phusion polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Thermo Fisher phusion polymerase
    Phusion Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 581 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion polymerase/product/Thermo Fisher
    Average 98 stars, based on 581 article reviews
    Price from $9.99 to $1999.99
    phusion polymerase - by Bioz Stars, 2020-01
    98/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Phosphorylation and Proteasome Recognition of the mRNA-Binding Protein Cth2 Facilitates Yeast Adaptation to Iron Deficiency
    Article Snippet: Two copies of the Myc epitope were introduced into a NotI restriction site after the CTH2 start codon to generate a Myc2 -tagged Cth2 allele, which was cloned into pRS413 to obtain pSP886 plasmid. .. All PCR amplifications were performed with the Phusion polymerase (Thermo Fisher Scientific).

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Paragraph title: Cloning and DNA manipulation techniques ... Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology.

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Paragraph title: Cloning ... Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Article Title: Transcription attenuation-derived small RNA rnTrpL regulates tryptophan biosynthesis gene expression in trans
    Article Snippet: .. FastDigest Restriction Endonucleases and Phusion polymerase (Thermo Fischer Scientific) were used routinely for cloning in E. coli JM109 ( ) or E. coli DH5α. .. When pJet1.2/blunt (CloneJet PCR Cloning Kit, Thermo Fischer Scientific) was used for cloning, the inserts were subcloned into the conjugative plasmids pRK4352 , pSRKGm, pSRKTc , or pK18mobsacB ( ).

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: Linear vectors were then digested using Xba I. GST-tagged IP3 R1 sponge or a control fragment was cloned between the Xba I and Hinc II sites into the pUltra-Chili vector. .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′). .. The resulting amplicon, flanked by EcoRI and BamHI sites, was cloned into pEGFP-C1 (Clontech) to generate GFP-tagged MP-GAP.

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: Paragraph title: Cloning ... All PCR reactions were performed using the Phusion polymerase (Invitrogen).

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: Mtb DarG-FL was cloned into a pCOLD-TF (Takara) vector and expressed with an N-terminal 6xHis trigger-factor tag. .. Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific).

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: Linear vectors were then digested using Xba I. GST-tagged IP3 R1 sponge or a control fragment was cloned between the Xba I and Hinc II sites into the pUltra-Chili vector. .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Amplification:

    Article Title: Phosphorylation and Proteasome Recognition of the mRNA-Binding Protein Cth2 Facilitates Yeast Adaptation to Iron Deficiency
    Article Snippet: In all cases, BamHI and XhoI restriction sites were used to clone CTH2 amplified sequences. .. All PCR amplifications were performed with the Phusion polymerase (Thermo Fisher Scientific).

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: .. The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ]. .. After electrophoresis, each PCR fragment was independently purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) and quantified using Picogreen dsDNA quantification kit (Invitrogen).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Splice variants as well as full-length sequences were amplified from cDNA via PCR performed in the Arktik Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA). .. Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: Afterwards, all GFP-tagged constructs were amplified from the vector with primers containing AscI and NheI sites, digested and ligated in pLV.CMV.IRES.puro. .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′).

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: Mycobacterium tuberculosis toxin (Mtb DarT) and antitoxin (Mtb DarG) genes were amplified from a bacmid (a gift from Professor Andrew W. Munro, University of Manchester). .. Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific).

    Picogreen Assay:

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: Genomic DNA was quantified using Quant-iT™ PicoGreen® dsDNA Assay Kit (Invitrogen, Carlsbad, California). .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water.

    Construct:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Several different overlap-directed DNA assembly methods were used to produce constructs described in this work, including SLiCE cloning using DH10B lysate , , in vivo homologous recombination in yeast, and Gibson assembly . .. Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology.

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: Paragraph title: Constructs ... GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′).

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: Both ΔMUC and ΔMUCΔGP38 constructs retained the signal sequences 1 to 117. .. All PCR reactions were performed using the Phusion polymerase (Invitrogen).

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: Paragraph title: Constructs ... Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific).

    Electrophoresis:

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ]. .. After electrophoresis, each PCR fragment was independently purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) and quantified using Picogreen dsDNA quantification kit (Invitrogen).

    Random Hexamer Labeling:

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Sanger sequencing of 6283 C > T mutation Total RNA was extracted from muscle biopsy, and 1 μg was used in cDNA synthesis with random hexamer primers according to standard protocols. .. Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT).

