mrpl33 l  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Phusion HF Buffer Pack
    Description:
    Phusion HF Buffer Pack 6 0 ml
    Catalog Number:
    b0518s
    Price:
    24
    Size:
    6 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs mrpl33 l
    Phusion HF Buffer Pack
    Phusion HF Buffer Pack 6 0 ml
    https://www.bioz.com/result/mrpl33 l/product/New England Biolabs
    Average 93 stars, based on 4395 article reviews
    Price from $9.99 to $1999.99
    mrpl33 l - by Bioz Stars, 2020-08
    93/100 stars

    Images

    1) Product Images from "Isoforms S and L of MRPL33 from alternative splicing have isoform-specific roles in the chemoresponse to epirubicin in gastric cancer cells via the PI3K/AKT signaling pathway"

    Article Title: Isoforms S and L of MRPL33 from alternative splicing have isoform-specific roles in the chemoresponse to epirubicin in gastric cancer cells via the PI3K/AKT signaling pathway

    Journal: International Journal of Oncology

    doi: 10.3892/ijo.2019.4728

    Chemoresponse to epirubicin is regulated by MRPL33-L and MRPL33-S in gastric cancer. (A) Histogram of the chemoresponse of AGS cell groups (AGS control, plenti-vector, plenti-MRPL33-L and plenti-MRPL33-S), which were treated with epirubicin (0.003, 0.03, 0.3, 3 and 30 µ M) for 72 h. (B) Fluorescent staining of nuclei in AGS cell groups treated with 0.3 µ M epirubicin for 72 h. (C) Histogram of the chemoresponse of MGC-803 cell groups (MGC-803 control, plenti-vector, plenti-MRPL33-L and plenti-MRPL33-S), which were treated with epirubicin (0.003, 0.03, 0.3, 3 and 30 µ M) for 72 h. (D) Fluorescent staining of nuclei in MGC-803 cell groups treated with 0.3 µ M epirubicin for 72 h. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. * P
    Figure Legend Snippet: Chemoresponse to epirubicin is regulated by MRPL33-L and MRPL33-S in gastric cancer. (A) Histogram of the chemoresponse of AGS cell groups (AGS control, plenti-vector, plenti-MRPL33-L and plenti-MRPL33-S), which were treated with epirubicin (0.003, 0.03, 0.3, 3 and 30 µ M) for 72 h. (B) Fluorescent staining of nuclei in AGS cell groups treated with 0.3 µ M epirubicin for 72 h. (C) Histogram of the chemoresponse of MGC-803 cell groups (MGC-803 control, plenti-vector, plenti-MRPL33-L and plenti-MRPL33-S), which were treated with epirubicin (0.003, 0.03, 0.3, 3 and 30 µ M) for 72 h. (D) Fluorescent staining of nuclei in MGC-803 cell groups treated with 0.3 µ M epirubicin for 72 h. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. * P

    Techniques Used: Plasmid Preparation, Staining, Standard Deviation

    Effects of MRPL33-L and MRPL33-S overexpression in AGS gastric cancer cells. (A) Volcano plot and (B) heatmap indicating upregu-lated and downregulated genes in plenti-MRPL33-L-transfected cells. (C) Volcano plot and (D) heatmap indicating upregulated and downregulated genes in plenti-MRPL33-S-transfected cells. (E) Venn diagram and (F) heatmap showing the number of overlapping DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. (G) Gene Ontology analysis of DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. (H) KEGG pathway analysis of DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. MRPL33, mitochondrial ribosomal protein L33; L, long variant; S, short variant; DEGs, differentially expressed genes; KEGG, Kyoto Encyclopedia of Genes and Genomes.
    Figure Legend Snippet: Effects of MRPL33-L and MRPL33-S overexpression in AGS gastric cancer cells. (A) Volcano plot and (B) heatmap indicating upregu-lated and downregulated genes in plenti-MRPL33-L-transfected cells. (C) Volcano plot and (D) heatmap indicating upregulated and downregulated genes in plenti-MRPL33-S-transfected cells. (E) Venn diagram and (F) heatmap showing the number of overlapping DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. (G) Gene Ontology analysis of DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. (H) KEGG pathway analysis of DEGs in plenti-MRPL33-L and plenti-MRPL33-S-transfected cells. MRPL33, mitochondrial ribosomal protein L33; L, long variant; S, short variant; DEGs, differentially expressed genes; KEGG, Kyoto Encyclopedia of Genes and Genomes.

