Structured Review

Macrogen plasmid dna
Schematic diagram depicting a restriction map of a 5.6-kb <t>HindIII</t> fragment of E. faecium JS79 <t>DNA</t> containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black
Plasmid Dna, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid dna/product/Macrogen
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
plasmid dna - by Bioz Stars, 2021-03
86/100 stars

Images

1) Product Images from "Characterization of Two Newly Identified Genes, vgaD and vatG, Conferring Resistance to Streptogramin A in Enterococcus faecium ▿"

Article Title: Characterization of Two Newly Identified Genes, vgaD and vatG, Conferring Resistance to Streptogramin A in Enterococcus faecium ▿

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00798-09

Schematic diagram depicting a restriction map of a 5.6-kb HindIII fragment of E. faecium JS79 DNA containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black
Figure Legend Snippet: Schematic diagram depicting a restriction map of a 5.6-kb HindIII fragment of E. faecium JS79 DNA containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black

Techniques Used:

Southern hybridization to identify vatG -containing E. faecium isolates from healthy humans, swine, poultry stool samples, and chicken meat. (A) Agarose gel electrophoresis of HindIII-digested plasmid DNA from E. faecium isolates. (B) Southern hybridization
Figure Legend Snippet: Southern hybridization to identify vatG -containing E. faecium isolates from healthy humans, swine, poultry stool samples, and chicken meat. (A) Agarose gel electrophoresis of HindIII-digested plasmid DNA from E. faecium isolates. (B) Southern hybridization

Techniques Used: Hybridization, Agarose Gel Electrophoresis, Plasmid Preparation

Related Articles

Plasmid Preparation:

Article Title: Molecular diagnosis and phylogenetic analysis of human papillomavirus type-16 from suspected patients in Pakistan
Article Snippet: Plasmid DNA was extracted using a minipreparation protocol according to Sambrook and Russell [ ], and confirmed by digestion with restriction endonucleases. .. The plasmid DNA containing cloned fragment from three different independent clones, was sequenced using commercial sequencing facility of Macrogen (Korea) using M13 universal primers and gene specific primers. .. The sequence data was compiled using DNA Dragon Sequence Assembler version 1.5.1 (Sequentix-Digital DNA Processing, Germany).

Article Title: Comparison of standard PCR/cloning to single genome sequencing for analysis of HIV-1 populations
Article Snippet: NPCR products generated as described above were cloned using a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instructions. .. Sequencing of plasmid DNA isolated from randomly chosen individual bacterial colonies (7-20 per specimen) was performed by standard dideoxy methods using conserved primers (Macrogen, Rockville, MD, USA). .. HIV RNA was extracted using standard guanidinium extraction methods [7]; cDNA was synthesized using random hexamers and diluted to an average of one amplifiable molecule per 3 wells of a microtiter plate and PCR amplified using a previously described methodology and primer sets ( ).

Article Title: Conjugative Plasmids of Neisseria gonorrhoeae
Article Snippet: Approximately 1.2 µg of plasmid DNA was obtained from 1 liter of N. gonorrhoeae . .. 15 ug of plasmid DNA obtained from 13 liters of N. gonorrhoeae clinical isolate 5289 was send to the Macrogen Corporation (Seoul, South Korea) to obtain the plasmid sequence via shotgun cloning and sequencing. .. Southern blot and restriction analysis Whole plasmid DNA was transferred to nitrocelullose membranes by the method of Southern followed by the hybridization of DIG-labelled tetM .

Article Title: An Arc of Unpaired "Hinge Bases" Facilitates Information Exchange among Functional Centers of the Ribosome ▿
Article Snippet: [γ-32 P]ATP (Perkin-Elmer, Wellesley, MA) T4 polynucleotide kinase, and avian myeloblastosis virus reverse transcriptase (Roche) were used for primer extension. .. Plasmid DNA and RT-PCR products were sequenced by Macrogen, Inc. (Seoul, South Korea). .. The yeast high-copy-number vector pRS426 ( ) was used to provide the backbone for construction of the tetracycline-controllable rRNA expression plasmid pJD694.

