c or B6 mice, respectively [27] . A luciferase-expressing plasmid, p luc , was co-transfected to standardize transfection efficiencies. At 24 hours after transfection, each one-third of the transfected cells was used for immunoblotting, RNA extraction, and luciferase assays. For immunoblotting, the full-length and Δ5 mA3 proteins were detected with the anti-FLAG antibody. Quantitative real-time PCR reactions were carried out with primer set a-b and were normalized with the levels of actin transcripts expressed in 293T cells. Data shown are averages of three reaction wells and SD. (D) RT-PCR assays were performed with (RT+) or without (RT−) reverse transcription to demonstrate specific detection of expected mRNA. Both primer sets e-f and a-b were used to detect mA3 mRNA. NC, negative control transfected with the empty vector, pFLAG-CMV2. RT– samples were included to evaluate the possible contamination of transfected DNA. Specific amplification of cDNA generated in the presence of RT was observed in the cells transfected with a plasmid expressing the 5+ or Δ5 mA3 cDNA. Similar results were obtained for the corresponding B6-derived cDNA clones.

    Techniques Used: Expressing, Transfection, FLAG-tag, Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Mouse Assay, Luciferase, RNA Extraction, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Negative Control, Amplification, Generated, Derivative Assay

    The effect of exon 5 and its downstream sequences on mA3 intron 5 splicing. (A) Distributions of sequence polymorphisms in the intron 5 of the Apobec3 gene locus between the B6 allele [NT_039621] and the Celera database sequence of mixed mouse DNA [NW_001030577.1]. Shorter horizontal lines below the thick one representing intron 5 indicate regions of sequenced BALB/c genome [DDBJ accession No. AB646261-AB646265], which show nucleotide sequences identical to corresponding Celera database sequences. Spans of the analyzed regions are 1–620, 661–1597, 1643–2058, 2759–3443, and 5558–6247 in base numbers starting from the first nucleotide of intron 5. SNP are shown with vertical lines, single-base indels with arrows, and deletions of ≥2 bases with triangles. Indels and deletions above the thick horizontal line that represents intron 5 are deletions in the B6 allele relative to the Celera sequence, while those underneath the horizontal line are deletions in the Celera sequence relative to the B6 allele sequence. (B) Plasmid constructions for the splicing assays. The exon 5–6 plasmids harbored either the B6 or BALB/c genomic fragment encompassing exons 5 and 6, including the entire intron 5 of the corresponding allele. Each of the remaining plasmids possessed a sequentially reduced length of the intron 5 as indicated. The precise size of each PCR-generated 5′ fragment included was as follows: 3177bp and 3185bp for B6 and BALB/c intron 5-Δ3′; 2106bp and 2086bp for B6 and BALB/c 200bp intron 5; 1120bp and 1110bp for B6 and BALB/c 1100bp intron 5; and 634bp and 620bp for B6 and BALB/c 600bp intron 5, respectively. The primers g–h are the same as shown in Figure 4 . (C) RT-PCR detection of spliced messages expressed from the B6 and BALB/c exon 5–6 plasmids along with those from the exon 4–7 plasmids as controls. Primers g and h were used. A lack of expression of the spliced message in cells transfected with the B6 exon 5–6 plasmid was evident. (D and F) Splicing assays using intron 5 deletion plasmids. The intron 5 fragment included in each plasmid is shown in (B). RT-PCR assays were performed with primers g and h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies among the samples as shown in (C). Comparable levels of luciferase activities were observed in all samples in each experiment (data not shown). Quantitative real-time PCR data show averages of three reaction wells and SD. (E) Reciprocal chimeras were produced between B6 and BALB/c exon 5–6 by exchanging the cloned genomic DNA fragment at position 1100 within intron 5. The exact location of the above position 1100 for B6 and BALB/c intron 5 is described in the legend for (B). RT-PCR detection of spliced messages was performed with primers g and h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies.
    Figure Legend Snippet: The effect of exon 5 and its downstream sequences on mA3 intron 5 splicing. (A) Distributions of sequence polymorphisms in the intron 5 of the Apobec3 gene locus between the B6 allele [NT_039621] and the Celera database sequence of mixed mouse DNA [NW_001030577.1]. Shorter horizontal lines below the thick one representing intron 5 indicate regions of sequenced BALB/c genome [DDBJ accession No. AB646261-AB646265], which show nucleotide sequences identical to corresponding Celera database sequences. Spans of the analyzed regions are 1–620, 661–1597, 1643–2058, 2759–3443, and 5558–6247 in base numbers starting from the first nucleotide of intron 5. SNP are shown with vertical lines, single-base indels with arrows, and deletions of ≥2 bases with triangles. Indels and deletions above the thick horizontal line that represents intron 5 are deletions in the B6 allele relative to the Celera sequence, while those underneath the horizontal line are deletions in the Celera sequence relative to the B6 allele sequence. (B) Plasmid constructions for the splicing assays. The exon 5–6 plasmids harbored either the B6 or BALB/c genomic fragment encompassing exons 5 and 6, including the entire intron 5 of the corresponding allele. Each of the remaining plasmids possessed a sequentially reduced length of the intron 5 as indicated. The precise size of each PCR-generated 5′ fragment included was as follows: 3177bp and 3185bp for B6 and BALB/c intron 5-Δ3′; 2106bp and 2086bp for B6 and BALB/c 200bp intron 5; 1120bp and 1110bp for B6 and BALB/c 1100bp intron 5; and 634bp and 620bp for B6 and BALB/c 600bp intron 5, respectively. The primers g–h are the same as shown in Figure 4 . (C) RT-PCR detection of spliced messages expressed from the B6 and BALB/c exon 5–6 plasmids along with those from the exon 4–7 plasmids as controls. Primers g and h were used. A lack of expression of the spliced message in cells transfected with the B6 exon 5–6 plasmid was evident. (D and F) Splicing assays using intron 5 deletion plasmids. The intron 5 fragment included in each plasmid is shown in (B). RT-PCR assays were performed with primers g and h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies among the samples as shown in (C). Comparable levels of luciferase activities were observed in all samples in each experiment (data not shown). Quantitative real-time PCR data show averages of three reaction wells and SD. (E) Reciprocal chimeras were produced between B6 and BALB/c exon 5–6 by exchanging the cloned genomic DNA fragment at position 1100 within intron 5. The exact location of the above position 1100 for B6 and BALB/c intron 5 is described in the legend for (B). RT-PCR detection of spliced messages was performed with primers g and h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies.

