Structured Review

Addgene inc pl crispr
Monitoring the efficacy of <t>CRISPR-Cas9</t> system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with <t>pL.CRISPR.EFS.GFP-</t> Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.
Pl Crispr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pl crispr/product/Addgene inc
Average 97 stars, based on 1 article reviews
Price from $9.99 to $1999.99
pl crispr - by Bioz Stars, 2022-01
97/100 stars

Images

1) Product Images from "Functional NHE1 expression is critical to blood brain barrier integrity and sumatriptan blood to brain uptake"

Article Title: Functional NHE1 expression is critical to blood brain barrier integrity and sumatriptan blood to brain uptake

Journal: PLoS ONE

doi: 10.1371/journal.pone.0227463

Monitoring the efficacy of CRISPR-Cas9 system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with pL.CRISPR.EFS.GFP- Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.
Figure Legend Snippet: Monitoring the efficacy of CRISPR-Cas9 system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with pL.CRISPR.EFS.GFP- Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.

Techniques Used: CRISPR, Infection, Western Blot, Plasmid Preparation

2) Product Images from "The dynamic landscape of open chromatin during human cortical neurogenesis"

Article Title: The dynamic landscape of open chromatin during human cortical neurogenesis

Journal: Cell

doi: 10.1016/j.cell.2017.12.014

Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P
Figure Legend Snippet: Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P

Techniques Used: Derivative Assay, Hi-C, Expressing, Translocation Assay, Functional Assay, Infection, FACS, Polymerase Chain Reaction, CRISPR, Real-time Polymerase Chain Reaction

3) Product Images from "Neuron-Specific Gene 2 (NSG2) Encodes an AMPA Receptor Interacting Protein That Modulates Excitatory Neurotransmission"

Article Title: Neuron-Specific Gene 2 (NSG2) Encodes an AMPA Receptor Interacting Protein That Modulates Excitatory Neurotransmission

Journal: eNeuro

doi: 10.1523/ENEURO.0292-18.2018

Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).
Figure Legend Snippet: Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).

Techniques Used: Knock-Out, Transduction, CRISPR, Patch Clamp, Expressing, Marker, Immunofluorescence, Fluorescence

4) Product Images from "CRISPR Gene Editing of Murine Blood Stem and Progenitor Cells Induces MLL-AF9 Chromosomal Translocation and MLL-AF9 LeukaemogenesisEfficient and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler [ and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler ["

Article Title: CRISPR Gene Editing of Murine Blood Stem and Progenitor Cells Induces MLL-AF9 Chromosomal Translocation and MLL-AF9 LeukaemogenesisEfficient and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler [ and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler [

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms21124266

Design and validation of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 gene editing tools targeting murine mixed lineage leukaemia ( Mll ) and Af9 genes: ( A ) Schematic representation of partial Mll and Af9 genomic regions with sgRNA location. Four guides were designed targeting either introns 8 and 9 ( Mll sg1 and -2) or introns 10 and 11 ( Mll sg3 and -4) of the Mll gene, and three were designed to target introns 8 and 9 (AF9 sg1–3) of Af9. sgRNA locations/Cas9 cleavage sites are shown in orange. Red ( Mll ) and green ( Af9 ) arrows represent PCR primers flanking cleavage sites. Blue and purple arrows represent RT-PCR primers on MLL and AF9 transcripts, respectively. ( B ) Representation of two predicted Mll-Af9 fusion gene products following editing with either set of Mll and Af9 -targeting sgRNAs. ( C ) Surveyor assay of 32D cells transduced with a CRISPR vector expressing the indicated sgRNAs. PCR was performed on genomic DNA from transfected GFP + cell populations using primers as indicated in Figure 1 A. Products were assayed by the surveyor and analysed by 2% gel electrophoresis. Percentage indel formation was calculated by quantification of each DNA band. Cells transduced with an empty CRISPR vector (Cas9 only) were used as the control sample for each.
Figure Legend Snippet: Design and validation of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 gene editing tools targeting murine mixed lineage leukaemia ( Mll ) and Af9 genes: ( A ) Schematic representation of partial Mll and Af9 genomic regions with sgRNA location. Four guides were designed targeting either introns 8 and 9 ( Mll sg1 and -2) or introns 10 and 11 ( Mll sg3 and -4) of the Mll gene, and three were designed to target introns 8 and 9 (AF9 sg1–3) of Af9. sgRNA locations/Cas9 cleavage sites are shown in orange. Red ( Mll ) and green ( Af9 ) arrows represent PCR primers flanking cleavage sites. Blue and purple arrows represent RT-PCR primers on MLL and AF9 transcripts, respectively. ( B ) Representation of two predicted Mll-Af9 fusion gene products following editing with either set of Mll and Af9 -targeting sgRNAs. ( C ) Surveyor assay of 32D cells transduced with a CRISPR vector expressing the indicated sgRNAs. PCR was performed on genomic DNA from transfected GFP + cell populations using primers as indicated in Figure 1 A. Products were assayed by the surveyor and analysed by 2% gel electrophoresis. Percentage indel formation was calculated by quantification of each DNA band. Cells transduced with an empty CRISPR vector (Cas9 only) were used as the control sample for each.

Techniques Used: CRISPR, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Transduction, Plasmid Preparation, Expressing, Transfection, Nucleic Acid Electrophoresis

Endogenous generation of MLL-AF9 (MA9) translocation in murine haematopoietic cells: ( A ) Workflow schematic for generation of t(4;9) translocated 32D HSPCs. Cells were transduced with single or dual CRISPR/Cas9 lentivirus and sorted for GFP at day 5 for downstream analysis. ( B ) Flow cytometry histograms showing percentage of GFP + cells at day 5 post-transduction. ( C ) Validation of genomic MA9 translocation: Genomic DNA was extracted from sorted GFP + populations and PCR amplified using primers flanking the MA9 breakpoint. PCR products were then resolved by agarose gel electrophoresis. ( D ) Sanger sequencing of the PCR product from the sg2/sg3 sample (red “ b ” arrow, part C ): Alignment of the sequence to reference genome verified the alignment with murine Mll and Af9 . ( E ) RT-PCR analysis of the MA9 breakpoint region verifying MA9 translocation at RNA resolution: cDNA was reverse transcribed from RNA and PCR amplified using primers flanking the MA9 breakpoint. ( F ) Sanger sequencing of the sg2/sg3 RT-PCR product: Alignment of the sequence to reference RNA showed alignment to murine Mll and Af9 transcripts.
Figure Legend Snippet: Endogenous generation of MLL-AF9 (MA9) translocation in murine haematopoietic cells: ( A ) Workflow schematic for generation of t(4;9) translocated 32D HSPCs. Cells were transduced with single or dual CRISPR/Cas9 lentivirus and sorted for GFP at day 5 for downstream analysis. ( B ) Flow cytometry histograms showing percentage of GFP + cells at day 5 post-transduction. ( C ) Validation of genomic MA9 translocation: Genomic DNA was extracted from sorted GFP + populations and PCR amplified using primers flanking the MA9 breakpoint. PCR products were then resolved by agarose gel electrophoresis. ( D ) Sanger sequencing of the PCR product from the sg2/sg3 sample (red “ b ” arrow, part C ): Alignment of the sequence to reference genome verified the alignment with murine Mll and Af9 . ( E ) RT-PCR analysis of the MA9 breakpoint region verifying MA9 translocation at RNA resolution: cDNA was reverse transcribed from RNA and PCR amplified using primers flanking the MA9 breakpoint. ( F ) Sanger sequencing of the sg2/sg3 RT-PCR product: Alignment of the sequence to reference RNA showed alignment to murine Mll and Af9 transcripts.