    Techniques Used: Over Expression, Transfection, Variant Assay

    Chemoresponse to epirubicin is dependent on the PI3K/AKT/CREB/apoptosis axis, which is regulated by MRPL33-L and MRPL33-S in gastric cancer cells. (A) Western blot analysis and (B) corresponding histogram of ratio of p-AKT/AKT, ratio of p-CREB/CREB, Mcl-1 and Bcl-2 expression levels in the AGS cell groups (control, plenti-vector-plentil-MRPL33-S and plenti-MRPL33-L-transfected), with or without 0.3 µ M epirubicin. (C) Western blot analysis and (D) corresponding histogram of ratio of p-AKT/AKT, ratio of p-CREB/CREB, Mcl-1 and Bcl-2 expression levels in the MGC-803 cell groups (control, plenti-vector, plentil-MRPL33-S and plenti-MRPL33-L), with or without 0.3 µ M epirubicin. (E) Histograms of chemoresponse in AGS cell groups and (F) MGC-803 cell groups treated with 0.3 µ M epirubicin for 72 h. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. * P
    Figure Legend Snippet: Chemoresponse to epirubicin is dependent on the PI3K/AKT/CREB/apoptosis axis, which is regulated by MRPL33-L and MRPL33-S in gastric cancer cells. (A) Western blot analysis and (B) corresponding histogram of ratio of p-AKT/AKT, ratio of p-CREB/CREB, Mcl-1 and Bcl-2 expression levels in the AGS cell groups (control, plenti-vector-plentil-MRPL33-S and plenti-MRPL33-L-transfected), with or without 0.3 µ M epirubicin. (C) Western blot analysis and (D) corresponding histogram of ratio of p-AKT/AKT, ratio of p-CREB/CREB, Mcl-1 and Bcl-2 expression levels in the MGC-803 cell groups (control, plenti-vector, plentil-MRPL33-S and plenti-MRPL33-L), with or without 0.3 µ M epirubicin. (E) Histograms of chemoresponse in AGS cell groups and (F) MGC-803 cell groups treated with 0.3 µ M epirubicin for 72 h. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. * P

    Techniques Used: Western Blot, Expressing, Plasmid Preparation, Transfection, Standard Deviation

    Expression of MRPL33-L and MRPL33-S in gastric cancer. (A) Schematic diagram of the splice variants of MRPL33, including or lacking alternative exon 3 (MRPL33-L and MRPL33-S; top). Different amino acid sequences are presented in red font for of MRPL33-L and in blue font for MRPL33-S (bottom). (B) Agarose gel electrophoresis photograph and (C) corresponding scatter diagrams of expression levels of MRPL33-L and MRPL33-S in 10 paired clinical specimens of tumor and matched adjacent normal tissues from patients with gastric cancer. (D) Agarose gel electrophoresis photograph and (E) corresponding histograms of expression levels of MRPL33-L and MRPL33-S in AGS and MGC-803 cells. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. *** P
    Figure Legend Snippet: Expression of MRPL33-L and MRPL33-S in gastric cancer. (A) Schematic diagram of the splice variants of MRPL33, including or lacking alternative exon 3 (MRPL33-L and MRPL33-S; top). Different amino acid sequences are presented in red font for of MRPL33-L and in blue font for MRPL33-S (bottom). (B) Agarose gel electrophoresis photograph and (C) corresponding scatter diagrams of expression levels of MRPL33-L and MRPL33-S in 10 paired clinical specimens of tumor and matched adjacent normal tissues from patients with gastric cancer. (D) Agarose gel electrophoresis photograph and (E) corresponding histograms of expression levels of MRPL33-L and MRPL33-S in AGS and MGC-803 cells. Three independent biological replicates were performed and data were presented as the mean ± standard deviation. *** P