Article Title: Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
Article Snippet: Expressed sequence tag (EST) clone , which encoded a homologous OST polypeptide, was retrieved from the C . sinensis transcriptome database of the Korea National Institute of Health [ , ]. .. Plasmid DNA was extracted from its glycerol stock and sequenced (Macrogen, Inc., Seoul, Korea). .. The missing N-terminal region was obtained using 5′-RACE (SMARTer RACE cDNA Amplification Kit; Clontech Laboratories, Inc.).

Article Title: Viral Bcl2s’ transmembrane domain interact with host Bcl2 proteins to control cellular apoptosis
Article Snippet: Mutations into the TMD were introduced by site-directed mutagenesis using the Quick Change II kit following the manufacturer’s instructions (Agilent Technologies). .. All DNA manipulations were confirmed by the sequencing of plasmid DNAs (Macrogen). .. Transfection of DNA into eukaryotic cells was performed in Opti-MEM reduced serum medium (Gibco) with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s specifications.

Clone Assay:

Article Title: Molecular diagnosis and phylogenetic analysis of human papillomavirus type-16 from suspected patients in Pakistan
Article Snippet: Plasmid DNA was extracted using a minipreparation protocol according to Sambrook and Russell [ ], and confirmed by digestion with restriction endonucleases. .. The plasmid DNA containing cloned fragment from three different independent clones, was sequenced using commercial sequencing facility of Macrogen (Korea) using M13 universal primers and gene specific primers. .. The sequence data was compiled using DNA Dragon Sequence Assembler version 1.5.1 (Sequentix-Digital DNA Processing, Germany).

Article Title: Conjugative Plasmids of Neisseria gonorrhoeae
Article Snippet: Approximately 1.2 µg of plasmid DNA was obtained from 1 liter of N. gonorrhoeae . .. 15 ug of plasmid DNA obtained from 13 liters of N. gonorrhoeae clinical isolate 5289 was send to the Macrogen Corporation (Seoul, South Korea) to obtain the plasmid sequence via shotgun cloning and sequencing. .. Southern blot and restriction analysis Whole plasmid DNA was transferred to nitrocelullose membranes by the method of Southern followed by the hybridization of DIG-labelled tetM .

Sequencing:

Article Title: Molecular diagnosis and phylogenetic analysis of human papillomavirus type-16 from suspected patients in Pakistan
Article Snippet: Plasmid DNA was extracted using a minipreparation protocol according to Sambrook and Russell [ ], and confirmed by digestion with restriction endonucleases. .. The plasmid DNA containing cloned fragment from three different independent clones, was sequenced using commercial sequencing facility of Macrogen (Korea) using M13 universal primers and gene specific primers. .. The sequence data was compiled using DNA Dragon Sequence Assembler version 1.5.1 (Sequentix-Digital DNA Processing, Germany).

Article Title: Comparison of standard PCR/cloning to single genome sequencing for analysis of HIV-1 populations
Article Snippet: NPCR products generated as described above were cloned using a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instructions. .. Sequencing of plasmid DNA isolated from randomly chosen individual bacterial colonies (7-20 per specimen) was performed by standard dideoxy methods using conserved primers (Macrogen, Rockville, MD, USA). .. HIV RNA was extracted using standard guanidinium extraction methods [7]; cDNA was synthesized using random hexamers and diluted to an average of one amplifiable molecule per 3 wells of a microtiter plate and PCR amplified using a previously described methodology and primer sets ( ).

Article Title: Conjugative Plasmids of Neisseria gonorrhoeae
Article Snippet: Approximately 1.2 µg of plasmid DNA was obtained from 1 liter of N. gonorrhoeae . .. 15 ug of plasmid DNA obtained from 13 liters of N. gonorrhoeae clinical isolate 5289 was send to the Macrogen Corporation (Seoul, South Korea) to obtain the plasmid sequence via shotgun cloning and sequencing. .. Southern blot and restriction analysis Whole plasmid DNA was transferred to nitrocelullose membranes by the method of Southern followed by the hybridization of DIG-labelled tetM .

Article Title: Viral Bcl2s’ transmembrane domain interact with host Bcl2 proteins to control cellular apoptosis
Article Snippet: Mutations into the TMD were introduced by site-directed mutagenesis using the Quick Change II kit following the manufacturer’s instructions (Agilent Technologies). .. All DNA manipulations were confirmed by the sequencing of plasmid DNAs (Macrogen). .. Transfection of DNA into eukaryotic cells was performed in Opti-MEM reduced serum medium (Gibco) with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s specifications.

