phusion hot start polymerase new england biolabs  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Phusion Hot Start Flex DNA Polymerase
    Phusion Hot Start Flex DNA Polymerase 500 units
    Catalog Number:
    500 units
    Thermostable DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs phusion hot start polymerase new england biolabs
    Phusion Hot Start Flex DNA Polymerase
    Phusion Hot Start Flex DNA Polymerase 500 units hot start polymerase new england biolabs/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phusion hot start polymerase new england biolabs - by Bioz Stars, 2021-01
    99/100 stars

    Related Products / Commonly Used Together

    phusion hf buffer
    pcr reactions


    Related Articles

    Clone Assay:

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..


    Article Title: ZmPep1, an Ortholog of Arabidopsis Elicitor Peptide 1, Regulates Maize Innate Immunity and Enhances Disease Resistance 1ZmPep1, an Ortholog of Arabidopsis Elicitor Peptide 1, Regulates Maize Innate Immunity and Enhances Disease Resistance 1 [W]ZmPep1, an Ortholog of Arabidopsis Elicitor Peptide 1, Regulates Maize Innate Immunity and Enhances Disease Resistance 1 [W] [OA]
    Article Snippet: .. The ZmPROPEP1 open reading frame was amplified from the cDNA with the forward primer 5′-GACCTCAGGAAAGGGGAGACCTGGA-3′ and the reverse primer 5′-AAGGAAGCGAACAAGCTAGGGTCACCGTA-3′ using Phusion Hot Start II DNA Polymerase (New England Biolabs). .. The amplified cDNA was cloned into the pCR BLUNT II TOPO vector using a Zero Blunt PCR cloning kit (Invitrogen) as per kit instructions and transformed by heat shock into TOP10F′ chemically competent Escherichia coli (Invitrogen).

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO). ..

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..

    Article Title: Solid-phase cloning for high-throughput assembly of single and multiple DNA parts
    Article Snippet: .. DNA parts were amplified with Phusion® Hot-Start Flex (2 U/μl, New England Biolabs, Ipswich, MA, USA) by the following PCR program: 98°C for 30 s, 30 cycles of 98°C 8 s, 25 s annealing with temperature depending on primer melting temperature and 72°C for 20 s/kb, before ending with 72°C for 7 min followed by 4°C hold. ..

    Article Title: A Flexible Approach for Highly Multiplexed Candidate Gene Targeted Resequencing
    Article Snippet: .. After a brief purification using the Spin-20 columns (Princeton Separations), the captured DNA pool was amplified by PCR (98°C for 30 seconds followed by 36–37 cycles at 98°C for 10 seconds, 65°C for 30 seconds, and 73°C for 30 seconds) using Phusion Hot Start High-Fidelity DNA polymerase (New England BioLabs) and non-target specific common primers that are homologous to the vector oligonucleotide. .. After purification using the Fermentas PCR Purification kit, 0.5–1 µg PCR products per sequencing library were ligated to each other using T4 DNA ligase (New England BioLabs).

    In Vitro:

    Article Title: A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli
    Article Snippet: .. Then, fragment 1, 2 and 3 were assembled together in vitro under the action of T5 exonuclease (Epicentre), Phusion Hot Start DNA Polymerase (New England Biolabs (NEB)) and Taq DNA ligase (NEB) at 50°C for 15 min. .. The resulting constructs containing different promoters were then transformed into competent cells and were firstly screened based on the fluorescence signal and PCR detection.


    Article Title: A Flexible Approach for Highly Multiplexed Candidate Gene Targeted Resequencing
    Article Snippet: .. After a brief purification using the Spin-20 columns (Princeton Separations), the captured DNA pool was amplified by PCR (98°C for 30 seconds followed by 36–37 cycles at 98°C for 10 seconds, 65°C for 30 seconds, and 73°C for 30 seconds) using Phusion Hot Start High-Fidelity DNA polymerase (New England BioLabs) and non-target specific common primers that are homologous to the vector oligonucleotide. .. After purification using the Fermentas PCR Purification kit, 0.5–1 µg PCR products per sequencing library were ligated to each other using T4 DNA ligase (New England BioLabs).