    Expressing:

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Cloning All until now, physiologically occurring spontaneous mRNA splice variants (see Figure ) of the XPF (XPF-201, XPF-003, XPF-202) and XPG (XPG IsoII – VI, XPG-201 and XPG-202) genes were amplified from WT MRC5Vi mRNA and cloned into different expression plasmids: pcDNA3.1(+) (for functional testing), pcDNA3.1(-)mycHisA2 (for protein level analyses), and pcDNA3.1 (+)eGFP (C-terminal, for subcellular localization studies). mRNA was isolated from WT MRC5Vi using the RNeasy Kit from Qiagen. .. Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Modification:

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: The modified M segments lacking the mucin and/or GP38 regions were produced by polymerase chain reaction (PCR). .. All PCR reactions were performed using the Phusion polymerase (Invitrogen).

    Derivative Assay:

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′). .. The resulting amplicon, flanked by EcoRI and BamHI sites, was cloned into pEGFP-C1 (Clontech) to generate GFP-tagged MP-GAP.

    Conjugation Assay:

    Article Title: Transcription attenuation-derived small RNA rnTrpL regulates tryptophan biosynthesis gene expression in trans
    Article Snippet: Paragraph title: Plasmid construction and conjugation ... FastDigest Restriction Endonucleases and Phusion polymerase (Thermo Fischer Scientific) were used routinely for cloning in E. coli JM109 ( ) or E. coli DH5α.

    Ligand Binding Assay:

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Generated:

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′). .. The resulting amplicon, flanked by EcoRI and BamHI sites, was cloned into pEGFP-C1 (Clontech) to generate GFP-tagged MP-GAP.

    DNA Sequencing:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology. .. Correct assemblies were verified by DNA sequencing.

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ]. .. For the preparation of libraries and next-generation sequencing, dsDNA was fragmented by ultrasound with Bioruptor (Diagenode), libraries were prepared using NEXTflex PCR-Free DNA-Seq kit (Bioo Scientific), and then sequenced using a 2 x 300 nucleotides paired-end strategy on the Illumina MiSeq platform.

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: Addition of forked barcoded adapters to the captured molecules was performed using the standard Illumina DNA-Seq library generation protocol with some small modifications. .. A 20 cycle-PCR enrichment was performed using Phusion polymerase (Finnzymes).

    Sequencing:

    Article Title: Transcription attenuation-derived small RNA rnTrpL regulates tryptophan biosynthesis gene expression in trans
    Article Snippet: FastDigest Restriction Endonucleases and Phusion polymerase (Thermo Fischer Scientific) were used routinely for cloning in E. coli JM109 ( ) or E. coli DH5α. .. Insert sequences were analyzed by Sanger sequencing with plasmid-specific primers (sequencing service by Microsynth Seqlab, Göttingen, Germany) prior to conjugation into S. meliloti .

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Paragraph title: Sanger sequencing of 6283 C > T mutation ... Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT).

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: Paired-end adapters for massively parallel sequencing (Illumina) were added as previously described , with the following modifications to the paired end library preparation step (Basic Protocol 2). .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water.

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: A 20 cycle-PCR enrichment was performed using Phusion polymerase (Finnzymes). .. 300 bp libraries were isolated using e-Gel 2% SizeSelect (Invitrogen) and sequenced by HiSeq 2000 (Illumina) and paired-end sequencing of 105 bp reads.

    Sonication:

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: 1 μg of genomic DNA from each sample was sheared by sonication with the following conditions: Duty Cycle 10%, Intensity 5, Cycles per Burst 200, and 135 seconds (Covaris S2 instrument). .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water.

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: Purified, circularized FlcDNAs were resuspended in 130 μL EB and sonicated with a Covaris S220 (4 min, 20% Duty Cycle, Intensity 5, 200 cycles/burst). .. A 20 cycle-PCR enrichment was performed using Phusion polymerase (Finnzymes).

    Binding Assay:

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: Taq DarT was cloned into pBAD33 (a gift from Gareth McVicker, University of Oxford), containing a ribosomal binding site and either N-terminal 6xHis-TEV cleavage site or 6xHis-TEV cleavage site-V5 tags. .. Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific).