Techniques Used: Translocation Assay, Transduction, CRISPR, Flow Cytometry, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Sequencing, Reverse Transcription Polymerase Chain Reaction

5) Product Images from "The dynamic landscape of open chromatin during human cortical neurogenesis"

Article Title: The dynamic landscape of open chromatin during human cortical neurogenesis

Journal: Cell

doi: 10.1016/j.cell.2017.12.014

Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P
Figure Legend Snippet: Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P

Techniques Used: Derivative Assay, Hi-C, Expressing, Translocation Assay, Functional Assay, Infection, FACS, Polymerase Chain Reaction, CRISPR, Real-time Polymerase Chain Reaction

6) Product Images from "Follistatin is a novel therapeutic target and biomarker in FLT3/ ITD acute myeloid leukemia"

Article Title: Follistatin is a novel therapeutic target and biomarker in FLT3/ ITD acute myeloid leukemia

Journal: EMBO Molecular Medicine

doi: 10.15252/emmm.201910895

FLT 3 / ITD upregulated FST through phosphorylation of CREB In silico analysis (DECipherment of DNA Elements, SABiosciences) and schematic model of transcription factor binding sites on human FST promoter. CBP: CREB‐binding protein; CRE: cAMP‐response element; TSS: transcription start site. The direct binding of p‐CREB to human FST promoter was detected by ChIP‐PCR (B) and ChIP‐qPCR (C). c‐Fos was used as positive control of p‐CREB target gene. Normal IgG was used as negative control of ChIP. Dual‐luciferase assay demonstrating the direct binding of p‐CREB on human FST promoter. pRL‐CMV, Renilla luciferase vector; pGL‐CRE− and pGL‐CRE+, firefly luciferase expression driven by human FST promoter with deleted CRE site (CRE−) or wild type (CRE+); p‐GFPSpark, GFP‐expressing vector; p‐CREB Y134F , CREB Y134F ‐GFP‐expressing vector. FST expression and FLT3 /ITD signaling were detected by Western blotting in Ba/F3‐parental (P in short) and Ba/F3‐ FLT3 /ITD (ITD in short) cells. Phospho‐flow analysis of p‐CREB in Ba/F3‐parental, Ba/F3‐ FLT3 /ITD, and Ba/F3‐ FLT3 /ITD cells treated with FLT3 inhibitor quizartinib (Qui in short). Isotype antibody was used as control to calculate the mean fluorescence intensity (MFI) ratio (F, G). The transcription and expression of Fst were detected by RT–qPCR after quizartinib treatment (10 nM) in Ba/F3‐ FLT3 /ITD cells for 1 day (H). The expression of FST and phosphorylation of CREB were detected by Western blotting (I and K) and phospho‐flow analysis (J) in MOLM‐13 (I) and Ba/F3‐ FLT3 /ITD (K) cells treated with quizartinib and BRD7389 for 1 day, respectively. RSK expression and FST expression were detected by Western blotting after p90RSK knockout by CRISPR/Cas9 in MOLM‐13 cells. The phosphorylation of CREB and FST expression was detected by Western blotting in Ba/F3‐ FLT3 /ITD cells treated with CREB inhibitor 666‐15 for 1 day. ^: non‐specific staining of p‐ATF1 protein due to the conserved motif. CREB expression and FST expression were detected by Western blotting after