    Article Title: A rev1-vpu polymorphism unique to HIV-1 subtype A and C strains impairs envelope glycoprotein expression from rev-vpu-env cassettes and reduces virion infectivity in pseudotyping assays
    Article Snippet: .. For this, the DNA template was generated by PCR using Phusion Hot-Start polymerase (New England Biolabs) and the following primers (forward 5′- aattaaccctcactaaaggg CATTTCAGACCCTTATCCCAAACTCG-3′, reverse 5′- taatacgactcactataggg CCCAGATACTTAAGGATTTGCCACCC-3′) and 10 ng of ZM247Fv1 Env plasmid DNA. ..

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..


    Article Title: A rev1-vpu polymorphism unique to HIV-1 subtype A and C strains impairs envelope glycoprotein expression from rev-vpu-env cassettes and reduces virion infectivity in pseudotyping assays
    Article Snippet: .. To generate rev1-vpu expression vectors (p rev1vpu ZM247Fv1, p rev1vpu ZM247Fv1-fs, p rev1vpu ZM246F and p rev1vpu ZM246F-fs), we used Phusion Hot-Start polymerase (New England Biolabs) and the following primers (ZM247Fv1 and ZM246F forward 5′-actt tctaga tacaaTATGGCAGGAAGAAGCGGAGACA-3′, reverse ZM247Fv1 5′-aaga acgcgT TATAAGTCAATAGCACCCAAAAGCCTAATATGCC-3′; reverse ZM246F 5′-aaga acgcgt CTATAAATCATCAAAAAGCCTAATATGCTCCATATCCA-3′) to amplify the corresponding region from the ZM247Fv1, ZM247Fv1-fs, ZM246F and ZM246F-fs rev-vpu-env cassettes. .. Unique XbaI and MluI sites in the primers sequences (underlined) facilitated directional cloning into pCG-IRES-eGFP (kindly provided by Frank Kirchhoff).

    Polymerase Chain Reaction:

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO). ..

    Article Title: A rev1-vpu polymorphism unique to HIV-1 subtype A and C strains impairs envelope glycoprotein expression from rev-vpu-env cassettes and reduces virion infectivity in pseudotyping assays
    Article Snippet: .. For this, the DNA template was generated by PCR using Phusion Hot-Start polymerase (New England Biolabs) and the following primers (forward 5′- aattaaccctcactaaaggg CATTTCAGACCCTTATCCCAAACTCG-3′, reverse 5′- taatacgactcactataggg CCCAGATACTTAAGGATTTGCCACCC-3′) and 10 ng of ZM247Fv1 Env plasmid DNA. ..

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..

    Article Title: Solid-phase cloning for high-throughput assembly of single and multiple DNA parts
    Article Snippet: .. DNA parts were amplified with Phusion® Hot-Start Flex (2 U/μl, New England Biolabs, Ipswich, MA, USA) by the following PCR program: 98°C for 30 s, 30 cycles of 98°C 8 s, 25 s annealing with temperature depending on primer melting temperature and 72°C for 20 s/kb, before ending with 72°C for 7 min followed by 4°C hold. ..

    Article Title: A Flexible Approach for Highly Multiplexed Candidate Gene Targeted Resequencing
    Article Snippet: .. After a brief purification using the Spin-20 columns (Princeton Separations), the captured DNA pool was amplified by PCR (98°C for 30 seconds followed by 36–37 cycles at 98°C for 10 seconds, 65°C for 30 seconds, and 73°C for 30 seconds) using Phusion Hot Start High-Fidelity DNA polymerase (New England BioLabs) and non-target specific common primers that are homologous to the vector oligonucleotide. .. After purification using the Fermentas PCR Purification kit, 0.5–1 µg PCR products per sequencing library were ligated to each other using T4 DNA ligase (New England BioLabs).

    Transformation Assay:

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..

    Plasmid Preparation:

    Article Title: A rev1-vpu polymorphism unique to HIV-1 subtype A and C strains impairs envelope glycoprotein expression from rev-vpu-env cassettes and reduces virion infectivity in pseudotyping assays
    Article Snippet: .. For this, the DNA template was generated by PCR using Phusion Hot-Start polymerase (New England Biolabs) and the following primers (forward 5′- aattaaccctcactaaaggg CATTTCAGACCCTTATCCCAAACTCG-3′, reverse 5′- taatacgactcactataggg CCCAGATACTTAAGGATTTGCCACCC-3′) and 10 ng of ZM247Fv1 Env plasmid DNA. ..