    Techniques Used: Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Generated, Reverse Transcription Polymerase Chain Reaction, Expressing, Transfection, Luciferase, Real-time Polymerase Chain Reaction, Produced, Clone Assay

    The impact of TCCT repeat numbers on exon 5 inclusion in mA3 mRNA splicing. (A) Schematic representation of the genomic DNA structure of the Apobec3 gene locus. Boxes indicate exons. LTR, the endogenous retroviral LTR inserted into intron 2 in some strains of mice [37] . (B) Insert structures of the plasmids used for the splicing assays. BALB/c exon 4–7 and BALB/c ΔTCCT plasmids harbored the same DNA fragment amplified from BALB/c genomic DNA encompassing exons 4 and 7, except that the BALB/c ΔTCCT contains only a single TCCT quadruplet. B6 exon 4–7 plasmid harbored the B6 genomic DNA fragment encompassing exons 4 and 7. C741T and T741C indicate a C to T or reciprocal nucleotide substitution, respectively, within intron 4 at 741-bp downstream from the first nucleotide of exon 4 on the backbone of the BALB/c or B6 exon 4–7 insert. An additional repeat of the TCCT quadruplet was added to the B6 exon 4–6 construct to generate B6 +TCCT. The positions of primers g, h, i, and j used for RT-PCR assays are indicated with the arrows. (C) The plasmid harboring each insert depicted in (B) was transfected into BALB/3T3 cells, total RNA was extracted, and RT-PCR reactions were performed with primer pairs g–h and i–h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies among the samples. Comparable levels of luciferase activities were observed in all samples in each experiment (data not shown). The predicted splicing products are schematically indicated on the right side of the panel. Quantitative real-time PCR assays were performed with primers g and j, and data are shown here by averages of three reaction wells and SD.
    Figure Legend Snippet: The impact of TCCT repeat numbers on exon 5 inclusion in mA3 mRNA splicing. (A) Schematic representation of the genomic DNA structure of the Apobec3 gene locus. Boxes indicate exons. LTR, the endogenous retroviral LTR inserted into intron 2 in some strains of mice [37] . (B) Insert structures of the plasmids used for the splicing assays. BALB/c exon 4–7 and BALB/c ΔTCCT plasmids harbored the same DNA fragment amplified from BALB/c genomic DNA encompassing exons 4 and 7, except that the BALB/c ΔTCCT contains only a single TCCT quadruplet. B6 exon 4–7 plasmid harbored the B6 genomic DNA fragment encompassing exons 4 and 7. C741T and T741C indicate a C to T or reciprocal nucleotide substitution, respectively, within intron 4 at 741-bp downstream from the first nucleotide of exon 4 on the backbone of the BALB/c or B6 exon 4–7 insert. An additional repeat of the TCCT quadruplet was added to the B6 exon 4–6 construct to generate B6 +TCCT. The positions of primers g, h, i, and j used for RT-PCR assays are indicated with the arrows. (C) The plasmid harboring each insert depicted in (B) was transfected into BALB/3T3 cells, total RNA was extracted, and RT-PCR reactions were performed with primer pairs g–h and i–h. A portion of the transfected cells were utilized for luciferase assays to compare transfection efficiencies among the samples. Comparable levels of luciferase activities were observed in all samples in each experiment (data not shown). The predicted splicing products are schematically indicated on the right side of the panel. Quantitative real-time PCR assays were performed with primers g and j, and data are shown here by averages of three reaction wells and SD.

    Techniques Used: Mouse Assay, Amplification, Plasmid Preparation, Construct, Reverse Transcription Polymerase Chain Reaction, Transfection, Luciferase, Real-time Polymerase Chain Reaction

    5) Product Images from "FGFR1 inhibits skeletal muscle atrophy associated with hindlimb suspension"

    Article Title: FGFR1 inhibits skeletal muscle atrophy associated with hindlimb suspension

    Journal: BMC Musculoskeletal Disorders

    doi: 10.1186/1471-2474-8-32

    Downstream detection of activated FGF signaling . Activity of mouse osteocalcin gene 2 promoter (mOG2)-luciferase reporter gene in gastrocnemius and soleus muscles of mice transfected with either control (control) or FGFR1 expression plasmid DNA (FGFR1). Data are expressed as luciferase dependent light units normalized to renilla luciferase dependent light units (mOG2/Fl). Means (±SEM) bearing different letters differ significantly ( P
    Figure Legend Snippet: Downstream detection of activated FGF signaling . Activity of mouse osteocalcin gene 2 promoter (mOG2)-luciferase reporter gene in gastrocnemius and soleus muscles of mice transfected with either control (control) or FGFR1 expression plasmid DNA (FGFR1). Data are expressed as luciferase dependent light units normalized to renilla luciferase dependent light units (mOG2/Fl). Means (±SEM) bearing different letters differ significantly ( P

    Techniques Used: Activity Assay, Luciferase, Mouse Assay, Transfection, Expressing, Plasmid Preparation

    6) Product Images from "Valine 738 and lysine 735 in the fifth transmembrane domain of rTas1r3 mediate insensitivity towards lactisole of the rat sweet taste receptor"

    Article Title: Valine 738 and lysine 735 in the fifth transmembrane domain of rTas1r3 mediate insensitivity towards lactisole of the rat sweet taste receptor

    Journal: BMC Neuroscience

    doi: 10.1186/1471-2202-6-22

    Expression of receptor variants. The table shows the overall expression in % of all receptor constructs detected by immuncytochemistry (a), transmission and fluorescence pictures of HEK293T/ G α16gust44 cells transfected with rTas1r3 (b), rTas1r3-V738A (c) or rTas1r3 m6/3 (d) DNA. Scale, 50 μm.
    Figure Legend Snippet: Expression of receptor variants. The table shows the overall expression in % of all receptor constructs detected by immuncytochemistry (a), transmission and fluorescence pictures of HEK293T/ G α16gust44 cells transfected with rTas1r3 (b), rTas1r3-V738A (c) or rTas1r3 m6/3 (d) DNA. Scale, 50 μm.