    Techniques Used: Expressing, Agarose Gel Electrophoresis, Standard Deviation

    Analysis of the PI3K/AKT signaling pathway based on the KEGG database. (A) PPI network analysis of 36 target genes involved in the PI3K/AKT signaling pathway in plenti-MRPL33-L-transfected cells and in (B) plenti-MRPL33-S-transfected cells. (C) Map of the PI3K/AKT signaling pathway with the 36 target genes based on the KEGG database. Red and blue represent the upregulation and downregulation of genes, respectively. The size of circle in (A) and (B) indicates significance based on P-value. The square and rounded square in (C) represent genes in plenti-MRPL33-L- and plenti-MRPL33-S-trans-fected cells, respectively. * P
    Figure Legend Snippet: Analysis of the PI3K/AKT signaling pathway based on the KEGG database. (A) PPI network analysis of 36 target genes involved in the PI3K/AKT signaling pathway in plenti-MRPL33-L-transfected cells and in (B) plenti-MRPL33-S-transfected cells. (C) Map of the PI3K/AKT signaling pathway with the 36 target genes based on the KEGG database. Red and blue represent the upregulation and downregulation of genes, respectively. The size of circle in (A) and (B) indicates significance based on P-value. The square and rounded square in (C) represent genes in plenti-MRPL33-L- and plenti-MRPL33-S-trans-fected cells, respectively. * P

    Techniques Used: Transfection

    2) Product Images from "Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides"

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides

    Journal: Biological Procedures Online

    doi: 10.1186/s12575-015-0016-8

    Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.
    Figure Legend Snippet: Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.

    Techniques Used: Plasmid Preparation, Marker, Selection, Polymerase Chain Reaction, Amplification

    3) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    4) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    5) Product Images from "Proxies of CRISPR/Cas9 Activity To Aid in the Identification of Mutagenized Arabidopsis Plants"

    Article Title: Proxies of CRISPR/Cas9 Activity To Aid in the Identification of Mutagenized Arabidopsis Plants

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.120.401110

    Sequence analysis of CRISPR/Cas9 edited proxy genes. CRISPR/Cas9 induced mutations detected via PCR and Sanger sequencing in jar1 (A), gl1 (B) and ein2 (C) mutants across independent T2 progenies. The target sequence is depicted in red. The PAM site is depicted in blue. Indels are depicted in green. Wild type reference DNA sequence (WT) and mutant alleles (M1…5) detected for each proxy gene are shown as sequence alignments.
    Figure Legend Snippet: Sequence analysis of CRISPR/Cas9 edited proxy genes. CRISPR/Cas9 induced mutations detected via PCR and Sanger sequencing in jar1 (A), gl1 (B) and ein2 (C) mutants across independent T2 progenies. The target sequence is depicted in red. The PAM site is depicted in blue. Indels are depicted in green. Wild type reference DNA sequence (WT) and mutant alleles (M1…5) detected for each proxy gene are shown as sequence alignments.

    Techniques Used: Sequencing, CRISPR, Polymerase Chain Reaction, Mutagenesis

    Proxy-based selection scheme of CRISPR-mutagenized plants. (A) The pCUT3-CE construct contains three individual transcriptional units that generate sgRNA for JAR1 , GL1 and EIN2 editing. The expression of each sgRNA is controlled by individual AtU6 promoters (U6P) and poly-T terminator (TTTTTT). (B-D) JAR1 , GL1 and EIN2 target sites. Sequence in red denote the 20nt crRNA target site within each proxy gene. The PAM site is boxed in blue. Scale bar = 0.1kb. (E) Selection scheme using proxy plants: T 0 plants are transformed with the binary vector shown in (A). In the T1 generation, each gene targeted is depicted as a yellow, green or blue diamond, each one positioned on a different Arabidopsis chromosome. The T-DNA harboring CRISPR-Cas9 is depicted as a red chromosome fragment. The genotype of proxy-selected T2 plants is shown at the left end of the scheme: the blue star depicts loss-of-function mutation of the proxy gene that allowed for the visual selection of edited plants, while yellow and green diamonds with a question mark depict surrogate genes of unknow allelic condition that need to be PCR-genotyped.
    Figure Legend Snippet: Proxy-based selection scheme of CRISPR-mutagenized plants. (A) The pCUT3-CE construct contains three individual transcriptional units that generate sgRNA for JAR1 , GL1 and EIN2 editing. The expression of each sgRNA is controlled by individual AtU6 promoters (U6P) and poly-T terminator (TTTTTT). (B-D) JAR1 , GL1 and EIN2 target sites. Sequence in red denote the 20nt crRNA target site within each proxy gene. The PAM site is boxed in blue. Scale bar = 0.1kb. (E) Selection scheme using proxy plants: T 0 plants are transformed with the binary vector shown in (A). In the T1 generation, each gene targeted is depicted as a yellow, green or blue diamond, each one positioned on a different Arabidopsis chromosome. The T-DNA harboring CRISPR-Cas9 is depicted as a red chromosome fragment. The genotype of proxy-selected T2 plants is shown at the left end of the scheme: the blue star depicts loss-of-function mutation of the proxy gene that allowed for the visual selection of edited plants, while yellow and green diamonds with a question mark depict surrogate genes of unknow allelic condition that need to be PCR-genotyped.