Isolation:

Article Title: Comparison of standard PCR/cloning to single genome sequencing for analysis of HIV-1 populations
Article Snippet: NPCR products generated as described above were cloned using a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instructions. .. Sequencing of plasmid DNA isolated from randomly chosen individual bacterial colonies (7-20 per specimen) was performed by standard dideoxy methods using conserved primers (Macrogen, Rockville, MD, USA). .. HIV RNA was extracted using standard guanidinium extraction methods [7]; cDNA was synthesized using random hexamers and diluted to an average of one amplifiable molecule per 3 wells of a microtiter plate and PCR amplified using a previously described methodology and primer sets ( ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: An Arc of Unpaired "Hinge Bases" Facilitates Information Exchange among Functional Centers of the Ribosome ▿
Article Snippet: [γ-32 P]ATP (Perkin-Elmer, Wellesley, MA) T4 polynucleotide kinase, and avian myeloblastosis virus reverse transcriptase (Roche) were used for primer extension. .. Plasmid DNA and RT-PCR products were sequenced by Macrogen, Inc. (Seoul, South Korea). .. The yeast high-copy-number vector pRS426 ( ) was used to provide the backbone for construction of the tetracycline-controllable rRNA expression plasmid pJD694.

DNA Sequencing:

Article Title: The Oncoprotein BCL11A Binds to Orphan Nuclear Receptor TLX and Potentiates its Transrepressive Function
Article Snippet: After 5 days incubation at 30°C, positive growing colonies were picked up and cultured in prey selective liquid medium (SD-T, lacking Trp). .. Prey plasmids DNAs were then extracted from cultures and shuttled in E. coli DH5a strain to enable DNA sequencing (Macrogen, Inc) using the following primers (Sigma-Aldrich): 5′ TATAACGCGTTTGGAATCACT 3 and 5′′ TAAATTTCTGGCAAGGTAGAC ′3. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Macrogen plasmid dna sequencing
    Sequence comparison between MYCN upstream and ACE3 , and transcription factor binding sites in MYCN upstream. (A) A 1,020 bp <t>DNA</t> sequence (top; bases 1–1,020) encompassing ACE3 from Drosophila melanogaster chorion gene cluster and a DNA sequence of ~65 kb (bottom) containing MYCN (bases 2,416,201 to 2,481,180) from human chromosome 2 genomic contig were compared using the LFASTAn program. (B) Using the TFSEARCH program, putative <t>c-Myb</t> and E2F1 binding sites upstream (−1,021 to −143) of human MYCN gene were detected. MYCN, MYCN proto-oncogene bHLH transcription factor ; ACE3, amplification-control-element-on-3 ; c-Myb, transcriptional activator Myb; E2F1, E2F transcription factor 1.
    Plasmid Dna Sequencing, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna sequencing/product/Macrogen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid dna sequencing - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    86
    Macrogen plasmid dna
    Schematic diagram depicting a restriction map of a 5.6-kb <t>HindIII</t> fragment of E. faecium JS79 <t>DNA</t> containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black
    Plasmid Dna, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna/product/Macrogen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    plasmid dna - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    Image Search Results


    Sequence comparison between MYCN upstream and ACE3 , and transcription factor binding sites in MYCN upstream. (A) A 1,020 bp DNA sequence (top; bases 1–1,020) encompassing ACE3 from Drosophila melanogaster chorion gene cluster and a DNA sequence of ~65 kb (bottom) containing MYCN (bases 2,416,201 to 2,481,180) from human chromosome 2 genomic contig were compared using the LFASTAn program. (B) Using the TFSEARCH program, putative c-Myb and E2F1 binding sites upstream (−1,021 to −143) of human MYCN gene were detected. MYCN, MYCN proto-oncogene bHLH transcription factor ; ACE3, amplification-control-element-on-3 ; c-Myb, transcriptional activator Myb; E2F1, E2F transcription factor 1.

