phusion hot start ii high fidelity dna polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher phusion hot start ii high fidelity dna polymerase
    Phusion Hot Start Ii High Fidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start ii high fidelity dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 82 article reviews
    Price from $9.99 to $1999.99
    phusion hot start ii high fidelity dna polymerase - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: Supernatant was collected, pooled with the first supernatant, and 250 μL of the combined supernatant was used for purification with Maxwell 16 Tissue LEV Total RNA Purification Kit, catalog no.AS1220 (Promega Corp.) customized for DNA extraction in combination with the STAR buffer. .. Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water.

    Clone Assay:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: .. All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher). .. PCR products were purified and cloned in the pSEVA344 plasmid and transferred to receptor strains via tripartite conjugation by using the pRK2013 helper plasmid.

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: .. PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. One-step RT-qPCR was used to semi-quantitatively assess virus load in AF, using primers IBV.RdRp.F41 and IBV.RdRp.R41 as previously described [15] .

    Amplification:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: For complementation purposes, rplF under its own promoter was amplified with primers EcoRI_rplF_fwd and HindIII_rplF_rev (TATAAAGCTTATGACCTGGGCGTAAATGTG) from PA PAO1 and mutant clinical isolate and cloned into EcoRI–HindIII–pSEVA332 ( ) restriction sites, resulting in pCE (empty vector), pCrplf harboring the wild-type copy of rplf gene, and pCL6M harboring the mutant rplf gene from mutant isolate. .. All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher).

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: .. Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water. .. The amplification program included 30 s initial denaturation at 98°C, followed by 25 cycles (with the exception of ileal mucosal DNA samples which were processed with 30 cycles to yield sufficient amplicon fragments) of denaturation at 98°C for 10 s, annealing at 42°C for 10 s, elongation at 72°C for 10 s, and a final extension at 72°C for 7 min. PCR product presence and size (approximately 280 bp) was confirmed by gel electrophoresis using a 1% agarose gel.

    Agarose Gel Electrophoresis:

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water. .. The amplification program included 30 s initial denaturation at 98°C, followed by 25 cycles (with the exception of ileal mucosal DNA samples which were processed with 30 cycles to yield sufficient amplicon fragments) of denaturation at 98°C for 10 s, annealing at 42°C for 10 s, elongation at 72°C for 10 s, and a final extension at 72°C for 7 min. PCR product presence and size (approximately 280 bp) was confirmed by gel electrophoresis using a 1% agarose gel.

    Nucleic Acid Electrophoresis:

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water. .. The amplification program included 30 s initial denaturation at 98°C, followed by 25 cycles (with the exception of ileal mucosal DNA samples which were processed with 30 cycles to yield sufficient amplicon fragments) of denaturation at 98°C for 10 s, annealing at 42°C for 10 s, elongation at 72°C for 10 s, and a final extension at 72°C for 7 min. PCR product presence and size (approximately 280 bp) was confirmed by gel electrophoresis using a 1% agarose gel.

    Conjugation Assay:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher). .. PCR products were purified and cloned in the pSEVA344 plasmid and transferred to receptor strains via tripartite conjugation by using the pRK2013 helper plasmid.

    Mutagenesis:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: For complementation purposes, rplF under its own promoter was amplified with primers EcoRI_rplF_fwd and HindIII_rplF_rev (TATAAAGCTTATGACCTGGGCGTAAATGTG) from PA PAO1 and mutant clinical isolate and cloned into EcoRI–HindIII–pSEVA332 ( ) restriction sites, resulting in pCE (empty vector), pCrplf harboring the wild-type copy of rplf gene, and pCL6M harboring the mutant rplf gene from mutant isolate. .. All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher).

    Isolation:

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: Paragraph title: RNA isolation, reverse transcription PCR ... PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes.

    Quantitative RT-PCR:

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. One-step RT-qPCR was used to semi-quantitatively assess virus load in AF, using primers IBV.RdRp.F41 and IBV.RdRp.R41 as previously described [15] .