    Techniques Used: Selection, CRISPR, Construct, Expressing, Sequencing, Transformation Assay, Plasmid Preparation, Mutagenesis, Polymerase Chain Reaction

    6) Product Images from "Discovery and characterization of a prevalent human gut bacterial enzyme sufficient for the inactivation of a family of plant toxins"

    Article Title: Discovery and characterization of a prevalent human gut bacterial enzyme sufficient for the inactivation of a family of plant toxins

    Journal: eLife

    doi: 10.7554/eLife.33953

    Cgr2 activity, but not EPR-active [4Fe-4S] clusters, increase with higher Fe and S equivalents. ( A ) Ultraviolet-visible (UV-Vis) spectra of reconstituted Cgr2 in the absence or presence of reducing agent sodium dithionite (NaDT) revealed that the [Fe-S] clusters in Cgr2 are redox active. ( B ) Purified Cgr2 did not exhibit a detectable EPR signal. Upon reduction with NaDT, an EPR signal corresponding to [4Fe-4S] 1+ clusters was detected in purified Cgr2. This signal was amplified in reconstituted Cgr2, showing incorporation of additional [4Fe-4S] cluster(s). Samples contained 200 µM protein, 0.2 mM sodium dithionite, and EPR measurements were conducted at 10 K. ( C ) EPR spectra of dithionite-treated Cgr2 samples that had been reconstituted with 0 (purified), 2, 4, or 8 equivalents of iron and sulfide for 5 hours or overnight (O/N). Samples contained 150 µM protein, 0.3 mM sodium dithionite, and measurements were conducted at 10 K. Number of EPR-active clusters per Cgr2 monomer under each reconstitution condition is shown in parentheses. Spin quantitation was determined against a 150 µM Cu 2+ -EDTA standard measured under non-saturating conditions. ( D ) In vitro reaction rates of Cgr2 reconstituted under different conditions revealed increasing activity with higher reconstitution equivalents. Data represents mean ± SEM (n = 3 independent experiments).
    Figure Legend Snippet: Cgr2 activity, but not EPR-active [4Fe-4S] clusters, increase with higher Fe and S equivalents. ( A ) Ultraviolet-visible (UV-Vis) spectra of reconstituted Cgr2 in the absence or presence of reducing agent sodium dithionite (NaDT) revealed that the [Fe-S] clusters in Cgr2 are redox active. ( B ) Purified Cgr2 did not exhibit a detectable EPR signal. Upon reduction with NaDT, an EPR signal corresponding to [4Fe-4S] 1+ clusters was detected in purified Cgr2. This signal was amplified in reconstituted Cgr2, showing incorporation of additional [4Fe-4S] cluster(s). Samples contained 200 µM protein, 0.2 mM sodium dithionite, and EPR measurements were conducted at 10 K. ( C ) EPR spectra of dithionite-treated Cgr2 samples that had been reconstituted with 0 (purified), 2, 4, or 8 equivalents of iron and sulfide for 5 hours or overnight (O/N). Samples contained 150 µM protein, 0.3 mM sodium dithionite, and measurements were conducted at 10 K. Number of EPR-active clusters per Cgr2 monomer under each reconstitution condition is shown in parentheses. Spin quantitation was determined against a 150 µM Cu 2+ -EDTA standard measured under non-saturating conditions. ( D ) In vitro reaction rates of Cgr2 reconstituted under different conditions revealed increasing activity with higher reconstitution equivalents. Data represents mean ± SEM (n = 3 independent experiments).

    Techniques Used: Activity Assay, Electron Paramagnetic Resonance, Purification, Amplification, Quantitation Assay, In Vitro

    Multiple sequence alignment of urocanate reductases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized urocanate reductases and clustered proteins from the sequence similarity network and were not conserved in Cgr2.
    Figure Legend Snippet: Multiple sequence alignment of urocanate reductases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized urocanate reductases and clustered proteins from the sequence similarity network and were not conserved in Cgr2.

