phusiontm site directed mutagenesis kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion Site Directed Mutagenesis Kit
    Description:
    Thermo Scientific Phusion Site Directed Mutagenesis Kit is a versatile and efficient tool for introducing point mutations insertions or deletions in any type of plasmid DNA With this kit the entire plasmid is amplified using phosphorylated primers that introduce the desired changes The amplified linear PCR product containing the desired mutation is circularized in a 5 minute ligation reaction with T4 DNA Ligase The resulting plasmid can be then transformed into any competent E coli cells The optimal annealing temperature for Phusion DNA Polymerases may differ significantly from that of Taq based polymerases For optimal results start by accurately calculating your Tm with our Tm calculator Highlights• Robust and reliable exponential amplification method• No requirements such as special vectors restriction sites or methylation status for the target plasmid• No need to destroy the starting template in a separate step• Phusion Hot Start II High Fidelity DNA Polymerase minimizes unwanted secondary mutations• Amplification of large plasmids up to 10 kb• Hot start modification of the polymerase prevents amplification of non specific products and unwanted degradation of primers prior to first cycle of PCR• T4 DNA Ligase included in the kit no purification steps before or after ligation• Compatible with all strains of competent E coli cells
    Catalog Number:
    f541
    Price:
    None
    Applications:
    Cloning|Mutagenesis
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher phusiontm site directed mutagenesis kit
    Thermo Scientific Phusion Site Directed Mutagenesis Kit is a versatile and efficient tool for introducing point mutations insertions or deletions in any type of plasmid DNA With this kit the entire plasmid is amplified using phosphorylated primers that introduce the desired changes The amplified linear PCR product containing the desired mutation is circularized in a 5 minute ligation reaction with T4 DNA Ligase The resulting plasmid can be then transformed into any competent E coli cells The optimal annealing temperature for Phusion DNA Polymerases may differ significantly from that of Taq based polymerases For optimal results start by accurately calculating your Tm with our Tm calculator Highlights• Robust and reliable exponential amplification method• No requirements such as special vectors restriction sites or methylation status for the target plasmid• No need to destroy the starting template in a separate step• Phusion Hot Start II High Fidelity DNA Polymerase minimizes unwanted secondary mutations• Amplification of large plasmids up to 10 kb• Hot start modification of the polymerase prevents amplification of non specific products and unwanted degradation of primers prior to first cycle of PCR• T4 DNA Ligase included in the kit no purification steps before or after ligation• Compatible with all strains of competent E coli cells
    https://www.bioz.com/result/phusiontm site directed mutagenesis kit/product/Thermo Fisher
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    phusiontm site directed mutagenesis kit - by Bioz Stars, 2020-05
    99/100 stars

    Images

    Related Articles

    Polyacrylamide Gel Electrophoresis:

    Article Title: Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification
    Article Snippet: .. Site-directed mutagenesis of OsDJ-1C, expression and purification of the mutein Mutagenesis of OsDJ-1C gene (Cysteine 119 residue to Alanine) was carried out using special 5′phosphorylated PAGE purified primers (forward 5′GCATCAGTTGCCCATGGACAGT3′ and reverse 5′AATAGGTTTCTTCGCATCAGAG 3′) and OsDJ-1C _pET28a plasmid as the template according to manufacturer’s protocol (Phusion site directed mutagenesis kit, Finnzymes, Finland). .. Mutation was confirmed by sequencing, followed by expression and purification of the mutein as described above.

    Ligation:

    Article Title: A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering
    Article Snippet: .. Discussion In one of the early PCR-based mutagenesis protocols, WHOPS was performed with non-overlapping phosphorylated primers and was followed by a ligation step prior to transformation of the mutant DNA [ ] - the method became available as the Exsite™ PCR-based Site-Directed Mutagenesis Kit (Stratagene) and a similar product is today available as the Phusion™ Site-directed Mutagenesis Kit (Finnzymes). .. The uracil-excision site-directed mutagenesis approach is very similar.