    Multiplexing:

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water. .. PCR primers were removed by using 1.8× volume of Agencourt AMPure PCR Purification kit (Agencourt Bioscience Corporation).

    In Vivo:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Several different overlap-directed DNA assembly methods were used to produce constructs described in this work, including SLiCE cloning using DH10B lysate , , in vivo homologous recombination in yeast, and Gibson assembly . .. Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology.

    Mutagenesis:

    Article Title: Phosphorylation and Proteasome Recognition of the mRNA-Binding Protein Cth2 Facilitates Yeast Adaptation to Iron Deficiency
    Article Snippet: Plasmids pSP413 and pSP886 were used as the templates to mutagenize Cth2 residues S64, S65, S68, S70, and C190 by using either the overlapping extension method ( ) or the Phusion site-directed mutagenesis kit (Thermo Fisher Scientific). .. All PCR amplifications were performed with the Phusion polymerase (Thermo Fisher Scientific).

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Paragraph title: Sanger sequencing of 6283 C > T mutation ... Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT).

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: .. Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific). .. Bacterial Culture Conditions Bacteria were grown in Luria-Bertani (LB) broth (Fisher Scientific) with 25 μg/mL chloramphenicol to maintain pBAD33-based plasmids and 50 μg/mL kanamycin to maintain pET28a-based plasmids.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Isolation:

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Cloning All until now, physiologically occurring spontaneous mRNA splice variants (see Figure ) of the XPF (XPF-201, XPF-003, XPF-202) and XPG (XPG IsoII – VI, XPG-201 and XPG-202) genes were amplified from WT MRC5Vi mRNA and cloned into different expression plasmids: pcDNA3.1(+) (for functional testing), pcDNA3.1(-)mycHisA2 (for protein level analyses), and pcDNA3.1 (+)eGFP (C-terminal, for subcellular localization studies). mRNA was isolated from WT MRC5Vi using the RNeasy Kit from Qiagen. .. Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: A 20 cycle-PCR enrichment was performed using Phusion polymerase (Finnzymes). .. 300 bp libraries were isolated using e-Gel 2% SizeSelect (Invitrogen) and sequenced by HiSeq 2000 (Illumina) and paired-end sequencing of 105 bp reads.

    Negative Control:

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: A plasmid with a glutathione S -transferase (GST)-tagged IP3 R1 ligand binding region (226–604 amino acid region) with a point mutation (R441Q: m49) or a negative control plasmid with a point mutation (K508A: m30) was recloned from pEF-GSTm49-IRES-GFP or pEF-GSTm30-IRES-GFP (Iwasaki et al., ; Uchiyama et al., ). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Purification:

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ]. .. After electrophoresis, each PCR fragment was independently purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) and quantified using Picogreen dsDNA quantification kit (Invitrogen).

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT). .. PCR products were purified from agarose gel using QIAquick gel extraction kit (Qiagen).

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water. .. PCR primers were removed by using 1.8× volume of Agencourt AMPure PCR Purification kit (Agencourt Bioscience Corporation).

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: The fragmented DNA was purified with Ampure XP beads and eluted with 20 μL EB. .. A 20 cycle-PCR enrichment was performed using Phusion polymerase (Finnzymes).

    Polymerase Chain Reaction:

    Article Title: Phosphorylation and Proteasome Recognition of the mRNA-Binding Protein Cth2 Facilitates Yeast Adaptation to Iron Deficiency
    Article Snippet: .. All PCR amplifications were performed with the Phusion polymerase (Thermo Fisher Scientific). ..

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: .. Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology. .. Correct assemblies were verified by DNA sequencing.

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: .. The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ]. .. After electrophoresis, each PCR fragment was independently purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) and quantified using Picogreen dsDNA quantification kit (Invitrogen).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Splice variants as well as full-length sequences were amplified from cDNA via PCR performed in the Arktik Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA). .. Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Article Title: Transcription attenuation-derived small RNA rnTrpL regulates tryptophan biosynthesis gene expression in trans
    Article Snippet: FastDigest Restriction Endonucleases and Phusion polymerase (Thermo Fischer Scientific) were used routinely for cloning in E. coli JM109 ( ) or E. coli DH5α. .. When pJet1.2/blunt (CloneJet PCR Cloning Kit, Thermo Fischer Scientific) was used for cloning, the inserts were subcloned into the conjugative plasmids pRK4352 , pSRKGm, pSRKTc , or pK18mobsacB ( ).