CREB knockout by CRISPR/Cas9 in MOLM‐13 cells. The growth of Ba/F3‐parental (with IL‐3), Ba/F3‐ FLT3 /ITD (without IL‐3), and Ba/F3‐ FLT3 /ITD (with IL‐3) cells was measured after 3 days treatment of CREB inhibitor 666‐15 in vitro . The rescue effect of CREB inhibitor 666‐15 on FLT3 /ITD‐induced dorsalization and axis duplication in zebrafish embryos at 1 dpf. Data information: In (C, D, G, H, J, and O), the experiments were performed in triplicates, and the data were presented as mean ± SEM. ** P
Figure Legend Snippet: FLT 3 / ITD upregulated FST through phosphorylation of CREB In silico analysis (DECipherment of DNA Elements, SABiosciences) and schematic model of transcription factor binding sites on human FST promoter. CBP: CREB‐binding protein; CRE: cAMP‐response element; TSS: transcription start site. The direct binding of p‐CREB to human FST promoter was detected by ChIP‐PCR (B) and ChIP‐qPCR (C). c‐Fos was used as positive control of p‐CREB target gene. Normal IgG was used as negative control of ChIP. Dual‐luciferase assay demonstrating the direct binding of p‐CREB on human FST promoter. pRL‐CMV, Renilla luciferase vector; pGL‐CRE− and pGL‐CRE+, firefly luciferase expression driven by human FST promoter with deleted CRE site (CRE−) or wild type (CRE+); p‐GFPSpark, GFP‐expressing vector; p‐CREB Y134F , CREB Y134F ‐GFP‐expressing vector. FST expression and FLT3 /ITD signaling were detected by Western blotting in Ba/F3‐parental (P in short) and Ba/F3‐ FLT3 /ITD (ITD in short) cells. Phospho‐flow analysis of p‐CREB in Ba/F3‐parental, Ba/F3‐ FLT3 /ITD, and Ba/F3‐ FLT3 /ITD cells treated with FLT3 inhibitor quizartinib (Qui in short). Isotype antibody was used as control to calculate the mean fluorescence intensity (MFI) ratio (F, G). The transcription and expression of Fst were detected by RT–qPCR after quizartinib treatment (10 nM) in Ba/F3‐ FLT3 /ITD cells for 1 day (H). The expression of FST and phosphorylation of CREB were detected by Western blotting (I and K) and phospho‐flow analysis (J) in MOLM‐13 (I) and Ba/F3‐ FLT3 /ITD (K) cells treated with quizartinib and BRD7389 for 1 day, respectively. RSK expression and FST expression were detected by Western blotting after p90RSK knockout by CRISPR/Cas9 in MOLM‐13 cells. The phosphorylation of CREB and FST expression was detected by Western blotting in Ba/F3‐ FLT3 /ITD cells treated with CREB inhibitor 666‐15 for 1 day. ^: non‐specific staining of p‐ATF1 protein due to the conserved motif. CREB expression and FST expression were detected by Western blotting after CREB knockout by CRISPR/Cas9 in MOLM‐13 cells. The growth of Ba/F3‐parental (with IL‐3), Ba/F3‐ FLT3 /ITD (without IL‐3), and Ba/F3‐ FLT3 /ITD (with IL‐3) cells was measured after 3 days treatment of CREB inhibitor 666‐15 in vitro . The rescue effect of CREB inhibitor 666‐15 on FLT3 /ITD‐induced dorsalization and axis duplication in zebrafish embryos at 1 dpf. Data information: In (C, D, G, H, J, and O), the experiments were performed in triplicates, and the data were presented as mean ± SEM. ** P