    Mutagenesis:

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis
    Article Snippet: .. Both New England BioLabs and Thermo Fisher Scientific offer Phusion-based site-directed mutagenesis kits, which use non-overlapping primers for PCR, and the PCR products are ligated by DNA ligase before transformation. .. Our protocol does not need a ligation step.

    Article Title: Cis-Acting Sequence Elements and Upstream Open Reading Frame in Mouse Utrophin-A 5'-UTR Repress Cap-Dependent Translation
    Article Snippet: .. Point mutation at AUG425 in 5'-UTR was done by Phusion Site-Directed Mutagenesis Kit (Thermo Scientific) using oligos ggctagcaggtattcaAgctagcctggaccatttttc and GAAAAATGGTC CAGGCTAGCTTGAATACCTG CTAGCC. .. In vitro transcription All constructs were amplified with a T7 containing forward primer and a T50 tailed reverse primer to prepare templates for in vitro transcription.

    Article Title: Single Mutations in the VP2 300 Loop Region of the Three-Fold Spike of the Carnivore Parvovirus Capsid Can Determine Host Range
    Article Snippet: .. Mutant viruses were prepared using a Phusion site-directed mutagenesis kit (Thermo Scientific, Waltham, MA) according to the manufacturer's instructions. .. Plasmids were transfected into Nordon Laboratory feline kidney (NLFK) cells by use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, and recovered viruses were passaged one additional time in NLFK cells to generate stocks for use in the experimental evolution studies.

    Article Title: N1303K (c.3909C > G) Mutation and Splicing: Implication of Its c.[744-33GATT(6); 869+11C > T] Complex Allele in CFTR Exon 7 Aberrant Splicing
    Article Snippet: .. Directed mutagenesis using specific primers was performed to obtain the different minigenes ( ) using the gene tailor site-directed mutagenesis kit (Invitrogen) and specific primers ( ). .. All hybrid minigene constructs were sequenced to verify the correct insertion of WT and mutated DNA fragments ( ).

    Article Title: Antioxidant-induced INrf2 (Keap1) tyrosine 85 phosphorylation controls the nuclear export and degradation of the INrf2-Cul3-Rbx1 complex to allow normal Nrf2 activation and repression
    Article Snippet: .. Three tyrosine residues (Y74, Y432 and Y764) present in Cul3–V5 were mutated to alanine using a site-directed mutagenesis kit (Invitrogen). .. Mutant Y74A was generated by PCR using the mutant forward primer 5′-AAACATGGAGAAAAGCTCGCCACTGGACTAAGA and reverse primer 5′-GAGCTTTTCTCCATGTTTATGCAAAACCAT.

    Article Title: Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification
    Article Snippet: .. Site-directed mutagenesis of OsDJ-1C, expression and purification of the mutein Mutagenesis of OsDJ-1C gene (Cysteine 119 residue to Alanine) was carried out using special 5′phosphorylated PAGE purified primers (forward 5′GCATCAGTTGCCCATGGACAGT3′ and reverse 5′AATAGGTTTCTTCGCATCAGAG 3′) and OsDJ-1C _pET28a plasmid as the template according to manufacturer’s protocol (Phusion site directed mutagenesis kit, Finnzymes, Finland). .. Mutation was confirmed by sequencing, followed by expression and purification of the mutein as described above.

    Article Title: Catalytic activation of β-arrestin by GPCRs
    Article Snippet: .. N-terminally FLAG-tagged β2AR (341T) and FLAG-tagged β2AR (365T), which was previously described , , were prepared through PCR site-directed mutagenesis (Phusion Site-Directed Mutagenesis Kit, Thermo Scientific). β2AR with an N-terminal FLAG tag and a C-terminal GFP tag was generated by inserting a gBlock (IDT) containing a C-terminal fragment of β2AR, a 12 base pair linker, and GFP using EcoRV and PshAI (NEB). β-arrestin-2-GFP, β-arrestin-2-mApple, and β-arrestin-2-PAmCherry were previously described , . β-arrestin-1-mVenus was a gift from Roger Sunahara (University of California, San Diego). ..