    Purification:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher). .. PCR products were purified and cloned in the pSEVA344 plasmid and transferred to receptor strains via tripartite conjugation by using the pRK2013 helper plasmid.

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: Supernatant was collected, pooled with the first supernatant, and 250 μL of the combined supernatant was used for purification with Maxwell 16 Tissue LEV Total RNA Purification Kit, catalog no.AS1220 (Promega Corp.) customized for DNA extraction in combination with the STAR buffer. .. Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water.

    Polymerase Chain Reaction:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher). .. PCR products were purified and cloned in the pSEVA344 plasmid and transferred to receptor strains via tripartite conjugation by using the pRK2013 helper plasmid.

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: .. PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. One-step RT-qPCR was used to semi-quantitatively assess virus load in AF, using primers IBV.RdRp.F41 and IBV.RdRp.R41 as previously described [15] .

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: PCR reactions were done in duplicate, each in a total volume of 50 μL and containing 20 ng of template DNA. .. Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water.

    Construct:

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. The constructs p-IBV-D3ab, p-IBV-D5ab, and p-IBV-D3ab5ab, in which the accessory genes 3ab, 5ab, and 3ab5ab are deleted, are shown in Fig. 1B and C. Design of the delta3ab fragment (D3ab) was such that the 1 nt overlap between the stop codon of the spike gene and the start codon of the 3a gene was replaced by an overlap between the stop codon of the spike gene and the start codon of the E gene ( Fig. 1C-5 ).

    Sequencing:

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: .. PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. One-step RT-qPCR was used to semi-quantitatively assess virus load in AF, using primers IBV.RdRp.F41 and IBV.RdRp.R41 as previously described [15] .

    Spectrophotometry:

    Article Title: Differences in gut microbiota composition of laying hen lines divergently selected on feather pecking
    Article Snippet: DNA concentrations were measured with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE) and adjusted to 20 ng μL−1 with DNAse- and RNAse-free water. .. Each sample was amplified with a uniquely barcoded primer pair (10 μM each per reaction), 1x HF buffer (Thermo Fisher Scientific, Waltham, MA), 1 μL dNTP Mix (10 mM each; Roche Diagnostics GmbH, Mannheim, Germany), 1 U Phusion Hot Start II High Fidelity DNA Polymerase (Thermo Fisher Scientific), and 36.5 μL of DNAse- and RNAse-free water.

    Plasmid Preparation:

    Article Title: Structure of Pseudomonas aeruginosa ribosomes from an aminoglycoside-resistant clinical isolate
    Article Snippet: Plasmid were transferred by triparental mating as described above using pRK2013 as helper plasmid ( ). .. All cloning PCRs were performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher).

    Article Title: Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.
    Article Snippet: PCR was performed with Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) for sequencing and cloning purposes. .. The design of donor plasmid p-IBV has been described previously [15] (Fig. 1A) .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher phusion hot start ii high fidelity dna polymerase
    Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with <t>Phusion</t> Hot Start II High-Fidelity <t>DNA</t> Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.
    Phusion Hot Start Ii High Fidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start ii high fidelity dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 82 article reviews
    Price from $9.99 to $1999.99
    phusion hot start ii high fidelity dna polymerase - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher phusion hot start dna polymerases
    A diagram of the Hot Fusion process for single fragment cloning. Red and blue boxes on the vector and PCR product indicate the overlapping sequences (17–30 bp). T5 exonuclease removes nucleotides from the 5′ to 3′ end of double strand <t>DNA</t> molecules. <t>Phusion</t> DNA polymerase fills in gaps that are over-generated by T5 exonuclease. Annealed fragments are transformed into E. coli and the nick sites in the nucleotide chain are repaired by E. coli.
    Phusion Hot Start Dna Polymerases, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start dna polymerases/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phusion hot start dna polymerases - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Journal: Scientific Reports

    Article Title: The impact of storage buffer, DNA extraction method, and polymerase on microbial analysis

    doi: 10.1038/s41598-018-24573-y

    Figure Lengend Snippet: Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Article Snippet: Platinum SuperFi DNA Polymerase (Thermo Fisher Scientific) and the Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) were both tested for amplification.