    Techniques Used: Expressing, Construct, Transmission Assay, Fluorescence, Transfection

    7) Product Images from "CGRP Stimulation of iNOS and NO Release from Trigeminal Ganglion Glial Cells Involves MAP Kinase Pathways"

    Article Title: CGRP Stimulation of iNOS and NO Release from Trigeminal Ganglion Glial Cells Involves MAP Kinase Pathways

    Journal: Journal of neurochemistry

    doi: 10.1111/j.1471-4159.2009.06154.x

    Effects of MAP kinase over-expression on the regulation of NO release from trigeminal glial cells. NO levels were determined by the Griess reaction in media collected from untreated control cultures (CON) or 48 h after transient transfection of expression plasmid DNA for MEK1, MEKK, MEK3, or MEK6 or treatment with LPS (1 μg/mL). * p
    Figure Legend Snippet: Effects of MAP kinase over-expression on the regulation of NO release from trigeminal glial cells. NO levels were determined by the Griess reaction in media collected from untreated control cultures (CON) or 48 h after transient transfection of expression plasmid DNA for MEK1, MEKK, MEK3, or MEK6 or treatment with LPS (1 μg/mL). * p

    Techniques Used: Over Expression, Transfection, Expressing, Plasmid Preparation

    8) Product Images from "TVB Receptors for Cytopathic and Noncytopathic Subgroups of Avian Leukosis Viruses Are Functional Death Receptors"

    Article Title: TVB Receptors for Cytopathic and Noncytopathic Subgroups of Avian Leukosis Viruses Are Functional Death Receptors

    Journal: Journal of Virology

    doi:

    TVB S1 , TVB S3 , and TVB T proteins induce apoptosis via the caspase pathway by a mechanism involving their cytoplasmic death domains. Human 293 cells were transfected with plasmid DNA encoding wild-type and mutant TVB proteins or instead with a control plasmid pBK-CMV (Stratagene). Cells were incubated with or without the caspase inhibitor zVAD-fmk (zVAD). The numbers of apoptotic nuclei associated with each cell population was determined by fluorescence microscopy after Hoechst staining by using a Nikon TE-200 microscope. Ten fields of each cell population were studied. The experiments were performed in triplicate, and the standard deviations of the data obtained are shown.
    Figure Legend Snippet: TVB S1 , TVB S3 , and TVB T proteins induce apoptosis via the caspase pathway by a mechanism involving their cytoplasmic death domains. Human 293 cells were transfected with plasmid DNA encoding wild-type and mutant TVB proteins or instead with a control plasmid pBK-CMV (Stratagene). Cells were incubated with or without the caspase inhibitor zVAD-fmk (zVAD). The numbers of apoptotic nuclei associated with each cell population was determined by fluorescence microscopy after Hoechst staining by using a Nikon TE-200 microscope. Ten fields of each cell population were studied. The experiments were performed in triplicate, and the standard deviations of the data obtained are shown.

    Techniques Used: Transfection, Plasmid Preparation, Mutagenesis, Incubation, Fluorescence, Microscopy, Staining

    9) Product Images from "Normal Development and Fertility of Knockout Mice Lacking the Tumor Suppressor Gene LRP1b Suggest Functional Compensation by LRP1"

    Article Title: Normal Development and Fertility of Knockout Mice Lacking the Tumor Suppressor Gene LRP1b Suggest Functional Compensation by LRP1

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.24.9.3782-3793.2004

    Genotyping and absence of LRP1b protein expression in LRP1b −/− mice. (A) Genomic DNA was prepared from the tails of wild-type mice (lane 1) and mice heterozygous (lane 2) and homozygous (lane 3) for the disruption of the LRP1b gene. The DNA was amplified by PCR with allele-specific primers to detect the wild-type LRP1b allele (500 bp) and disrupted allele (300 bp), respectively. (B) Genomic DNA from the tails of mice with the genotypes indicated was digested with BamHI and BglII and separated on a 0.6% agarose gel. Southern blotting was performed with a 32 P-labeled probe 3′ of the short arm homology region. The size of the bands is shown (5-kb wild-type allele, 6.5-kb disrupted allele). (C) Crude membrane fractions were prepared from the brains of three homozygous LRP1b −/− mice (lanes 1 to 3) and three wild-type controls (lanes 4 to 6). Equal amounts of total protein (100 μg) were separated by SDS-4% PAGE, transferred to nitrocellulose membranes and subjected to Western blotting using antibodies against the carboxyl terminus of LRP1b (upper panel) and LRP1 (lower panel).
    Figure Legend Snippet: Genotyping and absence of LRP1b protein expression in LRP1b −/− mice. (A) Genomic DNA was prepared from the tails of wild-type mice (lane 1) and mice heterozygous (lane 2) and homozygous (lane 3) for the disruption of the LRP1b gene. The DNA was amplified by PCR with allele-specific primers to detect the wild-type LRP1b allele (500 bp) and disrupted allele (300 bp), respectively. (B) Genomic DNA from the tails of mice with the genotypes indicated was digested with BamHI and BglII and separated on a 0.6% agarose gel. Southern blotting was performed with a 32 P-labeled probe 3′ of the short arm homology region. The size of the bands is shown (5-kb wild-type allele, 6.5-kb disrupted allele). (C) Crude membrane fractions were prepared from the brains of three homozygous LRP1b −/− mice (lanes 1 to 3) and three wild-type controls (lanes 4 to 6). Equal amounts of total protein (100 μg) were separated by SDS-4% PAGE, transferred to nitrocellulose membranes and subjected to Western blotting using antibodies against the carboxyl terminus of LRP1b (upper panel) and LRP1 (lower panel).