    Article Title: A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering
    Article Snippet: .. Discussion In one of the early PCR-based mutagenesis protocols, WHOPS was performed with non-overlapping phosphorylated primers and was followed by a ligation step prior to transformation of the mutant DNA [ ] - the method became available as the Exsite™ PCR-based Site-Directed Mutagenesis Kit (Stratagene) and a similar product is today available as the Phusion™ Site-directed Mutagenesis Kit (Finnzymes). .. The uracil-excision site-directed mutagenesis approach is very similar.

    Purification:

    Article Title: Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification
    Article Snippet: .. Site-directed mutagenesis of OsDJ-1C, expression and purification of the mutein Mutagenesis of OsDJ-1C gene (Cysteine 119 residue to Alanine) was carried out using special 5′phosphorylated PAGE purified primers (forward 5′GCATCAGTTGCCCATGGACAGT3′ and reverse 5′AATAGGTTTCTTCGCATCAGAG 3′) and OsDJ-1C _pET28a plasmid as the template according to manufacturer’s protocol (Phusion site directed mutagenesis kit, Finnzymes, Finland). .. Mutation was confirmed by sequencing, followed by expression and purification of the mutein as described above.

    FLAG-tag:

    Article Title: Catalytic activation of β-arrestin by GPCRs
    Article Snippet: .. N-terminally FLAG-tagged β2AR (341T) and FLAG-tagged β2AR (365T), which was previously described , , were prepared through PCR site-directed mutagenesis (Phusion Site-Directed Mutagenesis Kit, Thermo Scientific). β2AR with an N-terminal FLAG tag and a C-terminal GFP tag was generated by inserting a gBlock (IDT) containing a C-terminal fragment of β2AR, a 12 base pair linker, and GFP using EcoRV and PshAI (NEB). β-arrestin-2-GFP, β-arrestin-2-mApple, and β-arrestin-2-PAmCherry were previously described , . β-arrestin-1-mVenus was a gift from Roger Sunahara (University of California, San Diego). ..

    Generated:

    Article Title: Catalytic activation of β-arrestin by GPCRs
    Article Snippet: .. N-terminally FLAG-tagged β2AR (341T) and FLAG-tagged β2AR (365T), which was previously described , , were prepared through PCR site-directed mutagenesis (Phusion Site-Directed Mutagenesis Kit, Thermo Scientific). β2AR with an N-terminal FLAG tag and a C-terminal GFP tag was generated by inserting a gBlock (IDT) containing a C-terminal fragment of β2AR, a 12 base pair linker, and GFP using EcoRV and PshAI (NEB). β-arrestin-2-GFP, β-arrestin-2-mApple, and β-arrestin-2-PAmCherry were previously described , . β-arrestin-1-mVenus was a gift from Roger Sunahara (University of California, San Diego). ..

    Expressing:

    Article Title: Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification
    Article Snippet: .. Site-directed mutagenesis of OsDJ-1C, expression and purification of the mutein Mutagenesis of OsDJ-1C gene (Cysteine 119 residue to Alanine) was carried out using special 5′phosphorylated PAGE purified primers (forward 5′GCATCAGTTGCCCATGGACAGT3′ and reverse 5′AATAGGTTTCTTCGCATCAGAG 3′) and OsDJ-1C _pET28a plasmid as the template according to manufacturer’s protocol (Phusion site directed mutagenesis kit, Finnzymes, Finland). .. Mutation was confirmed by sequencing, followed by expression and purification of the mutein as described above.

    Polymerase Chain Reaction:

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis
    Article Snippet: .. Both New England BioLabs and Thermo Fisher Scientific offer Phusion-based site-directed mutagenesis kits, which use non-overlapping primers for PCR, and the PCR products are ligated by DNA ligase before transformation. .. Our protocol does not need a ligation step.