    Journal: Molecular Medicine Reports

    Article Title: MYCN is amplified during S phase, and c-myb is involved in controlling MYCN expression and amplification in MYCN-amplified neuroblastoma cell lines

    doi: 10.3892/mmr.2018.9686

    Figure Lengend Snippet: Sequence comparison between MYCN upstream and ACE3 , and transcription factor binding sites in MYCN upstream. (A) A 1,020 bp DNA sequence (top; bases 1–1,020) encompassing ACE3 from Drosophila melanogaster chorion gene cluster and a DNA sequence of ~65 kb (bottom) containing MYCN (bases 2,416,201 to 2,481,180) from human chromosome 2 genomic contig were compared using the LFASTAn program. (B) Using the TFSEARCH program, putative c-Myb and E2F1 binding sites upstream (−1,021 to −143) of human MYCN gene were detected. MYCN, MYCN proto-oncogene bHLH transcription factor ; ACE3, amplification-control-element-on-3 ; c-Myb, transcriptional activator Myb; E2F1, E2F transcription factor 1.

    Article Snippet: The shRNA sequences of c- myb and EGFP vectors were confirmed by plasmid DNA sequencing (Macrogen, Inc., Seoul, Korea) in both directions using forward (OL559) and reverse (OL408) primers.

    Techniques: Sequencing, Binding Assay, Amplification

    The effect of c- myb RNAi treatment on MYCN gene copy number. (A) Interference rate of c- myb mRNA was presented as compared with shRNA controls in MYCN -amplified neuroblastoma cell lines. The expression levels of c- myb mRNA were determined pre- and post-c- myb RNAi treatment of Kelly, SIMA, MHH-NB-11 and IMR32 cell lines, as normalized to the Cp values of target and reference genes of the SH-SY5Y control cell line. R-value was calculated using the mean Cp ± standard error of duplicate or triplicate experiments in case of discordant results. (B) MYCN / p53 DNA copy number ratios were determined by the delta-delta Cp method pre- and post-c- myb RNAi treatment as compared with shRNA control in MYCN -amplified neuroblastoma cell lines. Data are expressed as mean Cp ± standard error of the mean from ≥6 independent experiments. *P

    Journal: Molecular Medicine Reports

    Article Title: MYCN is amplified during S phase, and c-myb is involved in controlling MYCN expression and amplification in MYCN-amplified neuroblastoma cell lines

    doi: 10.3892/mmr.2018.9686

    Figure Lengend Snippet: The effect of c- myb RNAi treatment on MYCN gene copy number. (A) Interference rate of c- myb mRNA was presented as compared with shRNA controls in MYCN -amplified neuroblastoma cell lines. The expression levels of c- myb mRNA were determined pre- and post-c- myb RNAi treatment of Kelly, SIMA, MHH-NB-11 and IMR32 cell lines, as normalized to the Cp values of target and reference genes of the SH-SY5Y control cell line. R-value was calculated using the mean Cp ± standard error of duplicate or triplicate experiments in case of discordant results. (B) MYCN / p53 DNA copy number ratios were determined by the delta-delta Cp method pre- and post-c- myb RNAi treatment as compared with shRNA control in MYCN -amplified neuroblastoma cell lines. Data are expressed as mean Cp ± standard error of the mean from ≥6 independent experiments. *P

    Article Snippet: The shRNA sequences of c- myb and EGFP vectors were confirmed by plasmid DNA sequencing (Macrogen, Inc., Seoul, Korea) in both directions using forward (OL559) and reverse (OL408) primers.

    Techniques: shRNA, Amplification, Expressing

    Expression of potential c-Myb target genes and MYCN gene copy number in neuroblastoma cell lines. (A) Heat map visualizing the mRNA expression of 10 genes and MYCN gene copy number ( MYCN -DNA) from neuroblastoma cell lines compared with reference genes, HPRT1 and p53 , respectively. The color key represents the column Z-score of gene expression levels and copy numbers. Dark pink indicates the lowest gene expression or copy number and dark green indicates the highest gene expression or copy number. (B) Expression levels of MYCN and B- myb as compared with reference HPRT1 ; (C) MYCN gene copy number as compared with reference p53 in neuroblastoma cell lines (see also Table III ). MYCN, MYCN proto-oncogene bHLH transcription factor ; B- myb, MYB proto-oncogene like 2 ; E2F1, E2F transcription factor 1 ; hCdt1, chromatin licensing and DNA replication factor 1 ; GMNN, geminin ; p27, cyclin-dependent kinase inhibitor 1B ; CDK2, cyclin dependent kinase 2 ; p21, cyclin-dependent kinase inhibitor 1A ; L3MBTL1, L3MBTL1 histone methyl-lysine binding protein ; c-Myb, transcriptional activator Myb ; HPRT1, hypoxanthine phosphoribosyltransferase 1 .