    Techniques Used: Sequencing

    Identification of 6 cysteine residues important for Cgr2 activity. ( A ) Whole cell assays of R. erythropolis expressing individual cysteine to alanine point mutants and incubated with digoxin demonstrated that six cysteine residues are important for activity. Data represents mean ± SEM (n = 3 biological replicates). Asterisks indicate statistical significance of each variant compared to wild-type Cgr2 by Student’s t test (*p
    Figure Legend Snippet: Identification of 6 cysteine residues important for Cgr2 activity. ( A ) Whole cell assays of R. erythropolis expressing individual cysteine to alanine point mutants and incubated with digoxin demonstrated that six cysteine residues are important for activity. Data represents mean ± SEM (n = 3 biological replicates). Asterisks indicate statistical significance of each variant compared to wild-type Cgr2 by Student’s t test (*p

    Techniques Used: Activity Assay, Expressing, Incubation, Variant Assay

    Preliminary model for digoxin metabolism by Cgr1 and Cgr2. ( A ) Proposed biochemical model and ( B ) mechanism of digoxin reduction by Cgr proteins. Cgr1 is predicted to transfer electrons from a membrane-associated electron donor to the [4Fe-4S] 2+ cluster of Cgr2 via covalently bound heme groups. The reduced [4Fe-4S] 1+ cluster of Cgr2 could sequentially transfer two electrons to FAD, generating FADH – , which could mediate hydride transfer to the β-position of the digoxin lactone ring. Protonation of the resulting intermediate would yield (20 R )-dihydrodigoxin.
    Figure Legend Snippet: Preliminary model for digoxin metabolism by Cgr1 and Cgr2. ( A ) Proposed biochemical model and ( B ) mechanism of digoxin reduction by Cgr proteins. Cgr1 is predicted to transfer electrons from a membrane-associated electron donor to the [4Fe-4S] 2+ cluster of Cgr2 via covalently bound heme groups. The reduced [4Fe-4S] 1+ cluster of Cgr2 could sequentially transfer two electrons to FAD, generating FADH – , which could mediate hydride transfer to the β-position of the digoxin lactone ring. Protonation of the resulting intermediate would yield (20 R )-dihydrodigoxin.

    Techniques Used:

    Multiple sequence alignment of fumarate reductases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized fumarate reductases and clustered proteins from the sequence similarity network. These residues were not conserved in Cgr2 and another predicted fumarate reductase (Cac4) associated with the cgr gene cluster.
    Figure Legend Snippet: Multiple sequence alignment of fumarate reductases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized fumarate reductases and clustered proteins from the sequence similarity network. These residues were not conserved in Cgr2 and another predicted fumarate reductase (Cac4) associated with the cgr gene cluster.

    Techniques Used: Sequencing

    [Fe-S] cluster(s) affect Cgr2 stability and oligomerization. ( A ) SDS-PAGE analysis of heterologously expressed Cgr2(–48aa)-NHis 6 constructs (expected mass = 55 kDa) purified on HisPur Ni-NTA resin. Heat-generating lysis methods (e.g. sonication) led to substantial protein degradation as compared to cell disruption. ( B ) Analytical fast protein liquid chromatography (FPLC) performed under aerobic and anaerobic conditions. Colored bars highlight molecular weights corresponding to dimeric (blue) or monomeric (pink) Cgr2. ( C ) Thermal melt curves displaying relative fluorescence of Sypro Orange bound to purified and ( D ) reconstituted Cgr2 in various pH buffers. Protein melting temperature (Tm) of purified protein was
    Figure Legend Snippet: [Fe-S] cluster(s) affect Cgr2 stability and oligomerization. ( A ) SDS-PAGE analysis of heterologously expressed Cgr2(–48aa)-NHis 6 constructs (expected mass = 55 kDa) purified on HisPur Ni-NTA resin. Heat-generating lysis methods (e.g. sonication) led to substantial protein degradation as compared to cell disruption. ( B ) Analytical fast protein liquid chromatography (FPLC) performed under aerobic and anaerobic conditions. Colored bars highlight molecular weights corresponding to dimeric (blue) or monomeric (pink) Cgr2. ( C ) Thermal melt curves displaying relative fluorescence of Sypro Orange bound to purified and ( D ) reconstituted Cgr2 in various pH buffers. Protein melting temperature (Tm) of purified protein was

    Techniques Used: SDS Page, Construct, Purification, Lysis, Sonication, Fast Protein Liquid Chromatography, Fluorescence

    Clustal Omega alignment of Sanger-sequenced cgr2 confirms high degree of conservation.
    Figure Legend Snippet: Clustal Omega alignment of Sanger-sequenced cgr2 confirms high degree of conservation.