Techniques Used: In Silico, Binding Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Positive Control, Negative Control, Luciferase, Plasmid Preparation, Expressing, Western Blot, Fluorescence, Quantitative RT-PCR, Knock-Out, CRISPR, Staining, In Vitro

7) Product Images from "Neuron-Specific Gene 2 (NSG2) Encodes an AMPA Receptor Interacting Protein That Modulates Excitatory Neurotransmission"

Article Title: Neuron-Specific Gene 2 (NSG2) Encodes an AMPA Receptor Interacting Protein That Modulates Excitatory Neurotransmission

Journal: eNeuro

doi: 10.1523/ENEURO.0292-18.2018

Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p = 0.34). Data in the KO group were derived only from neurons devoid of NSG2 confirmed by post-recording immunostaining of Lucifer yellow injected neurons (Extended Data Fig. 4-1 ). NSG2 KO did not alter outward potassium I/V relationship (Extended Data Fig. 4-2 ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).
Figure Legend Snippet: Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p = 0.34). Data in the KO group were derived only from neurons devoid of NSG2 confirmed by post-recording immunostaining of Lucifer yellow injected neurons (Extended Data Fig. 4-1 ). NSG2 KO did not alter outward potassium I/V relationship (Extended Data Fig. 4-2 ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).

Techniques Used: Knock-Out, Transduction, CRISPR, Patch Clamp, Expressing, Derivative Assay, Immunostaining, Injection, Marker, Immunofluorescence, Fluorescence

8) Product Images from "Green Transfection: Cationic Lipid Nanocarrier System Derivatized from Vegetable Fat, Palmstearin Enhances Nucleic Acid Transfections"

Article Title: Green Transfection: Cationic Lipid Nanocarrier System Derivatized from Vegetable Fat, Palmstearin Enhances Nucleic Acid Transfections

Journal: ACS Omega

doi: 10.1021/acsomega.7b00935

Delivery of all-in-one CRISPR plasmid. Lipoplexes of PS-Lips and P-Lip with pL-CRISPR.EFS.GFP were transfected in HEK-293 cells at a 2:1 lipid to DNA charge ratio; images were obtained using an inverted fluorescence microscope, and quantification data were obtained by flow cytometric analysis.
Figure Legend Snippet: Delivery of all-in-one CRISPR plasmid. Lipoplexes of PS-Lips and P-Lip with pL-CRISPR.EFS.GFP were transfected in HEK-293 cells at a 2:1 lipid to DNA charge ratio; images were obtained using an inverted fluorescence microscope, and quantification data were obtained by flow cytometric analysis.

Techniques Used: CRISPR, Plasmid Preparation, Transfection, Fluorescence, Microscopy, Flow Cytometry

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Addgene inc pl crispr
    Monitoring the efficacy of <t>CRISPR-Cas9</t> system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with <t>pL.CRISPR.EFS.GFP-</t> Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.
    Pl Crispr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pl crispr/product/Addgene inc
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pl crispr - by Bioz Stars, 2022-01
    97/100 stars
      Buy from Supplier

    98
    Addgene inc pl crispr efs gfp
    Decreased Npas4 expression in APP-silenced primary neurons APP was knock-down by <t>CRISPR-Cas9</t> approach in primary neurons cultures. A ) Cortical neurons were infected at DIV1 with lentiviruses expressing sgRNAs (Oligo2, Oligo17) or no sgRNA (Ct), SpCas9 and <t>GFP.</t> Cultures were immunostained for MAP2 (red), APP (blue) and DAPI (light blue) at DIV7. Arrowheads indicate the position of GFP-positive (infected) neurons in each condition. Scale bar: 100µm. B ) Quantification of APP signal in GFP-positive neurons. At least 33 neurons were quantified in two independent experiments for each condition (n=33 N=2). Results (mean ± SEM) are given as percentage of control (Ct). ###p
    Pl Crispr Efs Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pl crispr efs gfp/product/Addgene inc
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pl crispr efs gfp - by Bioz Stars, 2022-01
    98/100 stars
      Buy from Supplier

    Image Search Results


    Monitoring the efficacy of CRISPR-Cas9 system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with pL.CRISPR.EFS.GFP- Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.

    Journal: PLoS ONE

    Article Title: Functional NHE1 expression is critical to blood brain barrier integrity and sumatriptan blood to brain uptake

    doi: 10.1371/journal.pone.0227463

    Figure Lengend Snippet: Monitoring the efficacy of CRISPR-Cas9 system in bEnd.3 cells. ( A ) Representative images of bEnd.3 cells infected with pL.CRISPR.EFS.GFP- Slc9A1 sgRNA show GFP-positive cells 72 hours after post-infection. ( B ) Representative immunoblots indicating NHE1 and α-tubulin as a loading control in the whole cell lysate of gene-edited bEnd.3 cells. Values represent the % of empty vector control ± SEM (n = 9–10). *** p = 0.0002, as assessed by unpaired t-test.