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion. ..

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT). .. PCR products were purified from agarose gel using QIAquick gel extraction kit (Qiagen).

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′). .. The resulting amplicon, flanked by EcoRI and BamHI sites, was cloned into pEGFP-C1 (Clontech) to generate GFP-tagged MP-GAP.

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: .. All PCR reactions were performed using the Phusion polymerase (Invitrogen). .. Following PCR, fragments were digested with NotI and BglII and ligated into the pWRG7077 vector.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion. ..

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water. .. PCR primers were removed by using 1.8× volume of Agencourt AMPure PCR Purification kit (Agencourt Bioscience Corporation).

    De-Phosphorylation Assay:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology. .. For dephosphorylation of digested vector backbones Antarctic Phosphatase (New England Biolabs, Frankfurt am Main, Germany) was used.

    cDNA Library Assay:

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′). .. The resulting amplicon, flanked by EcoRI and BamHI sites, was cloned into pEGFP-C1 (Clontech) to generate GFP-tagged MP-GAP.

    Agarose Gel Electrophoresis:

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT). .. PCR products were purified from agarose gel using QIAquick gel extraction kit (Qiagen).

    RNA Extraction:

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: Paragraph title: RNA extraction and next-generation sequencing ... The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ].

    Plasmid Preparation:

    Article Title: Phosphorylation and Proteasome Recognition of the mRNA-Binding Protein Cth2 Facilitates Yeast Adaptation to Iron Deficiency
    Article Snippet: Two copies of the Myc epitope were introduced into a NotI restriction site after the CTH2 start codon to generate a Myc2 -tagged Cth2 allele, which was cloned into pRS413 to obtain pSP886 plasmid. .. All PCR amplifications were performed with the Phusion polymerase (Thermo Fisher Scientific).

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology. .. For dephosphorylation of digested vector backbones Antarctic Phosphatase (New England Biolabs, Frankfurt am Main, Germany) was used.

    Article Title: Transcription attenuation-derived small RNA rnTrpL regulates tryptophan biosynthesis gene expression in trans
    Article Snippet: Paragraph title: Plasmid construction and conjugation ... FastDigest Restriction Endonucleases and Phusion polymerase (Thermo Fischer Scientific) were used routinely for cloning in E. coli JM109 ( ) or E. coli DH5α.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion. ..

    Article Title: p120-catenin prevents multinucleation through control of MKLP1-dependent RhoA activity during cytokinesis
    Article Snippet: Afterwards, all GFP-tagged constructs were amplified from the vector with primers containing AscI and NheI sites, digested and ligated in pLV.CMV.IRES.puro. .. GFP-tagged MP-GAP (ARHGAP11A) was generated by PCR using Phusion polymerase (Thermo Fischer Scientific) from a cDNA library derived from U2OS mRNA (kind gift from Susanne Lens) using the following primers (5′-GCTACTCGAGCTATGTGGGATCAGAGGCTG-3′ and 5′-TGCAGGATCCTTACAAATCTACAGGTTTACTTGTTGG-3′).

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: All PCR reactions were performed using the Phusion polymerase (Invitrogen). .. Following PCR, fragments were digested with NotI and BglII and ligated into the pWRG7077 vector.

    Article Title: The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA
    Article Snippet: Mtb DarG-FL was cloned into a pCOLD-TF (Takara) vector and expressed with an N-terminal 6xHis trigger-factor tag. .. Mutations were introduced using site-directed mutagenesis with Phusion polymerase (Thermo Scientific).

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion. ..

    Multiplex Assay:

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: First, the multiplex adapter provided with the Multiplex Paired-End Library Sample Preparation Kit (Illumina) was used instead of the standard paired-end adapter. .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water.

    shRNA:

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: As a control, scrambled shRNA against pLenti-GFP was applied (catalog no. TR30021, Origene). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Article Title: Huntingtin-Associated Protein 1A Regulates Store-Operated Calcium Entry in Medium Spiny Neurons From Transgenic YAC128 Mice, a Model of Huntington’s Disease
    Article Snippet: As a control, scrambled shRNA against pLenti-GFP was applied (catalog no. TR30021, Origene). .. To obtain the GST-tagged IP3 R1 sponge or control fragment in the frame with the pUbe promoter in the pUltra-Chili plasmid, the Xba I restriction site together with the corresponding cytosine on its 3’ end was deleted using PCR with Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and primers for deletion.