    Journal: Molecular Medicine Reports

    Article Title: MYCN is amplified during S phase, and c-myb is involved in controlling MYCN expression and amplification in MYCN-amplified neuroblastoma cell lines

    doi: 10.3892/mmr.2018.9686

    Figure Lengend Snippet: Expression of potential c-Myb target genes and MYCN gene copy number in neuroblastoma cell lines. (A) Heat map visualizing the mRNA expression of 10 genes and MYCN gene copy number ( MYCN -DNA) from neuroblastoma cell lines compared with reference genes, HPRT1 and p53 , respectively. The color key represents the column Z-score of gene expression levels and copy numbers. Dark pink indicates the lowest gene expression or copy number and dark green indicates the highest gene expression or copy number. (B) Expression levels of MYCN and B- myb as compared with reference HPRT1 ; (C) MYCN gene copy number as compared with reference p53 in neuroblastoma cell lines (see also Table III ). MYCN, MYCN proto-oncogene bHLH transcription factor ; B- myb, MYB proto-oncogene like 2 ; E2F1, E2F transcription factor 1 ; hCdt1, chromatin licensing and DNA replication factor 1 ; GMNN, geminin ; p27, cyclin-dependent kinase inhibitor 1B ; CDK2, cyclin dependent kinase 2 ; p21, cyclin-dependent kinase inhibitor 1A ; L3MBTL1, L3MBTL1 histone methyl-lysine binding protein ; c-Myb, transcriptional activator Myb ; HPRT1, hypoxanthine phosphoribosyltransferase 1 .

    Article Snippet: The shRNA sequences of c-myb and EGFP vectors were confirmed by plasmid DNA sequencing (Macrogen, Inc., Seoul, Korea) in both directions using forward (OL559) and reverse (OL408) primers.

    Techniques: Expressing, Binding Assay

    Sequence comparison between MYCN upstream and ACE3 , and transcription factor binding sites in MYCN upstream. (A) A 1,020 bp DNA sequence (top; bases 1–1,020) encompassing ACE3 from Drosophila melanogaster chorion gene cluster and a DNA sequence of ~65 kb (bottom) containing MYCN (bases 2,416,201 to 2,481,180) from human chromosome 2 genomic contig were compared using the LFASTAn program. (B) Using the TFSEARCH program, putative c-Myb and E2F1 binding sites upstream (−1,021 to −143) of human MYCN gene were detected. MYCN, MYCN proto-oncogene bHLH transcription factor ; ACE3, amplification-control-element-on-3 ; c-Myb, transcriptional activator Myb; E2F1, E2F transcription factor 1.

    Journal: Molecular Medicine Reports

    Article Title: MYCN is amplified during S phase, and c-myb is involved in controlling MYCN expression and amplification in MYCN-amplified neuroblastoma cell lines

    doi: 10.3892/mmr.2018.9686

    Figure Lengend Snippet: Sequence comparison between MYCN upstream and ACE3 , and transcription factor binding sites in MYCN upstream. (A) A 1,020 bp DNA sequence (top; bases 1–1,020) encompassing ACE3 from Drosophila melanogaster chorion gene cluster and a DNA sequence of ~65 kb (bottom) containing MYCN (bases 2,416,201 to 2,481,180) from human chromosome 2 genomic contig were compared using the LFASTAn program. (B) Using the TFSEARCH program, putative c-Myb and E2F1 binding sites upstream (−1,021 to −143) of human MYCN gene were detected. MYCN, MYCN proto-oncogene bHLH transcription factor ; ACE3, amplification-control-element-on-3 ; c-Myb, transcriptional activator Myb; E2F1, E2F transcription factor 1.

    Article Snippet: The shRNA sequences of c-myb and EGFP vectors were confirmed by plasmid DNA sequencing (Macrogen, Inc., Seoul, Korea) in both directions using forward (OL559) and reverse (OL408) primers.

