phusion polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs phusion polymerase
    Construction of a DENV library with randomized amino acids at position E1690. (A) Diagram showing how the randomization was achieved at the assembly site of two PCR products (dark gray and black) during Gibson ligation. The primer sites for PCR are depicted in letters, while the rest of DNA strands are represented by solid lines. The arrows represent the direction of repair by <t>Phusion</t> polymerase during the assembly reaction. (B) Chromatograms of sequences at prM847, E1690, and NS4B7016 of prM+E+NS4B virus with amino acid randomization at E1690. The randomized position in E and heterogeneous nucleotides in M and NS4B are highlighted in yellow. (C) Comparison between the foci of the DENV library (prM+LibE+NS4B) and the foci of the virus with the same genetic background without randomization at E1690 (prM+E+NS4B). The foci for each virus stock in duplicate wells are shown.
    Phusion Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 962 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion polymerase/product/New England Biolabs
    Average 99 stars, based on 962 article reviews
    Price from $9.99 to $1999.99
    phusion polymerase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput"

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput

    Journal: Journal of Virology

    doi: 10.1128/JVI.02261-13

    Construction of a DENV library with randomized amino acids at position E1690. (A) Diagram showing how the randomization was achieved at the assembly site of two PCR products (dark gray and black) during Gibson ligation. The primer sites for PCR are depicted in letters, while the rest of DNA strands are represented by solid lines. The arrows represent the direction of repair by Phusion polymerase during the assembly reaction. (B) Chromatograms of sequences at prM847, E1690, and NS4B7016 of prM+E+NS4B virus with amino acid randomization at E1690. The randomized position in E and heterogeneous nucleotides in M and NS4B are highlighted in yellow. (C) Comparison between the foci of the DENV library (prM+LibE+NS4B) and the foci of the virus with the same genetic background without randomization at E1690 (prM+E+NS4B). The foci for each virus stock in duplicate wells are shown.
    Figure Legend Snippet: Construction of a DENV library with randomized amino acids at position E1690. (A) Diagram showing how the randomization was achieved at the assembly site of two PCR products (dark gray and black) during Gibson ligation. The primer sites for PCR are depicted in letters, while the rest of DNA strands are represented by solid lines. The arrows represent the direction of repair by Phusion polymerase during the assembly reaction. (B) Chromatograms of sequences at prM847, E1690, and NS4B7016 of prM+E+NS4B virus with amino acid randomization at E1690. The randomized position in E and heterogeneous nucleotides in M and NS4B are highlighted in yellow. (C) Comparison between the foci of the DENV library (prM+LibE+NS4B) and the foci of the virus with the same genetic background without randomization at E1690 (prM+E+NS4B). The foci for each virus stock in duplicate wells are shown.

    Techniques Used: Polymerase Chain Reaction, Ligation

    2) Product Images from "A comprehensive assay for targeted multiplex amplification of human DNA sequences"

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0803240105

    The median CEL intensities for each amplicon obtained by using Stoffel DNA polymerase and Phusion DNA polymerase in the gap-fill reaction are plotted against each other. The CEL intensities that were
    Figure Legend Snippet: The median CEL intensities for each amplicon obtained by using Stoffel DNA polymerase and Phusion DNA polymerase in the gap-fill reaction are plotted against each other. The CEL intensities that were

    Techniques Used: Amplification

    3) Product Images from "A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput"

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput

    Journal: Journal of Virology

    doi: 10.1128/JVI.02261-13

    Construction of a DENV library with randomized amino acids at position E1690. (A) Diagram showing how the randomization was achieved at the assembly site of two PCR products (dark gray and black) during Gibson ligation. The primer sites for PCR are depicted in letters, while the rest of DNA strands are represented by solid lines. The arrows represent the direction of repair by Phusion polymerase during the assembly reaction. (B) Chromatograms of sequences at prM847, E1690, and NS4B7016 of prM+E+NS4B virus with amino acid randomization at E1690. The randomized position in E and heterogeneous nucleotides in M and NS4B are highlighted in yellow. (C) Comparison between the foci of the DENV library (prM+LibE+NS4B) and the foci of the virus with the same genetic background without randomization at E1690 (prM+E+NS4B). The foci for each virus stock in duplicate wells are shown.
    Figure Legend Snippet: Construction of a DENV library with randomized amino acids at position E1690. (A) Diagram showing how the randomization was achieved at the assembly site of two PCR products (dark gray and black) during Gibson ligation. The primer sites for PCR are depicted in letters, while the rest of DNA strands are represented by solid lines. The arrows represent the direction of repair by Phusion polymerase during the assembly reaction. (B) Chromatograms of sequences at prM847, E1690, and NS4B7016 of prM+E+NS4B virus with amino acid randomization at E1690. The randomized position in E and heterogeneous nucleotides in M and NS4B are highlighted in yellow. (C) Comparison between the foci of the DENV library (prM+LibE+NS4B) and the foci of the virus with the same genetic background without randomization at E1690 (prM+E+NS4B). The foci for each virus stock in duplicate wells are shown.