    Sample Prep:

    Article Title: High-Throughput Detection of Actionable Genomic Alterations in Clinical Tumor Samples by Targeted, Massively Parallel Sequencing
    Article Snippet: Second, PCR enrichment was conducted in 150 μl total volume with 3 primers from the Multiplexing Sample Preparation Oligonucleotide Kit (Illumina). .. Each PCR enrichment reaction contained 75 μl Phusion polymerase (Finnzymes), 3 μl Multiplexing PE Primer 1.0 (25 μM), 3 μl Multiplexing PE Primer 2.0 (0.5 μM), 3 μl of an Index primer (25 μM), 36 μl paired-end library, and 30 μl nuclease-free water.

    In Vitro:

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: Although non-standardized input concentrations of viral RNA have been used for PCR amplification before NGS, the number of RNA copies/ul of cDNA determined from salivary glands and the virus titres of samples obtained for the in vitro passages indicate that more than 1000 virus RNA copies were used ( and Tables). .. The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ].

    Next-Generation Sequencing:

    Article Title: Comparison of intra- and inter-host genetic diversity in rabies virus during experimental cross-species transmission
    Article Snippet: Paragraph title: RNA extraction and next-generation sequencing ... The complete viral genome (excluding the 3' and 5' extremities, corresponding to the leader and the trailer regions, respectively) was amplified with 6 overlapping PCR fragments by using the Phusion polymerase (ThermoFisher) as described previously [ ].

    Functional Assay:

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Cloning All until now, physiologically occurring spontaneous mRNA splice variants (see Figure ) of the XPF (XPF-201, XPF-003, XPF-202) and XPG (XPG IsoII – VI, XPG-201 and XPG-202) genes were amplified from WT MRC5Vi mRNA and cloned into different expression plasmids: pcDNA3.1(+) (for functional testing), pcDNA3.1(-)mycHisA2 (for protein level analyses), and pcDNA3.1 (+)eGFP (C-terminal, for subcellular localization studies). mRNA was isolated from WT MRC5Vi using the RNeasy Kit from Qiagen. .. Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used according to manufacturer’s instructions.

    Produced:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: .. Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology. .. Correct assemblies were verified by DNA sequencing.

    Article Title: GP38-targeting monoclonal antibodies protect adult mice against lethal Crimean-Congo hemorrhagic fever virus infection
    Article Snippet: ΔMUCΔGP38 was produced using the forward primer 5′-ATCGCTGGGCTCCTCGCTGTGGCTGCCGTGGGTCTC-3′ and reverse primer 3′-GAGACCCACGGCAGCCACAGCGAGGAGCCCAGCGAT-5′, which removed nucleotide regions 120 to 1545. .. All PCR reactions were performed using the Phusion polymerase (Invitrogen).

    Gel Extraction:

    Article Title: Intra‐arterial transplantation of HLA‐matched donor mesoangioblasts in Duchenne muscular dystrophy
    Article Snippet: Subsequently, Phusion polymerase (Thermo Scientific) was used to amplify 544‐bp product with oligos FDMD6283 (5′‐TGCTCCTGACCTCTGTGCTA) and RDMD6283 (5′‐TGACAGCTGTTTGCAGACCT). .. PCR products were purified from agarose gel using QIAquick gel extraction kit (Qiagen).

    Homologous Recombination:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Several different overlap-directed DNA assembly methods were used to produce constructs described in this work, including SLiCE cloning using DH10B lysate , , in vivo homologous recombination in yeast, and Gibson assembly . .. Adjacent pieces for assembly were produced by PCR using Phusion polymerase (Life Technologies GmbH, Darmstadt, Germany) to encode 20–40 bp of terminal homology.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher phusion hot start ii dna polymerase
    Phusion Hot Start Ii Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start ii dna polymerase/product/Thermo Fisher
    Average 90 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    phusion hot start ii dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher phusion high fidelity pcr master mix
    Phusion High Fidelity Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 226 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity pcr master mix/product/Thermo Fisher
    Average 90 stars, based on 226 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity pcr master mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results