    Techniques: Amplification, Labeling

    Identification of the exponential phase during PCR amplification of barcode sequences. A. Schematic of the strategy used to identify the transition point from exponential to linear PCR amplification. gDNA isolated from HEK293T cells transduced with the pooled shRNA library were amplified in replicate PCR reactions. A replicate reaction was stopped at each cycle from 15 to 27 cycles. Subsequently, PCR products were used as templates for SYBR qPCR reactions using nested primers targeting a common sequence (outside of the barcode region) to examine the ΔC q between cycles. B. Difference of C q obtained in the qPCR on diluted amplicons from every cycle of the Phusion HS II polymerase PCR reaction (C qN+1 −C qN ) as a function of the Phusion PCR cycle number (N). C. Gel analysis of the PCR product generated from amplification cycles 22 to 25. Sizes of DNA bands in DNA marker (lane M) are indicated on the left.

    Journal: PLoS ONE

    Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens

    doi: 10.1371/journal.pone.0042341

    Figure Lengend Snippet: Identification of the exponential phase during PCR amplification of barcode sequences. A. Schematic of the strategy used to identify the transition point from exponential to linear PCR amplification. gDNA isolated from HEK293T cells transduced with the pooled shRNA library were amplified in replicate PCR reactions. A replicate reaction was stopped at each cycle from 15 to 27 cycles. Subsequently, PCR products were used as templates for SYBR qPCR reactions using nested primers targeting a common sequence (outside of the barcode region) to examine the ΔC q between cycles. B. Difference of C q obtained in the qPCR on diluted amplicons from every cycle of the Phusion HS II polymerase PCR reaction (C qN+1 −C qN ) as a function of the Phusion PCR cycle number (N). C. Gel analysis of the PCR product generated from amplification cycles 22 to 25. Sizes of DNA bands in DNA marker (lane M) are indicated on the left.

    Article Snippet: For the cell viability screen in HEK293T cells, amplification of the barcode region for microarray analysis was performed using Phusion® Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific, Vantaa, Finland) and Decode negative selection primers.

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Transduction, shRNA, Real-time Polymerase Chain Reaction, Sequencing, Generated, Marker

    Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Journal: Scientific Reports

    Article Title: The impact of storage buffer, DNA extraction method, and polymerase on microbial analysis

    doi: 10.1038/s41598-018-24573-y

    Figure Lengend Snippet: Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Article Snippet: Platinum SuperFi DNA Polymerase (Thermo Fisher Scientific) and the Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) were both tested for amplification.

    Techniques: Amplification, Labeling

    A diagram of the Hot Fusion process for single fragment cloning. Red and blue boxes on the vector and PCR product indicate the overlapping sequences (17–30 bp). T5 exonuclease removes nucleotides from the 5′ to 3′ end of double strand DNA molecules. Phusion DNA polymerase fills in gaps that are over-generated by T5 exonuclease. Annealed fragments are transformed into E. coli and the nick sites in the nucleotide chain are repaired by E. coli.

    Journal: PLoS ONE

    Article Title: Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

    doi: 10.1371/journal.pone.0115318

    Figure Lengend Snippet: A diagram of the Hot Fusion process for single fragment cloning. Red and blue boxes on the vector and PCR product indicate the overlapping sequences (17–30 bp). T5 exonuclease removes nucleotides from the 5′ to 3′ end of double strand DNA molecules. Phusion DNA polymerase fills in gaps that are over-generated by T5 exonuclease. Annealed fragments are transformed into E. coli and the nick sites in the nucleotide chain are repaired by E. coli.

    Article Snippet: Phusion Hot Start DNA polymerases and GeneRuler 1 kb Plus DNA Ladder were purchased from Thermo Scientific (Waltham, MA).

    Techniques: Clone Assay, Plasmid Preparation, Polymerase Chain Reaction, Generated, Transformation Assay