    Article Title: Catalytic activation of β-arrestin by GPCRs
    Article Snippet: .. N-terminally FLAG-tagged β2AR (341T) and FLAG-tagged β2AR (365T), which was previously described , , were prepared through PCR site-directed mutagenesis (Phusion Site-Directed Mutagenesis Kit, Thermo Scientific). β2AR with an N-terminal FLAG tag and a C-terminal GFP tag was generated by inserting a gBlock (IDT) containing a C-terminal fragment of β2AR, a 12 base pair linker, and GFP using EcoRV and PshAI (NEB). β-arrestin-2-GFP, β-arrestin-2-mApple, and β-arrestin-2-PAmCherry were previously described , . β-arrestin-1-mVenus was a gift from Roger Sunahara (University of California, San Diego). ..

    Article Title: A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering
    Article Snippet: .. Discussion In one of the early PCR-based mutagenesis protocols, WHOPS was performed with non-overlapping phosphorylated primers and was followed by a ligation step prior to transformation of the mutant DNA [ ] - the method became available as the Exsite™ PCR-based Site-Directed Mutagenesis Kit (Stratagene) and a similar product is today available as the Phusion™ Site-directed Mutagenesis Kit (Finnzymes). .. The uracil-excision site-directed mutagenesis approach is very similar.

    Transformation Assay:

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis
    Article Snippet: .. Both New England BioLabs and Thermo Fisher Scientific offer Phusion-based site-directed mutagenesis kits, which use non-overlapping primers for PCR, and the PCR products are ligated by DNA ligase before transformation. .. Our protocol does not need a ligation step.

    Article Title: A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering
    Article Snippet: .. Discussion In one of the early PCR-based mutagenesis protocols, WHOPS was performed with non-overlapping phosphorylated primers and was followed by a ligation step prior to transformation of the mutant DNA [ ] - the method became available as the Exsite™ PCR-based Site-Directed Mutagenesis Kit (Stratagene) and a similar product is today available as the Phusion™ Site-directed Mutagenesis Kit (Finnzymes). .. The uracil-excision site-directed mutagenesis approach is very similar.

    Plasmid Preparation:

    Article Title: Presence of unique glyoxalase III proteins in plants indicates the existence of shorter route for methylglyoxal detoxification
    Article Snippet: .. Site-directed mutagenesis of OsDJ-1C, expression and purification of the mutein Mutagenesis of OsDJ-1C gene (Cysteine 119 residue to Alanine) was carried out using special 5′phosphorylated PAGE purified primers (forward 5′GCATCAGTTGCCCATGGACAGT3′ and reverse 5′AATAGGTTTCTTCGCATCAGAG 3′) and OsDJ-1C _pET28a plasmid as the template according to manufacturer’s protocol (Phusion site directed mutagenesis kit, Finnzymes, Finland). .. Mutation was confirmed by sequencing, followed by expression and purification of the mutein as described above.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher scientific offer phusion based site directed mutagenesis kits
    The QuikChange TM method PCR with different high fidelity DNA polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of <t>Phusion;</t> Lane 4, PCR product of Pyrobest; Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).
    Scientific Offer Phusion Based Site Directed Mutagenesis Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 343 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scientific offer phusion based site directed mutagenesis kits/product/Thermo Fisher
    Average 99 stars, based on 343 article reviews
    Price from $9.99 to $1999.99
    scientific offer phusion based site directed mutagenesis kits - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    The QuikChange TM method PCR with different high fidelity DNA polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of Phusion; Lane 4, PCR product of Pyrobest; Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).

    Journal: Nucleic Acids Research

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis

    doi: 10.1093/nar/gku1189

    Figure Lengend Snippet: The QuikChange TM method PCR with different high fidelity DNA polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of Phusion; Lane 4, PCR product of Pyrobest; Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).