    Techniques Used: Expressing, Mouse Assay, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Southern Blot, Labeling, Polyacrylamide Gel Electrophoresis, Western Blot

    Related Articles

    Plasmid Preparation:

    Article Title: Conserved Regions in the Epstein-Barr Virus Leader Protein Define Distinct Domains Required for Nuclear Localization and Transcriptional Cooperation with EBNA2
    Article Snippet: Cells were transfected with the indicated amounts of target and effector plasmids. .. Total amounts of plasmid DNA for transfections were equalized using SG5 (Stratagene) plasmid DNA. .. For transfections using reporter plasmids, DG75 cells were used.

    Article Title: Sequence and Functional Analysis of EBNA-LP and EBNA2 Proteins from Nonhuman Primate Lymphocryptoviruses
    Article Snippet: Cells were transfected with the indicated amounts of target and effector plasmids. .. Total amounts of plasmid DNA for transfections were equalized by using SG5 (Stratagene) plasmid DNA. .. Transfections were harvested after 2 days of incubation, cells were lysed with reporter lysis buffer (Promega), and chloramphenicol acetyltransferase (CAT) or luciferase assays were carried out as previously described ( , ).

    Article Title: Functional Evidence of the Involvement of the Dynein Light Chain DYNLRB2 in Murine Leukemia Virus Infection
    Article Snippet: .. Plasmid DNAs were as follows. pCMVI expresses gag and pol from NB-MLV. pHit123 expresses the ecotropic envelope of MLV. pHit456 expresses the amphotropic envelope of MLV. pFBLuc (Stratagene) is a reporter plasmid containing the firefly luciferase coding sequence flanked by MLV-based long terminal repeats (LTRs). p8.91 carries gag and pol of HIV-1. pMD.G expresses the vesicular stomatitis virus envelope glycoprotein. pNCS contains the full-length Moloney murine leukemia virus. pNL43lucΔenv encodes an envelope-deficient HIV-1 strain with a luciferase reporter gene. pCMVHA-DYNLRB2 expresses the mouse DYNLRB2 protein fused to an HA epitope. .. Lentiviruses for transduction were produced by transfection of 293T cells with a mixture of the following plasmid DNAs: 1 μg pMD.G, 1 μg p8.91, and 1.5 μg of pGIPz, pGIPzDYNLL1 (containing shRNAs 1 to 3), pGIPzDYNLL2 (containing shRNA 1), pGIPzDYNLT1 (containing shRNA 1), pGIPzDYNLT3 (containing shRNAs 1 to 3), pGIPzDYNLRB1 (containing shRNAs 1 and 2), or pGIPzDYNLRB2 (containing shRNAs 1 and 2) (Open Biosystems).

    Article Title: Cofactor-Activated Phosphorylation Is Required for Inhibition of Cortical Neuron Differentiation by Groucho/TLE1
    Article Snippet: They suggest further that this post-translational modification plays a positive role in regulating the ability of Gro/TLE1 to inhibit neuronal differentiation. .. Site Directed Mutagenesis and DNA Plasmids DNAs encoding mutated forms of Gro/TLE1 harbouring the mutations S286A, S286E, S289A, S289E, S298A, and S298E were generated by site directed mutagenesis using the Quick Change II site directed mutagenesis kit (Stratagene, La Jolla, CA), using the pCMV2-FLAG-Gro/TLE1 plasmid as substrate. .. The following oligonucleotide primers were used for mutagenesis (mutations are underlined): S286A-F [ 5′- CTAAAGAAGGATGCTTCTAGC GC TCCAGCTTCCACGGCCTCCTC ], S289A-F [ 5′ -CTAGCAGTCCAGCT G CCACGGCCTCCTC ], S298A-F [ 5′-CCTCGGCAAGTTCCACT G C C TTGAAATCCAAAGAAATGAGC ], S286E-F [ 5′-AGGATGCTTCTAGC GAA CCAGCTTCCACGGCCTC ], S289E-F [ 5′- CTTCTAGCAGTCCAGCT GAA ACGGCCTCCTCGGCAAG ] and S298E-F [ 5′-CCTCGGCAAGTTCCACT GAA TTGAAATCCAAAGAAATGAGC]. pcDNA3-GAL4dbd-Gro/TLE1 plasmids used for transcription assays were obtained by PCR amplification of the entire coding sequence of each mutant using the appropriate pCMV2-FLAG-Gro/TLE1 plasmids as templates.

    Article Title: Concentration and Length Dependence of DNA Looping in Transcriptional Regulation
    Article Snippet: .. Plasmid DNAs Plasmid DNAs, bearing two Lac repressor binding sites spaced at a designed distance, are created using a point mutation method (QuikChange site-directed mutagenesis, Stratagene) on plasmid pUC19. .. Plasmid pUC19 was chosen as a starting template because it is not only a high copy plasmid but also contains two Lac repressor binding sites: and .

    Article Title: A Differential Screen for Ligand-Regulated Genes: Identification of HoxA10 as a Target of Vitamin D3 Induction in Myeloid Leukemic Cells
    Article Snippet: Poly(A)+ RNA was generated from the total nascent RNA by one round of oligo(dT) chromatography with the Fast-Track Kit (Invitrogen), following the manufacturer’s specifications. .. Five micrograms of pBluescript II SK+ (Stratagene) plasmid DNA was digested by Eco RI and Xho I and then dephosphorylated by calf intestine phosphatase (Boehringer Mannheim) and gel purified. .. The recovered vector DNA was aliquoted and stored at −20°C.