    Techniques Used:

    Cgr2 is a distinct flavoprotein reductase. ( A ) General mechanism of catalysis by Cgr2 homologs. Cgr2 appeared to lack most of the conserved active site residues found in the most similar related enzymes, including ( B ) 6/7 residues utilized by fumarate reductases, ( C ) 4/5 residues utilized by urocanate reductases, and ( D ) 3/5 residues utilized by ketosteroid dehydrogenases. Active site residues are shown with numbering based on S. putrefaciens fumarate reductase, S. oneidensis MR-1 urocanate reductase, and R. erythropolis SQ1 ketosteroid dehydrogenase. Residues shown in red were conserved in Cgr2. ( E ) Two residues involved in substrate binding and activation in ketosteroid dehydrogenases were conserved in Cgr2 (Y532, G536). Whole cell assays in R. erythropolis overexpressing putative active site mutants in Cgr2 showed that Y532 was not essential for Cgr2 activity towards digoxin. Data represents mean ± SEM (n = 3 biological replicates).
    Figure Legend Snippet: Cgr2 is a distinct flavoprotein reductase. ( A ) General mechanism of catalysis by Cgr2 homologs. Cgr2 appeared to lack most of the conserved active site residues found in the most similar related enzymes, including ( B ) 6/7 residues utilized by fumarate reductases, ( C ) 4/5 residues utilized by urocanate reductases, and ( D ) 3/5 residues utilized by ketosteroid dehydrogenases. Active site residues are shown with numbering based on S. putrefaciens fumarate reductase, S. oneidensis MR-1 urocanate reductase, and R. erythropolis SQ1 ketosteroid dehydrogenase. Residues shown in red were conserved in Cgr2. ( E ) Two residues involved in substrate binding and activation in ketosteroid dehydrogenases were conserved in Cgr2 (Y532, G536). Whole cell assays in R. erythropolis overexpressing putative active site mutants in Cgr2 showed that Y532 was not essential for Cgr2 activity towards digoxin. Data represents mean ± SEM (n = 3 biological replicates).

    Techniques Used: Binding Assay, Activation Assay, Activity Assay

    Phylogenetic tree of assayed E. lenta strains showing cgr2 Y333/N333 variants.
    Figure Legend Snippet: Phylogenetic tree of assayed E. lenta strains showing cgr2 Y333/N333 variants.

    Techniques Used:

    Multiple sequence alignment of ketosteroid dehydrogenases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized ketosteroid dehydrogenases and clustered proteins from the sequence similarity network. Two residues involved in substrate binding and activation were conserved in Cgr2 (Y532, G536).
    Figure Legend Snippet: Multiple sequence alignment of ketosteroid dehydrogenases. UniProtKB ID numbers are shown in parentheses. Active site residues (marked with an asterisk) were conserved in characterized ketosteroid dehydrogenases and clustered proteins from the sequence similarity network. Two residues involved in substrate binding and activation were conserved in Cgr2 (Y532, G536).

    Techniques Used: Sequencing, Binding Assay, Activation Assay

    Cgr2 is widespread in the human gut microbiome. ( A ) Analysis of the cgr -associated gene cluster and E. lenta (via elenmrk1 ) prevalence in the gut metagenomes of 1872 individuals ( see Materials and methods) revealed that both E. lenta and cgr2 are highly prevalent (41.5% and 27.7% respectively) but frequently low in abundance. ( B ) Quantification of E. lenta and cgr2 abundances in individual gut metagenomes revealed a tight correlation between the two, providing evidence that cgr2 is restricted to E. lenta and that individuals may harbor sub-populations of both cgr2+ and cgr2 - strains. Red line denotes the expected linear relationship and dashed lines represent a ± half log deviation. (Inset) Histogram of cgr- ratio ( cgr/elnmrk1 ) demonstrates a significant skew away from communities that would have more cgr2 than expected by E. lenta abundance (p
    Figure Legend Snippet: Cgr2 is widespread in the human gut microbiome. ( A ) Analysis of the cgr -associated gene cluster and E. lenta (via elenmrk1 ) prevalence in the gut metagenomes of 1872 individuals ( see Materials and methods) revealed that both E. lenta and cgr2 are highly prevalent (41.5% and 27.7% respectively) but frequently low in abundance. ( B ) Quantification of E. lenta and cgr2 abundances in individual gut metagenomes revealed a tight correlation between the two, providing evidence that cgr2 is restricted to E. lenta and that individuals may harbor sub-populations of both cgr2+ and cgr2 - strains. Red line denotes the expected linear relationship and dashed lines represent a ± half log deviation. (Inset) Histogram of cgr- ratio ( cgr/elnmrk1 ) demonstrates a significant skew away from communities that would have more cgr2 than expected by E. lenta abundance (p