    Techniques Used: Polymerase Chain Reaction, Ligation

    4) Product Images from "Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora"

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085385

    Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.
    Figure Legend Snippet: Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.

    Techniques Used: Clone Assay, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: Paragraph title: Cloning of N. pacificus rhdANP for B. megaterium heterologous expression ... N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB).

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: .. XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Article Title: Structure of PINK1 in complex with its substrate ubiquitin
    Article Snippet: Ubiquitin constructs were cloned into pET17b or into pOPIN-E, Ph PINK1 constructs were cloned into pOPIN-K or pOPIN-S , the Nb696 construct was cloned into a pMESy4 vector. .. Site directed mutagenesis and construct optimisation was carried out using the QuikChange and the InFusion protocol using Phusion polymerase (NEB).

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: Paragraph title: DNA isolation, PCR, cloning and sequencing ... The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Amplification:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: .. N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. The PCR product was cloned into the Bsr GI and Bam HI sites of pPT7 plasmid using Infusion HD (Clontech) and transformed into E. coli NEB5α.

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ). .. PCR settings were: 30 s at 98°C, followed by 24 PCR cycles (10 s at 98°C, 30 s at 58°C, 30 s at 72°C).

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: .. XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: .. Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB). .. Resulting amplicons were run on an 8% acrylamide non-denaturing gel, excised and incubated in 300 mM NaCl, 10 mM Tris (pH 8) and 1 mM EDTA-containing buffer overnight at 20 °C.

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: Moreover, the amount of template was reduced to the absolute minimum needed for sufficient amplification and a proofreading polymerase (Phusion, NEB) was used. .. The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: Paragraph title: cDNA synthesis and PCR amplification. ... PCR was performed with Phusion polymerase (NEB).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: .. PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen). .. To control for the contamination of assembled DNA from transfection reaction, another cDNA synthesis reaction with RNase A (Fermentas) was also set up.

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: .. Libraries were each amplified using Phusion Polymerase (New England Biolabs). .. The final pooled library was then gel purified to retain fragments of sizes 250-600bp and sequenced on an Illumina HiSeq.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: The reaction was incubated at 30 C for 10 min, 42 C for 60 min and 70 C for 15 min, and then cleaned up using 1.2X AMPure beads (Beckman Coulter) and eluted in 20 μl DS buffer (10 mM Tris pH8, 0.1 mM EDTA). scGESTALT cDNAs were PCR amplified in a two-step reaction involving: 1. .. GP12 and PE1S primers ( ) and Phusion polymerase (NEB).

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: .. The PCR was performed by the addition of 10 μl 5× GC buffer supplied wit the Phusion Polymerase Enzyme, 8 μl 1 mM dNTP, 25 pmol of each amplification primer, and 0.5 units Phusion polymerase (NEB). ..

    Synthesized:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: The rdhANP gene was codon optimized to remove codons that were rare in both E. coli and B. megaterium and synthesized (Genscript). .. N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB).

    Construct:

    Article Title: Structure of PINK1 in complex with its substrate ubiquitin
    Article Snippet: .. Site directed mutagenesis and construct optimisation was carried out using the QuikChange and the InFusion protocol using Phusion polymerase (NEB). .. Ph PINK1 constructs were expressed in Rosetta 2 (DE3) pLacI cells in 2xTY media.

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: PCR products for assembly of viral constructs were carried out with high-fidelity DNA polymerases (Phusion [NEB] and KAPA HiFi [KAPA Bioscience]) according to the manufacturers' protocols. .. PCR was performed with Phusion polymerase (NEB).