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides
    Article Snippet: .. Transformation-Associated Recombination (TAR) cloning of the 100 kb DNA segment A 7.5 kilobase (kb) TAR cloning vector was generated by PCR amplification of pRC60 using two primers (5′- ACTAATAATAAAACATTTATATACTTAATGAATAAATATAATTAG TACCGTTCGTATAATGTATGC-3′ and 5′-ATTTTAAAATTTATGTAATTTATTAATTTTTATCTTTATAATATA TACCGTTCGTATATGGTTTCT-3′) and the Phusion Hot Start High-Fidelity DNA polymerase with HF buffer (New England Biolabs; NEB) according to the manufacturer’s instructions with modifications. ..

    Article Title: A Flexible Approach for Highly Multiplexed Candidate Gene Targeted Resequencing
    Article Snippet: .. After a brief purification using the Spin-20 columns (Princeton Separations), the captured DNA pool was amplified by PCR (98°C for 30 seconds followed by 36–37 cycles at 98°C for 10 seconds, 65°C for 30 seconds, and 73°C for 30 seconds) using Phusion Hot Start High-Fidelity DNA polymerase (New England BioLabs) and non-target specific common primers that are homologous to the vector oligonucleotide. .. After purification using the Fermentas PCR Purification kit, 0.5–1 µg PCR products per sequencing library were ligated to each other using T4 DNA ligase (New England BioLabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs phusion hot start flex
    Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, <t>Phusion</t> and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.
    Phusion Hot Start Flex, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hot start flex/product/New England Biolabs
    Average 99 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    phusion hot start flex - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    New England Biolabs phusion high fidelity hot start dna polymerase
    Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, <t>Phusion</t> and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.
    Phusion High Fidelity Hot Start Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more high fidelity hot start dna polymerase/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity hot start dna polymerase - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    Image Search Results

    Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, Phusion and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.

    Journal: Nucleic Acids Research

    Article Title: Solid-phase cloning for high-throughput assembly of single and multiple DNA parts

    doi: 10.1093/nar/gkv036

    Figure Lengend Snippet: Results from head-to-tail SPC. ( A ) Comparison of compatibility of thermostable polymerases with the head-to-tail method. The polymerases with best proof-reading capabilities, Phusion and Deep Vent, all failed to generate transformants with the standard head-to-tail protocol. ( B ) Activity was retained for protocols using Phusion after supplementation of the washing buffer with SDS. ( C ) Colony screens of inserted region representing a selection of assemblies of various lengths and number of inserts assembled by head-to-tail SPC. Final construct sizes spanned 2.9 to 7.2 kbps.

    Article Snippet: DNA parts were amplified with Phusion® Hot-Start Flex (2 U/μl, New England Biolabs, Ipswich, MA, USA) by the following PCR program: 98°C for 30 s, 30 cycles of 98°C 8 s, 25 s annealing with temperature depending on primer melting temperature and 72°C for 20 s/kb, before ending with 72°C for 7 min followed by 4°C hold.

    Techniques: Activity Assay, Selection, Construct

    Construction outline of the MCP tac s promoter clusters . Fragment 5CP tac s with the flanking sequence was amplified by PCR with p5TG as the template. Fragment 1 was generated by digesting fragment 5CP tac s with BamH I. Fragment 2 was digested from fragment 5CP tac s with BamH I and Hind III. Fragment 3 was linearized from the plasmid p5TG with Hind III. Then, the three fragments were assembled together under the action of T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase in the isothermal process.

    Journal: Microbial Cell Factories

    Article Title: A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    doi: 10.1186/1475-2859-11-19

    Figure Lengend Snippet: Construction outline of the MCP tac s promoter clusters . Fragment 5CP tac s with the flanking sequence was amplified by PCR with p5TG as the template. Fragment 1 was generated by digesting fragment 5CP tac s with BamH I. Fragment 2 was digested from fragment 5CP tac s with BamH I and Hind III. Fragment 3 was linearized from the plasmid p5TG with Hind III. Then, the three fragments were assembled together under the action of T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase in the isothermal process.

    Article Snippet: Then, fragment 1, 2 and 3 were assembled together in vitro under the action of T5 exonuclease (Epicentre), Phusion Hot Start DNA Polymerase (New England Biolabs (NEB)) and Taq DNA ligase (NEB) at 50°C for 15 min.

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Generated, Plasmid Preparation