    Article Snippet: The sgRNA selected for targeting SLC9A1 exon 1 is located on the forward strand: ATCTTCCCCTCCTTGCTGG , score 86. pL-CRISPR.EFS.GFP (Addgene, 57818) was used as a backbone vector for simultaneous expression of Cas9 enzyme with the sgRNA and GFP to control for the infection efficiency.

    Techniques: CRISPR, Infection, Western Blot, Plasmid Preparation

    Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P

    Journal: Cell

    Article Title: The dynamic landscape of open chromatin during human cortical neurogenesis

    doi: 10.1016/j.cell.2017.12.014

    Figure Lengend Snippet: Mapping DREs involved in cortical neurogenesis to their cognate genes. (A) A schematic showing chromatin accessibility correlation and chromatin interaction assays used to map DREs to their cognate genes. (B) Distal ATAC-seq peaks show on average a higher correlation to promoter peaks when supported by chromatin interaction derived from their cognate GZ or CP tissue. GZ > CP and CP > GZ peaks show significantly higher peak correlation when supported by GZ or CP Hi-C data as compared to the absence of Hi-C support, respectively (GZ: P=1.1×10 -100 , CP: P=3.22×10 -34 ). (C) The correlation between DREs accessibility and gene expression of their cognate gene shows a stronger relationship when the regulatory element is mapped using both chromatin accessibility correlation and interaction rather than chromatin accessibility correlation alone. (D) . (E) An example of DRE mapping is provided at the EOMES locus, where DREs are supported by both chromatin interaction via Hi-C in GZ tissue and chromatin accessibility correlation. The location of a chromosomal breakpoint for a balanced chromosomal translocation that leads to complete absence of EOMES ). (F) Three distinct sgRNA pairs were designed to excise the EOMES enhancer. Overlap of ATAC-seq differential peak and predicted VISTA forebrain enhancer is shown. Primers used to validate genomic deletions are represented by green half arrows. (G) Schematic of functional validation of EOMES enhancer. sgRNA pairs flanking the EOMES enhancer were delivered along with P2A-linked GFP or RFP Cas9 via lentiviral infection into phNPCs. Following 3 wks of differentiation, cells containing both sgRNAs were selected via FACS and probed for enhancer excision and EOMES expression. (H) Genomic PCR of the 1.8kb region containing the EOMES enhancer in control or CRISPR/Cas9 + sgRNA infected phNPCs. Red arrow points to the expected 2107bp band in controls and white arrows point to expected products following excision (see 3F). (I) Excision of the EOMES enhancer led to a 72-77% reduction in EOMES expression as measured by qPCR in phNPCs (***P

    Article Snippet: A. Knowles (USC), C. Liu (UIC), D. Pinto (ISMMS), N. Sestan (Yale), P. Sklar (ISMMS), M. State (UCSF), P. Sullivan (UNC), F. Vaccarino (Yale), S. Weissman (Yale), K. White (UChicago) and P. Zandi (JHU). pL-CRISPR.EFS.GFP and pL-CRISPR.EFS.tRFP plasmids were a gift from Benjamin Ebert.

    Techniques: Derivative Assay, Hi-C, Expressing, Translocation Assay, Functional Assay, Infection, FACS, Polymerase Chain Reaction, CRISPR, Real-time Polymerase Chain Reaction

    Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).