    Techniques: Sequencing, Binding Assay, Amplification

    The effect of c- myb RNAi treatment on MYCN gene copy number. (A) Interference rate of c- myb mRNA was presented as compared with shRNA controls in MYCN -amplified neuroblastoma cell lines. The expression levels of c- myb mRNA were determined pre- and post-c- myb RNAi treatment of Kelly, SIMA, MHH-NB-11 and IMR32 cell lines, as normalized to the Cp values of target and reference genes of the SH-SY5Y control cell line. R-value was calculated using the mean Cp ± standard error of duplicate or triplicate experiments in case of discordant results. (B) MYCN / p53 DNA copy number ratios were determined by the delta-delta Cp method pre- and post-c- myb RNAi treatment as compared with shRNA control in MYCN -amplified neuroblastoma cell lines. Data are expressed as mean Cp ± standard error of the mean from ≥6 independent experiments. *P

    Journal: Molecular Medicine Reports

    Article Title: MYCN is amplified during S phase, and c-myb is involved in controlling MYCN expression and amplification in MYCN-amplified neuroblastoma cell lines

    doi: 10.3892/mmr.2018.9686

    Figure Lengend Snippet: The effect of c- myb RNAi treatment on MYCN gene copy number. (A) Interference rate of c- myb mRNA was presented as compared with shRNA controls in MYCN -amplified neuroblastoma cell lines. The expression levels of c- myb mRNA were determined pre- and post-c- myb RNAi treatment of Kelly, SIMA, MHH-NB-11 and IMR32 cell lines, as normalized to the Cp values of target and reference genes of the SH-SY5Y control cell line. R-value was calculated using the mean Cp ± standard error of duplicate or triplicate experiments in case of discordant results. (B) MYCN / p53 DNA copy number ratios were determined by the delta-delta Cp method pre- and post-c- myb RNAi treatment as compared with shRNA control in MYCN -amplified neuroblastoma cell lines. Data are expressed as mean Cp ± standard error of the mean from ≥6 independent experiments. *P

    Article Snippet: The shRNA sequences of c-myb and EGFP vectors were confirmed by plasmid DNA sequencing (Macrogen, Inc., Seoul, Korea) in both directions using forward (OL559) and reverse (OL408) primers.

    Techniques: shRNA, Amplification, Expressing

    Schematic diagram depicting a restriction map of a 5.6-kb HindIII fragment of E. faecium JS79 DNA containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Characterization of Two Newly Identified Genes, vgaD and vatG, Conferring Resistance to Streptogramin A in Enterococcus faecium ▿

    doi: 10.1128/AAC.00798-09

    Figure Lengend Snippet: Schematic diagram depicting a restriction map of a 5.6-kb HindIII fragment of E. faecium JS79 DNA containing two streptogramin A resistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black

    Article Snippet: A 6-kb HindIII fragment of plasmid DNA from Q-D-resistant E. faecium isolate was sequenced by Macrogen Service Center (Macrogen, Seoul, South Korea) and analyzed using DNAStar software version 5.0 to find open reading frames (ORFs).

    Techniques:

    Southern hybridization to identify vatG -containing E. faecium isolates from healthy humans, swine, poultry stool samples, and chicken meat. (A) Agarose gel electrophoresis of HindIII-digested plasmid DNA from E. faecium isolates. (B) Southern hybridization

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Characterization of Two Newly Identified Genes, vgaD and vatG, Conferring Resistance to Streptogramin A in Enterococcus faecium ▿

    doi: 10.1128/AAC.00798-09

    Figure Lengend Snippet: Southern hybridization to identify vatG -containing E. faecium isolates from healthy humans, swine, poultry stool samples, and chicken meat. (A) Agarose gel electrophoresis of HindIII-digested plasmid DNA from E. faecium isolates. (B) Southern hybridization

    Article Snippet: A 6-kb HindIII fragment of plasmid DNA from Q-D-resistant E. faecium isolate was sequenced by Macrogen Service Center (Macrogen, Seoul, South Korea) and analyzed using DNAStar software version 5.0 to find open reading frames (ORFs).

    Techniques: Hybridization, Agarose Gel Electrophoresis, Plasmid Preparation