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Once the presence of the desired mutation was confirmed by DNA sequencing, the plasmid was co-transformed with the appropriate ubiX construct into E. coli BL21(DE3).

    Incubation:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: The gel slices were crushed and cDNA was recovered by incubation in 500 μl diffusion buffer (20 mM Tris-HCl pH 7.5, 250 mMNaOAc, 1mM EDTA, 0.25% (w/v) SDS) overnight at 4°C, followed by ethanol precipitation. .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ).

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB). .. Resulting amplicons were run on an 8% acrylamide non-denaturing gel, excised and incubated in 300 mM NaCl, 10 mM Tris (pH 8) and 1 mM EDTA-containing buffer overnight at 20 °C.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: The reaction was incubated at 30 C for 10 min, 42 C for 60 min and 70 C for 15 min, and then cleaned up using 1.2X AMPure beads (Beckman Coulter) and eluted in 20 μl DS buffer (10 mM Tris pH8, 0.1 mM EDTA). scGESTALT cDNAs were PCR amplified in a two-step reaction involving: 1. .. GP12 and PE1S primers ( ) and Phusion polymerase (NEB).

    Diffusion-based Assay:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: The gel slices were crushed and cDNA was recovered by incubation in 500 μl diffusion buffer (20 mM Tris-HCl pH 7.5, 250 mMNaOAc, 1mM EDTA, 0.25% (w/v) SDS) overnight at 4°C, followed by ethanol precipitation. .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ).

    Expressing:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: Paragraph title: Cloning of N. pacificus rhdANP for B. megaterium heterologous expression ... N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: PCR products of the expression vector (for assembly with viral PCR products) were amplified with hCMV-rv and HDV-fw-dv4 (for DENV4) or HDV-fw-dv2 (for DENV2). .. PCR was performed with Phusion polymerase (NEB).

    Modification:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. Once the sequence of the insert was confirmed the purified plasmid was transformed into B. megaterium MS941 containing the pT7-RNAP plasmid that permits xylose inducible expression of T7 polymerase , using the modified minimal medium protoplast transformation protocol .

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: The double-stranded adapters were modified using 5’ and 3’-amino modified bases at one end to prevent self-ligation. .. Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    Transformation Assay:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. The PCR product was cloned into the Bsr GI and Bam HI sites of pPT7 plasmid using Infusion HD (Clontech) and transformed into E. coli NEB5α.

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Template was removed by Dpn I (NEB) digest and the PCR product transformed into E. coli NEB5α.

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Template was removed by Dpn I (NEB) digest and the PCR product transformed into E. coli NEB5α.

    Derivative Assay:

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: DNA sequencing of virus was performed with PCR products derived from viral cDNA. .. PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen).

    Flow Cytometry:

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Paragraph title: Flow-sorted single-cell amplification ... Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    Ligation:

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Illumina adapters containing 5-basepair barcodes were ligated to the genomic amplicon using the NEB Quick Ligation Kit. .. Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    Nick Translation:

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Libraries then underwent nick translation using NEB Bst polymerase. .. Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    Generated:

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: PCR was performed with Phusion polymerase (NEB). .. Eleven PCR products were generated from v17 cDNA by 11 pairs of primers: CMV-5′ UTR-DV4 and C-dv4-start-rv (5′ untranslated region [UTR]), C-dv4-start-fw and prM-dv4-start-rv (C), prM-dv4-start-fw and E-dv4-end-rv (prM-E), E-dv4-end-fw and NS1-dv4-end-rv (NS1), NS1-dv4-end-fw and NS2A-dv4-end-rw (NS2A), NS2A-dv4-end-fw and NS3-dv4-start-rv (NS2B), NS3-dv4-start-fw and NS3-dv4-end-rv (NS3), NS3-dv4-end-fw and NS4A-2K-dv4-end-rv (NS4A), NS4A-2K-dv4-end-fw and NS5-dv4-start-rv (NS4B), NS5-dv4-start-fw and NS5-dv4-end-rv (NS5), and NS5-dv4-end-fw and 3′ UTR-DV4 (3′ UTR).

    DNA Sequencing:

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Once the presence of the desired mutation was confirmed by DNA sequencing, the plasmid was co-transformed with the appropriate ubiX construct into E. coli BL21(DE3).

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Once the presence of the desired mutation was confirmed by DNA sequencing, the plasmid was transformed into B. megaterium as above.