    Transfection:

    Article Title: Conserved Regions in the Epstein-Barr Virus Leader Protein Define Distinct Domains Required for Nuclear Localization and Transcriptional Cooperation with EBNA2
    Article Snippet: Cells were transfected with the indicated amounts of target and effector plasmids. .. Total amounts of plasmid DNA for transfections were equalized using SG5 (Stratagene) plasmid DNA. .. For transfections using reporter plasmids, DG75 cells were used.

    Article Title: Sequence and Functional Analysis of EBNA-LP and EBNA2 Proteins from Nonhuman Primate Lymphocryptoviruses
    Article Snippet: Cells were transfected with the indicated amounts of target and effector plasmids. .. Total amounts of plasmid DNA for transfections were equalized by using SG5 (Stratagene) plasmid DNA. .. Transfections were harvested after 2 days of incubation, cells were lysed with reporter lysis buffer (Promega), and chloramphenicol acetyltransferase (CAT) or luciferase assays were carried out as previously described ( , ).

    Luciferase:

    Article Title: Functional Evidence of the Involvement of the Dynein Light Chain DYNLRB2 in Murine Leukemia Virus Infection
    Article Snippet: .. Plasmid DNAs were as follows. pCMVI expresses gag and pol from NB-MLV. pHit123 expresses the ecotropic envelope of MLV. pHit456 expresses the amphotropic envelope of MLV. pFBLuc (Stratagene) is a reporter plasmid containing the firefly luciferase coding sequence flanked by MLV-based long terminal repeats (LTRs). p8.91 carries gag and pol of HIV-1. pMD.G expresses the vesicular stomatitis virus envelope glycoprotein. pNCS contains the full-length Moloney murine leukemia virus. pNL43lucΔenv encodes an envelope-deficient HIV-1 strain with a luciferase reporter gene. pCMVHA-DYNLRB2 expresses the mouse DYNLRB2 protein fused to an HA epitope. .. Lentiviruses for transduction were produced by transfection of 293T cells with a mixture of the following plasmid DNAs: 1 μg pMD.G, 1 μg p8.91, and 1.5 μg of pGIPz, pGIPzDYNLL1 (containing shRNAs 1 to 3), pGIPzDYNLL2 (containing shRNA 1), pGIPzDYNLT1 (containing shRNA 1), pGIPzDYNLT3 (containing shRNAs 1 to 3), pGIPzDYNLRB1 (containing shRNAs 1 and 2), or pGIPzDYNLRB2 (containing shRNAs 1 and 2) (Open Biosystems).

    Sequencing:

    Article Title: Functional Evidence of the Involvement of the Dynein Light Chain DYNLRB2 in Murine Leukemia Virus Infection
    Article Snippet: .. Plasmid DNAs were as follows. pCMVI expresses gag and pol from NB-MLV. pHit123 expresses the ecotropic envelope of MLV. pHit456 expresses the amphotropic envelope of MLV. pFBLuc (Stratagene) is a reporter plasmid containing the firefly luciferase coding sequence flanked by MLV-based long terminal repeats (LTRs). p8.91 carries gag and pol of HIV-1. pMD.G expresses the vesicular stomatitis virus envelope glycoprotein. pNCS contains the full-length Moloney murine leukemia virus. pNL43lucΔenv encodes an envelope-deficient HIV-1 strain with a luciferase reporter gene. pCMVHA-DYNLRB2 expresses the mouse DYNLRB2 protein fused to an HA epitope. .. Lentiviruses for transduction were produced by transfection of 293T cells with a mixture of the following plasmid DNAs: 1 μg pMD.G, 1 μg p8.91, and 1.5 μg of pGIPz, pGIPzDYNLL1 (containing shRNAs 1 to 3), pGIPzDYNLL2 (containing shRNA 1), pGIPzDYNLT1 (containing shRNA 1), pGIPzDYNLT3 (containing shRNAs 1 to 3), pGIPzDYNLRB1 (containing shRNAs 1 and 2), or pGIPzDYNLRB2 (containing shRNAs 1 and 2) (Open Biosystems).

    Mutagenesis:

    Article Title: Cofactor-Activated Phosphorylation Is Required for Inhibition of Cortical Neuron Differentiation by Groucho/TLE1
    Article Snippet: They suggest further that this post-translational modification plays a positive role in regulating the ability of Gro/TLE1 to inhibit neuronal differentiation. .. Site Directed Mutagenesis and DNA Plasmids DNAs encoding mutated forms of Gro/TLE1 harbouring the mutations S286A, S286E, S289A, S289E, S298A, and S298E were generated by site directed mutagenesis using the Quick Change II site directed mutagenesis kit (Stratagene, La Jolla, CA), using the pCMV2-FLAG-Gro/TLE1 plasmid as substrate. .. The following oligonucleotide primers were used for mutagenesis (mutations are underlined): S286A-F [ 5′- CTAAAGAAGGATGCTTCTAGC GC TCCAGCTTCCACGGCCTCCTC ], S289A-F [ 5′ -CTAGCAGTCCAGCT G CCACGGCCTCCTC ], S298A-F [ 5′-CCTCGGCAAGTTCCACT G C C TTGAAATCCAAAGAAATGAGC ], S286E-F [ 5′-AGGATGCTTCTAGC GAA CCAGCTTCCACGGCCTC ], S289E-F [ 5′- CTTCTAGCAGTCCAGCT GAA ACGGCCTCCTCGGCAAG ] and S298E-F [ 5′-CCTCGGCAAGTTCCACT GAA TTGAAATCCAAAGAAATGAGC]. pcDNA3-GAL4dbd-Gro/TLE1 plasmids used for transcription assays were obtained by PCR amplification of the entire coding sequence of each mutant using the appropriate pCMV2-FLAG-Gro/TLE1 plasmids as templates.

    Article Title: Concentration and Length Dependence of DNA Looping in Transcriptional Regulation
    Article Snippet: .. Plasmid DNAs Plasmid DNAs, bearing two Lac repressor binding sites spaced at a designed distance, are created using a point mutation method (QuikChange site-directed mutagenesis, Stratagene) on plasmid pUC19. .. Plasmid pUC19 was chosen as a starting template because it is not only a high copy plasmid but also contains two Lac repressor binding sites: and .