    Article Snippet: Both New England BioLabs and Thermo Fisher Scientific offer Phusion-based site-directed mutagenesis kits, which use non-overlapping primers for PCR, and the PCR products are ligated by DNA ligase before transformation.

    Techniques: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Produced, Transformation Assay

    The Phusion-dependent site-directed mutagenesis with different lengths of the overlapping regions. ( A ) The primer pairs are shown with the reverse primers in reverse and overlapping regions aligned, and the mutation is for the deletion of TAA as indicated. ( B ) Gel electrophoresis of the PCR products produced by Phusion. The Phusion PCR was done in 20 μl with 2 ng of pBS-TAA as template and 0.5 μM partially overlapping primers in the Phusion HF buffer. The PCR was done with initial denaturation at 98°C for 3 min, followed by 16, 20 or 25 cycles of denaturizing at 98°C for 25 s, annealing at 69°C for 30 s and extension at 72°C for 90 s, and the final step was incubation at 72°C for 10 min. Three microliters of sample was analyzed. Lanes 1–3, PCR with primers containing 12 nucleotides in the overlapping region (Mut12F/R); 4–6, PCR with primers Mut16F/R; 8–10, PCR with primers Mut20F/R; 11–13, PCR with primers Mut24F/R; 15–17, PCR with primers Mut28F/R. For each primer pair: 1st lane, 16 cycles; 2nd lane, 20 cycles; 3rd lane, 25 cycles. Lanes 7, 14, 18, DNA markers. ( C ) The effects of the homologous lengths and PCR cycles on the mutation efficiency. The PCR was done as described in Figure 3B legend. After PCR and DpnI digestion, 5 μl of the PCR product was used for transformation. All blue colonies were counted. Black column, 16 PCR cycles; gray column, 20 PCR cycles; white column, 25 PCR cycles. The values were the averages of three results with standard deviations. The percentages of blue colonies ranged from 95 to 99%.

    Journal: Nucleic Acids Research

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis

    doi: 10.1093/nar/gku1189

    Figure Lengend Snippet: The Phusion-dependent site-directed mutagenesis with different lengths of the overlapping regions. ( A ) The primer pairs are shown with the reverse primers in reverse and overlapping regions aligned, and the mutation is for the deletion of TAA as indicated. ( B ) Gel electrophoresis of the PCR products produced by Phusion. The Phusion PCR was done in 20 μl with 2 ng of pBS-TAA as template and 0.5 μM partially overlapping primers in the Phusion HF buffer. The PCR was done with initial denaturation at 98°C for 3 min, followed by 16, 20 or 25 cycles of denaturizing at 98°C for 25 s, annealing at 69°C for 30 s and extension at 72°C for 90 s, and the final step was incubation at 72°C for 10 min. Three microliters of sample was analyzed. Lanes 1–3, PCR with primers containing 12 nucleotides in the overlapping region (Mut12F/R); 4–6, PCR with primers Mut16F/R; 8–10, PCR with primers Mut20F/R; 11–13, PCR with primers Mut24F/R; 15–17, PCR with primers Mut28F/R. For each primer pair: 1st lane, 16 cycles; 2nd lane, 20 cycles; 3rd lane, 25 cycles. Lanes 7, 14, 18, DNA markers. ( C ) The effects of the homologous lengths and PCR cycles on the mutation efficiency. The PCR was done as described in Figure 3B legend. After PCR and DpnI digestion, 5 μl of the PCR product was used for transformation. All blue colonies were counted. Black column, 16 PCR cycles; gray column, 20 PCR cycles; white column, 25 PCR cycles. The values were the averages of three results with standard deviations. The percentages of blue colonies ranged from 95 to 99%.

    Article Snippet: Both New England BioLabs and Thermo Fisher Scientific offer Phusion-based site-directed mutagenesis kits, which use non-overlapping primers for PCR, and the PCR products are ligated by DNA ligase before transformation.

    Techniques: Mutagenesis, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Produced, Incubation, Transformation Assay