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: DNA sequencing of virus was performed with PCR products derived from viral cDNA. .. PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen).

    Sequencing:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: .. N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. The PCR product was cloned into the Bsr GI and Bam HI sites of pPT7 plasmid using Infusion HD (Clontech) and transformed into E. coli NEB5α.

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB). .. Samples were analysed on a bioanalyzer before sequencing.

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: Paragraph title: DNA isolation, PCR, cloning and sequencing ... The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: All the PCR products were cleaned up using a PCR cleanup kit from Invitrogen before use in DNA assembly and sequencing. .. PCR was performed with Phusion polymerase (NEB).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: .. PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen). .. To control for the contamination of assembled DNA from transfection reaction, another cDNA synthesis reaction with RNase A (Fermentas) was also set up.

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: Target sequences are: sgRNA-tdTom aka sgRNA298 (targets STOP cassette in tdTomato locus), 5’-AAGTAAAACCTCTACAAATG-3’, sgRNA-non-targeting aka sgRNA339 (targets Gal4 sequence that is not present in mouse genome), 5’-AACGACTAGTTAGGCGTGTA-3’, sgRNANT3 (targets EGFP gene) 5’-GGTGGTGCAGATGAACTTCA-3’. .. Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol.

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Libraries were each amplified using Phusion Polymerase (New England Biolabs). .. The total sequencing depth was 310 million reads.

    Cellular Antioxidant Activity Assay:

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: .. Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol. .. The thermocycler setting consisted of 40 cycles of 95°C for 10 s, 59°C for 10 s and 72°C for 10 s. The PCR product was extracted once with phenol:chloroform:isoamyl alcohol and then once with chloroform, before isopropanol precipitation overnight at −20°C.

    DNA Extraction:

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: Paragraph title: DNA isolation, PCR, cloning and sequencing ... The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Nucleic Acid Electrophoresis:

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL). .. All PCR samples were held at 4°C before analysis by gel electrophoresis on 1% TAE gels containing Ethidium Bromide and evaluation under UV fluorescence.

    Fluorescence:

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL). .. All PCR samples were held at 4°C before analysis by gel electrophoresis on 1% TAE gels containing Ethidium Bromide and evaluation under UV fluorescence.

    Mutagenesis:

    Article Title: Structure of PINK1 in complex with its substrate ubiquitin
    Article Snippet: .. Site directed mutagenesis and construct optimisation was carried out using the QuikChange and the InFusion protocol using Phusion polymerase (NEB). .. Ph PINK1 constructs were expressed in Rosetta 2 (DE3) pLacI cells in 2xTY media.

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: Paragraph title: Mutagenesis ... PCR was performed using Phusion polymerase (NEB).

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: Paragraph title: Mutagenesis ... PCR was performed using Phusion polymerase (NEB).

    Isolation:

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: Ribosome-protected fragments were isolated using sephacryl S400 columns (GE Healthcare) in TE buffer. rRNAs were removed using the Ribo-zero magnetic kit (Illumina, MRZH11124). .. Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB).

    Transfection:

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen). .. To control for the contamination of assembled DNA from transfection reaction, another cDNA synthesis reaction with RNase A (Fermentas) was also set up.

    Size-exclusion Chromatography:

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: For the mtDNA genes, another program was used: initial denaturation for 10 min at 94°C; 40 cycles of denaturation for 1 min at 94°C; annealing for 30 sec at 52°C; extension for 1 min at 72°C; final extension for 10 min at 72°C. .. The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Polymerase Chain Reaction:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: .. N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. The PCR product was cloned into the Bsr GI and Bam HI sites of pPT7 plasmid using Infusion HD (Clontech) and transformed into E. coli NEB5α.

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ). .. PCR settings were: 30 s at 98°C, followed by 24 PCR cycles (10 s at 98°C, 30 s at 58°C, 30 s at 72°C).

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: .. Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB). .. Resulting amplicons were run on an 8% acrylamide non-denaturing gel, excised and incubated in 300 mM NaCl, 10 mM Tris (pH 8) and 1 mM EDTA-containing buffer overnight at 20 °C.