    Article Title: Inhibition of Cortical Neuron Differentiation by Groucho/TLE1 Requires Interaction with WRPW, but Not Eh1, Repressor Peptides *
    Article Snippet: .. Site-directed Mutagenesis and DNA Plasmids —DNAs encoding mutated forms of Gro/TLE1 harboring the mutations V486S, C488R, R534A, E550K, and L743F were generated by site-directed mutagenesis using the QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA), using pCMV2-FLAG-Gro/TLE1 ( ) as substrate. .. Oligonucleotide primers used for mutagenesis were as follows (mutations are underlined): V486S-F: 5′-CAACCACGGGGAG TC GGTGTGCGCTGTGA, C488R-F: 5′-CGGGGAGGTGGTG A G A GCTGTGACCATCAGC, R534A-F: 5′-CTGAACAGAGACAATTATATC GC TTCCTGTAAATTGCTACCCG, E550K-F: 5′-CTCATAGTGGGAGGG A AAGCCAGTACTTTGTCC, and L743F-F: 5′-GAGTCCTCGTCAGTG T TTAGCTGTGACATCTC. pcDNA3-GAL4dbd-Gro/TLE1 plasmids were generated by amplifying by PCR the entire coding sequence of each mutant using the appropriate pCMV2-FLAG-Gro/TLE1 plasmids as template, followed by subcloning into the EcoRV site of pcDNA3-GAL4dbd plasmid, which encodes the DNA-binding domain of GAL4 (GAL4dbd).

    Generated:

    Article Title: Cofactor-Activated Phosphorylation Is Required for Inhibition of Cortical Neuron Differentiation by Groucho/TLE1
    Article Snippet: They suggest further that this post-translational modification plays a positive role in regulating the ability of Gro/TLE1 to inhibit neuronal differentiation. .. Site Directed Mutagenesis and DNA Plasmids DNAs encoding mutated forms of Gro/TLE1 harbouring the mutations S286A, S286E, S289A, S289E, S298A, and S298E were generated by site directed mutagenesis using the Quick Change II site directed mutagenesis kit (Stratagene, La Jolla, CA), using the pCMV2-FLAG-Gro/TLE1 plasmid as substrate. .. The following oligonucleotide primers were used for mutagenesis (mutations are underlined): S286A-F [ 5′- CTAAAGAAGGATGCTTCTAGC GC TCCAGCTTCCACGGCCTCCTC ], S289A-F [ 5′ -CTAGCAGTCCAGCT G CCACGGCCTCCTC ], S298A-F [ 5′-CCTCGGCAAGTTCCACT G C C TTGAAATCCAAAGAAATGAGC ], S286E-F [ 5′-AGGATGCTTCTAGC GAA CCAGCTTCCACGGCCTC ], S289E-F [ 5′- CTTCTAGCAGTCCAGCT GAA ACGGCCTCCTCGGCAAG ] and S298E-F [ 5′-CCTCGGCAAGTTCCACT GAA TTGAAATCCAAAGAAATGAGC]. pcDNA3-GAL4dbd-Gro/TLE1 plasmids used for transcription assays were obtained by PCR amplification of the entire coding sequence of each mutant using the appropriate pCMV2-FLAG-Gro/TLE1 plasmids as templates.

    Article Title: Inhibition of Cortical Neuron Differentiation by Groucho/TLE1 Requires Interaction with WRPW, but Not Eh1, Repressor Peptides *
    Article Snippet: .. Site-directed Mutagenesis and DNA Plasmids —DNAs encoding mutated forms of Gro/TLE1 harboring the mutations V486S, C488R, R534A, E550K, and L743F were generated by site-directed mutagenesis using the QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA), using pCMV2-FLAG-Gro/TLE1 ( ) as substrate. .. Oligonucleotide primers used for mutagenesis were as follows (mutations are underlined): V486S-F: 5′-CAACCACGGGGAG TC GGTGTGCGCTGTGA, C488R-F: 5′-CGGGGAGGTGGTG A G A GCTGTGACCATCAGC, R534A-F: 5′-CTGAACAGAGACAATTATATC GC TTCCTGTAAATTGCTACCCG, E550K-F: 5′-CTCATAGTGGGAGGG A AAGCCAGTACTTTGTCC, and L743F-F: 5′-GAGTCCTCGTCAGTG T TTAGCTGTGACATCTC. pcDNA3-GAL4dbd-Gro/TLE1 plasmids were generated by amplifying by PCR the entire coding sequence of each mutant using the appropriate pCMV2-FLAG-Gro/TLE1 plasmids as template, followed by subcloning into the EcoRV site of pcDNA3-GAL4dbd plasmid, which encodes the DNA-binding domain of GAL4 (GAL4dbd).

    Binding Assay:

    Article Title: Concentration and Length Dependence of DNA Looping in Transcriptional Regulation
    Article Snippet: .. Plasmid DNAs Plasmid DNAs, bearing two Lac repressor binding sites spaced at a designed distance, are created using a point mutation method (QuikChange site-directed mutagenesis, Stratagene) on plasmid pUC19. .. Plasmid pUC19 was chosen as a starting template because it is not only a high copy plasmid but also contains two Lac repressor binding sites: and .

    Irradiation:

    Article Title: DNA Inversion on Conjugative Plasmid pVT745
    Article Snippet: Parental ATCC 29522 cells and potential RecA− transformants were grown in broth to late exponential phase and were then streaked in parallel onto TSBYE agar plates. .. Plates were irradiated with UV light with increasing doses (500, 1,000, 2,000 and 4,000 μJ) (UV Stratalinker 1800; Stratagene, La Jolla, Calif.), and their contents were then incubated for 2 days. .. The sensitivity of RecA− cells to the chemical MMS was tested by adding MMS to TSBYE agar plates in various concentrations, and a comparison of cell growth on these plates to that of parental strain ATCC 29522 grown under the same conditions was made.