    Journal: eNeuro

    Article Title: Neuron-Specific Gene 2 (NSG2) Encodes an AMPA Receptor Interacting Protein That Modulates Excitatory Neurotransmission

    doi: 10.1523/ENEURO.0292-18.2018

    Figure Lengend Snippet: Knock-out of NSG2 decreases mEPSC frequency. A , Representative confocal images of primary hippocampal neurons at DIV15 showing robust NSG2 (magenta) in MAP2 + (blue) neurons transduced with control CRISPR GFP lentivirus (cyan; top panels), whereas neurons transduced with CRISPR KO NSG2 lentivirus (cyan, bottom panels) show the absence of NSG2 (arrow; bottom panels); NSG2 (magenta) is present in an adjacent neuron not transduced with the CRISPR KO NSG2 lentivirus in the same field (arrowhead; bottom panels). B , Representative traces from whole-cell patch clamp recordings from neurons expressing either control CRISPR GFP (upper trace, black) or CRISPR KO NSG2 (bottom trace, green). Averaged mEPSCs from both control (black, n = 10) and NSG2 KO (green, n = 13) are shown to the right. C , Pooled data revealed a significant decrease in mEPSC frequency in neurons expressing NSG2 KO compared to cells expressing control CRISPR GFP (** p = 0.001). The amplitude of mEPSCs was not significantly different between groups ( p ). D , Quantification of presynaptic marker Synapsin1 + punctae (control, n = 10; NSG2 KO, n = 10; p = 0.46) and postsynaptic marker PSD95 + punctae (control, n = 9; NSG2 KO, n = 11; p = 0.18). E , Representative confocal images illustrate PSD95 immunofluorescence (cyan) in neurons expressing CRISPR KO NSG2 (right panels) or controls CRISPR GFP (left panels). GFP expression from both groups (top panels) is presented in grayscale for clarity. Quantification revealed a significant reduction in PSD95 fluorescence intensity in neurons expressing NSG2 KO ( n = 11) compared to controls ( n = 9; * p = 0.029). F , Pooled data show that the number of surface GluA1 + punctae (left; control, n = 10 and NSG2 KO, n = 9; p = 0.86) and surface GluA2 + punctae (right; control, n = 10 and NSG2 KO, n = 9; p = 0.18) remained unchanged between groups. Bars represent mean ± SEM. Scale bars = 10 μm ( A ) and 1 μm ( E ).

    Article Snippet: ). gRNAs (MsNSG2#1: 5’- GCGTGATGAGAGGGACGGTC -3′ and MsNSG2#2: 5′- CGTCCCTCTCATCACGCCCT -3′) were cloned into pL-Crispr.EFS.GFP (Addgene, catalog #57818) into the BsmBI site as previously suggested ( ).

    Techniques: Knock-Out, Transduction, CRISPR, Patch Clamp, Expressing, Marker, Immunofluorescence, Fluorescence

    Decreased Npas4 expression in APP-silenced primary neurons APP was knock-down by CRISPR-Cas9 approach in primary neurons cultures. A ) Cortical neurons were infected at DIV1 with lentiviruses expressing sgRNAs (Oligo2, Oligo17) or no sgRNA (Ct), SpCas9 and GFP. Cultures were immunostained for MAP2 (red), APP (blue) and DAPI (light blue) at DIV7. Arrowheads indicate the position of GFP-positive (infected) neurons in each condition. Scale bar: 100µm. B ) Quantification of APP signal in GFP-positive neurons. At least 33 neurons were quantified in two independent experiments for each condition (n=33 N=2). Results (mean ± SEM) are given as percentage of control (Ct). ###p

    Journal: bioRxiv

    Article Title: Amyloid Precursor Protein (APP) controls excitatory/inhibitory synaptic inputs by regulating the transcriptional activator Neuronal PAS Domain Protein 4 (NPAS4)

    doi: 10.1101/504340

    Figure Lengend Snippet: Decreased Npas4 expression in APP-silenced primary neurons APP was knock-down by CRISPR-Cas9 approach in primary neurons cultures. A ) Cortical neurons were infected at DIV1 with lentiviruses expressing sgRNAs (Oligo2, Oligo17) or no sgRNA (Ct), SpCas9 and GFP. Cultures were immunostained for MAP2 (red), APP (blue) and DAPI (light blue) at DIV7. Arrowheads indicate the position of GFP-positive (infected) neurons in each condition. Scale bar: 100µm. B ) Quantification of APP signal in GFP-positive neurons. At least 33 neurons were quantified in two independent experiments for each condition (n=33 N=2). Results (mean ± SEM) are given as percentage of control (Ct). ###p

    Article Snippet: pLenti CMV/TO Puro empty (w175-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17482). pL-CRISPR.EFS.GFP (Addgene plasmid # 57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid # 57819) were a gift from Benjamin Ebert. pCMV delta R8.2 (Addgene plasmid # 12263) and pMD2.G (Addgene plasmid # 12259) were a gift from Didier Trono.