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: Paragraph title: DNA isolation, PCR, cloning and sequencing ... The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: .. PCR was performed with Phusion polymerase (NEB). .. Eleven PCR products were generated from v17 cDNA by 11 pairs of primers: CMV-5′ UTR-DV4 and C-dv4-start-rv (5′ untranslated region [UTR]), C-dv4-start-fw and prM-dv4-start-rv (C), prM-dv4-start-fw and E-dv4-end-rv (prM-E), E-dv4-end-fw and NS1-dv4-end-rv (NS1), NS1-dv4-end-fw and NS2A-dv4-end-rw (NS2A), NS2A-dv4-end-fw and NS3-dv4-start-rv (NS2B), NS3-dv4-start-fw and NS3-dv4-end-rv (NS3), NS3-dv4-end-fw and NS4A-2K-dv4-end-rv (NS4A), NS4A-2K-dv4-end-fw and NS5-dv4-start-rv (NS4B), NS5-dv4-start-fw and NS5-dv4-end-rv (NS5), and NS5-dv4-end-fw and 3′ UTR-DV4 (3′ UTR).

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: .. PCR was performed using Phusion polymerase (NEB). .. Template was removed by Dpn I (NEB) digest and the PCR product transformed into E. coli NEB5α.

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: .. PCR was performed using Phusion polymerase (NEB). .. Template was removed by Dpn I (NEB) digest and the PCR product transformed into E. coli NEB5α.

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: .. PCR amplification for sequencing was performed with either Phusion polymerase (NEB) or Accuprime high-fidelity Taq polymerase (Invitrogen). .. To control for the contamination of assembled DNA from transfection reaction, another cDNA synthesis reaction with RNase A (Fermentas) was also set up.

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: .. Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol. .. The thermocycler setting consisted of 40 cycles of 95°C for 10 s, 59°C for 10 s and 72°C for 10 s. The PCR product was extracted once with phenol:chloroform:isoamyl alcohol and then once with chloroform, before isopropanol precipitation overnight at −20°C.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: The reaction was incubated at 30 C for 10 min, 42 C for 60 min and 70 C for 15 min, and then cleaned up using 1.2X AMPure beads (Beckman Coulter) and eluted in 20 μl DS buffer (10 mM Tris pH8, 0.1 mM EDTA). scGESTALT cDNAs were PCR amplified in a two-step reaction involving: 1. .. GP12 and PE1S primers ( ) and Phusion polymerase (NEB).

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: .. The PCR was performed by the addition of 10 μl 5× GC buffer supplied wit the Phusion Polymerase Enzyme, 8 μl 1 mM dNTP, 25 pmol of each amplification primer, and 0.5 units Phusion polymerase (NEB). ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: After addition of loading buffer, cDNA as applied to 10% denaturing PAGE and staining with SYBR Gold. .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ).

    Gel Extraction:

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Activated Clotting Time Assay:

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: .. Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol. .. The thermocycler setting consisted of 40 cycles of 95°C for 10 s, 59°C for 10 s and 72°C for 10 s. The PCR product was extracted once with phenol:chloroform:isoamyl alcohol and then once with chloroform, before isopropanol precipitation overnight at −20°C.

    Purification:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. Once the sequence of the insert was confirmed the purified plasmid was transformed into B. megaterium MS941 containing the pT7-RNAP plasmid that permits xylose inducible expression of T7 polymerase , using the modified minimal medium protoplast transformation protocol .

    Article Title: XRCC1 Mutation is Associated with PARP1 Hyperactivation and Cerebellar Ataxia
    Article Snippet: XRCC1 cDNA cloning cDNA prepared as above from patient cells treated with cycloheximide was used for Phusion polymerase (NEB) amplification of full length XRCC1 transcripts using primers ATGCCGGAGATCCGCCTCCG and GGCTTGCGGCACCACCCCAT. .. PCR products were purified using Gel extraction kit (Qiagen), cloned using TOPO cloning kit (Thermo Fischer Scientific) and plasmids originating from single colonies purified using Miniprep kit (Qiagen) and sequenced by Sanger sequencing (Beckman Coulter).

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora
    Article Snippet: The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL). .. Before sequencing, PCR products were purified using the QiaQuick PCR Purification Kit (Qiagen).

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Samples then underwent end-repair using the NEB Quick Blunting Kit and purified using a QIAGEN MinElute column. .. Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    Plasmid Preparation:

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: N. pacificus rdhANP was PCR amplified using primers NPRdhA3pPT7F and NPRdhA3pPT7R (the latter containing the sequence encoding for a C-terminal His-tag) using Phusion polymerase (NEB). .. The PCR product was cloned into the Bsr GI and Bam HI sites of pPT7 plasmid using Infusion HD (Clontech) and transformed into E. coli NEB5α.