    Incubation:

    Article Title: DNA Inversion on Conjugative Plasmid pVT745
    Article Snippet: Parental ATCC 29522 cells and potential RecA− transformants were grown in broth to late exponential phase and were then streaked in parallel onto TSBYE agar plates. .. Plates were irradiated with UV light with increasing doses (500, 1,000, 2,000 and 4,000 μJ) (UV Stratalinker 1800; Stratagene, La Jolla, Calif.), and their contents were then incubated for 2 days. .. The sensitivity of RecA− cells to the chemical MMS was tested by adding MMS to TSBYE agar plates in various concentrations, and a comparison of cell growth on these plates to that of parental strain ATCC 29522 grown under the same conditions was made.

    Purification:

    Article Title: A Differential Screen for Ligand-Regulated Genes: Identification of HoxA10 as a Target of Vitamin D3 Induction in Myeloid Leukemic Cells
    Article Snippet: Poly(A)+ RNA was generated from the total nascent RNA by one round of oligo(dT) chromatography with the Fast-Track Kit (Invitrogen), following the manufacturer’s specifications. .. Five micrograms of pBluescript II SK+ (Stratagene) plasmid DNA was digested by Eco RI and Xho I and then dephosphorylated by calf intestine phosphatase (Boehringer Mannheim) and gel purified. .. The recovered vector DNA was aliquoted and stored at −20°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • plasmid dna  (Stratagene)
    86
    Stratagene plasmid dna
    <t>FtHU</t> protects <t>DNA</t> from oxidative damage. The ability of FtHU to protect DNA from free hydroxyl radicals was tested. Samples were analyzed on 1% agarose gel and visualized by SYBR®Safe DNA gel stain. BSA protein was used as a negative control. 1 and 10 standards, 2 DNA, 3 DNA + H 2 O 2 , 4 DNA + H 2 O 2 + Fe 2+ (166 μM), 5–9 DNA + H 2 O 2 + FtHU + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM), 11–15 DNA + H 2 O 2 + BSA + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM). Even in case of increasing concentrations of Fe 2+ HU is able to protect DNA from reactive oxygen species.
    Plasmid Dna, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna/product/Stratagene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid dna - by Bioz Stars, 2021-03
    86/100 stars
    		  Buy from Supplier
    dna plasmid pcmv3tag8 egfp  (Stratagene)
    86
    Stratagene dna plasmid pcmv3tag8 egfp
    <t>DNA</t> plasmids for in vitro transcription. ( a ) The second generation CAR (CD19RCD28) cDNA under control of T7 promoter. ( b ) <t>EGFP</t> cDNA under control of T7 promoter. Amp(R): Ampicillin resistance, Kan(R): Kanamycin resistance, Hygro(R): Hygromycin resistance, BGH: bovine growth hormone
    Dna Plasmid Pcmv3tag8 Egfp, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna plasmid pcmv3tag8 egfp/product/Stratagene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna plasmid pcmv3tag8 egfp - by Bioz Stars, 2021-03
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    FtHU protects DNA from oxidative damage. The ability of FtHU to protect DNA from free hydroxyl radicals was tested. Samples were analyzed on 1% agarose gel and visualized by SYBR®Safe DNA gel stain. BSA protein was used as a negative control. 1 and 10 standards, 2 DNA, 3 DNA + H 2 O 2 , 4 DNA + H 2 O 2 + Fe 2+ (166 μM), 5–9 DNA + H 2 O 2 + FtHU + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM), 11–15 DNA + H 2 O 2 + BSA + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM). Even in case of increasing concentrations of Fe 2+ HU is able to protect DNA from reactive oxygen species.

    Journal: Virulence

    Article Title: HU protein is involved in intracellular growth and full virulence of Francisella tularensis

    doi: 10.1080/21505594.2018.1441588

    Figure Lengend Snippet: FtHU protects DNA from oxidative damage. The ability of FtHU to protect DNA from free hydroxyl radicals was tested. Samples were analyzed on 1% agarose gel and visualized by SYBR®Safe DNA gel stain. BSA protein was used as a negative control. 1 and 10 standards, 2 DNA, 3 DNA + H 2 O 2 , 4 DNA + H 2 O 2 + Fe 2+ (166 μM), 5–9 DNA + H 2 O 2 + FtHU + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM), 11–15 DNA + H 2 O 2 + BSA + Fe 2+ (0 μM, 166 μM, 333 μM, 666 μM, 1000 μM). Even in case of increasing concentrations of Fe 2+ HU is able to protect DNA from reactive oxygen species.

    Article Snippet: DNA protection assay The ability of FtHU (0.5 μg) to protect 500 ng of linearized plasmid DNA (pBluescriptSK+, Stratagene, 212205) from free hydroxyl radicals was tested in the binding buffer (20 mM Tris-HCl, pH 8, 0.1 mM EDTA-Na2 , 50 mM KCl, 10 μg/ml BSA, 5% glycerol, 0.1 mM DTT, 0.05% Brij 58) in a total volume of 10 μl.

    Techniques: Agarose Gel Electrophoresis, Staining, Negative Control

    FtHU binds to dsDNA. Gel electrophoresis of FtHU-DNA complex. Lanes 1 and 8 standards, lane 2 naked DNA, lanes 3,4,5,6, and 7 DNA with FtHU (0.5; 0.7; 0.9; 1; 1.2 μg), lanes 9,10,11,12,and 13 DNA with BSA (0.5; 0.7; 0.9; 1; 1.2 μg). FtHU-DNA complex migrates slower in agarose gel and it is localized higher than control sample with BSA.