    Techniques: Expressing, CRISPR, Infection

    Infectivity and toxicity of lentiviral CRISPR-Cas9 vectors A ) Cortical neurons were infected at DIV1 with lentiviruses expressing sgRNAs (Oligo2, Oligo17 or CRISPR- Npas4 ) or no sgRNA (Ct), SpCas9 and GFP. Cultures were immunostained for MAP2 (red) and DAPI (light blue) at DIV7. Scale bar = 400µm. B ) Quantification of GFP+ neurons (GFP+/MAP2+) in total neuron population (MAP2+) after lentiviral CRISPR-Cas9 infection with control (Ct), Oligo2, Oligo17 or CRISPR- Npas4 . At least five fields were analyzed for each lentiviral vector in two independent experiments (n≥5, N=2). Results are expressed as percentage of GFP+/MAP2+ cells in total MAP2+ cells (mean ± s.e.m). n.s= non-significant, Kruskal-Wallis test and Dunn’s multiple comparison test. C ) Measurement of LDH activity released after infection (DIV7) of primary neuron with control (Ct), Oligo2, Oligo17 or CRISPR- Npas4 at DIV7 lentiviral vectors. Background LDH release was determined in non-infected control cultures (NI). Results were expressed as percentage of total LDH release measured in non-infected control cultures (NI) in 2 independent experiments (n=12, N=2).

    Journal: bioRxiv

    Article Title: Amyloid Precursor Protein (APP) controls excitatory/inhibitory synaptic inputs by regulating the transcriptional activator Neuronal PAS Domain Protein 4 (NPAS4)

    doi: 10.1101/504340

    Figure Lengend Snippet: Infectivity and toxicity of lentiviral CRISPR-Cas9 vectors A ) Cortical neurons were infected at DIV1 with lentiviruses expressing sgRNAs (Oligo2, Oligo17 or CRISPR- Npas4 ) or no sgRNA (Ct), SpCas9 and GFP. Cultures were immunostained for MAP2 (red) and DAPI (light blue) at DIV7. Scale bar = 400µm. B ) Quantification of GFP+ neurons (GFP+/MAP2+) in total neuron population (MAP2+) after lentiviral CRISPR-Cas9 infection with control (Ct), Oligo2, Oligo17 or CRISPR- Npas4 . At least five fields were analyzed for each lentiviral vector in two independent experiments (n≥5, N=2). Results are expressed as percentage of GFP+/MAP2+ cells in total MAP2+ cells (mean ± s.e.m). n.s= non-significant, Kruskal-Wallis test and Dunn’s multiple comparison test. C ) Measurement of LDH activity released after infection (DIV7) of primary neuron with control (Ct), Oligo2, Oligo17 or CRISPR- Npas4 at DIV7 lentiviral vectors. Background LDH release was determined in non-infected control cultures (NI). Results were expressed as percentage of total LDH release measured in non-infected control cultures (NI) in 2 independent experiments (n=12, N=2).

    Article Snippet: pLenti CMV/TO Puro empty (w175-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17482). pL-CRISPR.EFS.GFP (Addgene plasmid # 57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid # 57819) were a gift from Benjamin Ebert. pCMV delta R8.2 (Addgene plasmid # 12263) and pMD2.G (Addgene plasmid # 12259) were a gift from Didier Trono.

    Techniques: Infection, CRISPR, Expressing, Plasmid Preparation, Activity Assay