    Article Title: Structure of PINK1 in complex with its substrate ubiquitin
    Article Snippet: Ubiquitin constructs were cloned into pET17b or into pOPIN-E, Ph PINK1 constructs were cloned into pOPIN-K or pOPIN-S , the Nb696 construct was cloned into a pMESy4 vector. .. Site directed mutagenesis and construct optimisation was carried out using the QuikChange and the InFusion protocol using Phusion polymerase (NEB).

    Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput
    Article Snippet: PCR products of the expression vector (for assembly with viral PCR products) were amplified with hCMV-rv and HDV-fw-dv4 (for DENV4) or HDV-fw-dv2 (for DENV2). .. PCR was performed with Phusion polymerase (NEB).

    Article Title: New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Once the presence of the desired mutation was confirmed by DNA sequencing, the plasmid was co-transformed with the appropriate ubiX construct into E. coli BL21(DE3).

    Article Title: Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation
    Article Snippet: PCR was performed using Phusion polymerase (NEB). .. Once the presence of the desired mutation was confirmed by DNA sequencing, the plasmid was transformed into B. megaterium as above.

    Selection:

    Article Title: Mobile genes in the human microbiome are structured from global to individual scales
    Article Snippet: Size selection was then performed using SPRI beads. .. Libraries were each amplified using Phusion Polymerase (New England Biolabs).

    In Vitro:

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: Paragraph title: In vitro T7 transcription of sgRNA ... Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol.

    Ethanol Precipitation:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: The gel slices were crushed and cDNA was recovered by incubation in 500 μl diffusion buffer (20 mM Tris-HCl pH 7.5, 250 mMNaOAc, 1mM EDTA, 0.25% (w/v) SDS) overnight at 4°C, followed by ethanol precipitation. .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ).

    Random Hexamer Labeling:

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: Reactions with 5 μl IVT aRNA, 1.5 μl 50 μM random hexamer, 1 μl 10mM dNTP and 3.5 μl water were incubated at 70 C for 3 min, followed by addition of a reverse transcription mix (4 μl 5X PrimeScript buffer, 3.5 μl water, 1 μl RNase inhibitor [40U/μl], 0.5 μl PrimeScript RT enzyme). .. GP12 and PE1S primers ( ) and Phusion polymerase (NEB).

    Lysis:

    Article Title: Translation from unconventional 5′ start sites drives tumour initiation
    Article Snippet: The resulting cell suspension was then filtered through a 40-μm cell strainer, spun down and resuspended in lysis buffer. .. Finally, ribosome-protected fragments were amplified in 7–9 PCR cycles using Phusion polymerase (NEB).

    CTG Assay:

    Article Title: Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes
    Article Snippet: .. Briefly, for the sgRNA-tdTom template, the PCR reaction contains 20 nM premix of BS298 (5’-TAA TAC GAC TCA CTA TAG AAG TAA AAC CTC TAC AAA TGG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG G-3’) and BS6 (5′- AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GC −3′), 1 μM premix of T25_long (5′-GAA ATT AAT ACG ACT CAC TAT AG −3′) and BS7 (5′- AAA AAA AGC ACC GAC TCG GTG C −3′), 200 μM dNTP and Phusion Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol. .. The thermocycler setting consisted of 40 cycles of 95°C for 10 s, 59°C for 10 s and 72°C for 10 s. The PCR product was extracted once with phenol:chloroform:isoamyl alcohol and then once with chloroform, before isopropanol precipitation overnight at −20°C.

    Staining:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: After addition of loading buffer, cDNA as applied to 10% denaturing PAGE and staining with SYBR Gold. .. The circularized cDNA was utilized for amplification with Phusion polymerase (NEB) and primers X98 and X99 ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs phusion high fidelity dna polymerase
    Phusion High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/New England Biolabs
    Average 90 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs fidelity phusion hot start flex dna polymerase enzyme
    Fidelity Phusion Hot Start Flex Dna Polymerase Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fidelity phusion hot start flex dna polymerase enzyme/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    fidelity phusion hot start flex dna polymerase enzyme - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results