    Journal: Virulence

    Article Title: HU protein is involved in intracellular growth and full virulence of Francisella tularensis

    doi: 10.1080/21505594.2018.1441588

    Figure Lengend Snippet: FtHU binds to dsDNA. Gel electrophoresis of FtHU-DNA complex. Lanes 1 and 8 standards, lane 2 naked DNA, lanes 3,4,5,6, and 7 DNA with FtHU (0.5; 0.7; 0.9; 1; 1.2 μg), lanes 9,10,11,12,and 13 DNA with BSA (0.5; 0.7; 0.9; 1; 1.2 μg). FtHU-DNA complex migrates slower in agarose gel and it is localized higher than control sample with BSA.

    Article Snippet: DNA protection assay The ability of FtHU (0.5 μg) to protect 500 ng of linearized plasmid DNA (pBluescriptSK+, Stratagene, 212205) from free hydroxyl radicals was tested in the binding buffer (20 mM Tris-HCl, pH 8, 0.1 mM EDTA-Na2 , 50 mM KCl, 10 μg/ml BSA, 5% glycerol, 0.1 mM DTT, 0.05% Brij 58) in a total volume of 10 μl.

    Techniques: Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis

    Idas targets Geminin to the nucleus. A , MCF7 cells were co-transfected with GemininGFP and Idas-Cherry ( upper ) or Cherry vector ( lower ), and the subcellular localization of GFP ( b and e ) and Cherry ( c and f ) was assessed. DNA was stained with DAPI ( a

    Journal: The Journal of Biological Chemistry

    Article Title: Idas, a Novel Phylogenetically Conserved Geminin-related Protein, Binds to Geminin and Is Required for Cell Cycle Progression *

    doi: 10.1074/jbc.M110.207688

    Figure Lengend Snippet: Idas targets Geminin to the nucleus. A , MCF7 cells were co-transfected with GemininGFP and Idas-Cherry ( upper ) or Cherry vector ( lower ), and the subcellular localization of GFP ( b and e ) and Cherry ( c and f ) was assessed. DNA was stained with DAPI ( a

    Article Snippet: MCF7 (1–3 × 105 cells) were transfected with a total of 1 μg of plasmid DNA using Genejammer (Stratagene) following the manufacturer's instructions, and cells were analyzed 22 h post-transfection.

    Techniques: Transfection, Plasmid Preparation, Staining

    SNAP c binds to the U6-9 promoter. Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-SNAP43 antibodies or normal IgG antibodies. The relative amounts of the U6-4 , U6-9 and U6-1 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘5% total’ represents 5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR.

    Journal: Nucleic Acids Research

    Article Title: Multiple, dispersed human U6 small nuclear RNA genes with varied transcriptional efficiencies

    doi:

    Figure Lengend Snippet: SNAP c binds to the U6-9 promoter. Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-SNAP43 antibodies or normal IgG antibodies. The relative amounts of the U6-4 , U6-9 and U6-1 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘5% total’ represents 5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR.

    Article Snippet: Using plasmid DNA from the above variants, PCR mutagenesis was performed using PfuTurbo polymerase (Stratagene) and the QuickChange protocol as suggested by the manufacturer.

    Techniques: Electrophoresis, Polymerase Chain Reaction

    TATA-binding protein and acetylated histone H4 interact with U6-1 , U6-2 , U6-7 , U6-8 and U6-9 promoters but not with the other potential full-length U6 genes. ( A ) Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-TBP antibodies or normal IgG antibodies, and DNA was purified following reversal of cross-links. The relative amounts of the U6 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘5% total’ represents 5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR. ( B ) Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-AcH4 antibodies or normal IgG antibodies, and DNA was purified following reversal of cross-links. The relative amounts of the U6 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘2.5% total’ represents 2.5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR.

    Journal: Nucleic Acids Research

    Article Title: Multiple, dispersed human U6 small nuclear RNA genes with varied transcriptional efficiencies

    doi:

    Figure Lengend Snippet: TATA-binding protein and acetylated histone H4 interact with U6-1 , U6-2 , U6-7 , U6-8 and U6-9 promoters but not with the other potential full-length U6 genes. ( A ) Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-TBP antibodies or normal IgG antibodies, and DNA was purified following reversal of cross-links. The relative amounts of the U6 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘5% total’ represents 5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR. ( B ) Sheared chromatin from human 293 cells that had been cross-linked with formaldehyde was immunoselected with anti-AcH4 antibodies or normal IgG antibodies, and DNA was purified following reversal of cross-links. The relative amounts of the U6 promoter sequences in the antibody-selected DNA samples were determined by electrophoresis of radiolabeled PCR products on a 15% gel. As an input control, ‘2.5% total’ represents 2.5% of the unselected chromatin DNA compared with the amount of the antibody-selected chromatin DNA assayed by PCR.

    Article Snippet: Using plasmid DNA from the above variants, PCR mutagenesis was performed using PfuTurbo polymerase (Stratagene) and the QuickChange protocol as suggested by the manufacturer.

    Techniques: Binding Assay, Purification, Electrophoresis, Polymerase Chain Reaction

    DNA plasmids for in vitro transcription. ( a ) The second generation CAR (CD19RCD28) cDNA under control of T7 promoter. ( b ) EGFP cDNA under control of T7 promoter. Amp(R): Ampicillin resistance, Kan(R): Kanamycin resistance, Hygro(R): Hygromycin resistance, BGH: bovine growth hormone

    Journal: Biomedical microdevices

    Article Title: A high throughput microelectroporation device to introduce a chimeric antigen receptor to redirect the specificity of human T cells

    doi: 10.1007/s10544-010-9440-3

    Figure Lengend Snippet: DNA plasmids for in vitro transcription. ( a ) The second generation CAR (CD19RCD28) cDNA under control of T7 promoter. ( b ) EGFP cDNA under control of T7 promoter. Amp(R): Ampicillin resistance, Kan(R): Kanamycin resistance, Hygro(R): Hygromycin resistance, BGH: bovine growth hormone

    Article Snippet: The same procedure for in vitro transcription was used to make EGFP mRNA using the DNA plasmid pCMV3tag8-EGFP (Stratagene, La Jolla, CA) using Not I to linearize this plasmid ( ).

    Techniques: In Vitro