    Techniques Used:

    Putative substrates for Cgr2 in the context of the human gut. ( A ) Plant-derived cardenolides. ( B ) Bufadienolides. ( C ) Dietary furanones, including sotolon (4,5-dimethyl-3-hydroxy-2,5-dihydrofuran-2-one), emoxyfuranone (5-ethyl-3-hydroxy-4-methyl-2(5 hr)-furanone), DMMF (2,5-dimethyl-4-methoxy-3(2 hr)-furanone), MHF (4-hydroxy-5-methyl-3-furanone), DMHF (4-Hydroxy-2,5-dimethyl-3(2 hr)-furanone), and EMHF (5-ethyl-4-hydroxy-2-methyl-3(2 hr)-furanone). ( D ) α,β-unsaturated carboxylic acids, including the antibiotic fusidic acid and substrates of similar bacterial reductases. ( E ) Ketosteroids, including naturally occurring hormones, synthetic steroid drugs, and putative cholesterol metabolites. ( F ) Unsaturated prostaglandins involved in host inflammation.
    Figure Legend Snippet: Putative substrates for Cgr2 in the context of the human gut. ( A ) Plant-derived cardenolides. ( B ) Bufadienolides. ( C ) Dietary furanones, including sotolon (4,5-dimethyl-3-hydroxy-2,5-dihydrofuran-2-one), emoxyfuranone (5-ethyl-3-hydroxy-4-methyl-2(5 hr)-furanone), DMMF (2,5-dimethyl-4-methoxy-3(2 hr)-furanone), MHF (4-hydroxy-5-methyl-3-furanone), DMHF (4-Hydroxy-2,5-dimethyl-3(2 hr)-furanone), and EMHF (5-ethyl-4-hydroxy-2-methyl-3(2 hr)-furanone). ( D ) α,β-unsaturated carboxylic acids, including the antibiotic fusidic acid and substrates of similar bacterial reductases. ( E ) Ketosteroids, including naturally occurring hormones, synthetic steroid drugs, and putative cholesterol metabolites. ( F ) Unsaturated prostaglandins involved in host inflammation.

    Techniques Used: Derivative Assay

    7) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.
    Figure Legend Snippet: Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.

    Techniques Used: Time-lapse Microscopy, Fluorescence

    8) Product Images from "Aldo-keto Reductase 1B15 (AKR1B15)"

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.610121

    Expression of AKR1B10 , AKR1B15.1 , and AKR1B15.2 in tissues and cell lines. A , semiquantitative end point RT-PCR with cDNA from tissues and cell lines shows different expression patterns for AKR1B15 and AKR1B10. GAPDH as well as reactions without reverse
    Figure Legend Snippet: Expression of AKR1B10 , AKR1B15.1 , and AKR1B15.2 in tissues and cell lines. A , semiquantitative end point RT-PCR with cDNA from tissues and cell lines shows different expression patterns for AKR1B15 and AKR1B10. GAPDH as well as reactions without reverse

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    Expression and purification of AKR1B10, AKR1B15.1, and AKR1B15.2 in E. coli BL21 (DE3). Protein bands in Coomassie-stained SDS-polyacrylamide gels are shown. A , lysates of isopropyl 1-thio-β- d -galactopyranoside-induced ( I ) but not uninduced (
    Figure Legend Snippet: Expression and purification of AKR1B10, AKR1B15.1, and AKR1B15.2 in E. coli BL21 (DE3). Protein bands in Coomassie-stained SDS-polyacrylamide gels are shown. A , lysates of isopropyl 1-thio-β- d -galactopyranoside-induced ( I ) but not uninduced (

    Techniques Used: Expressing, Purification, Staining

    Subcellular distribution of the two AKR1B15 isoforms. HeLa cells were transiently transfected with either N-Myc-pcDNA3-AKR1B15.2 ( a ), N-Myc-pcDNA3-AKR1B15.1 ( b ), pcDNA4-Myc/His B-AKR1B15.2 ( c ), pcDNA4-Myc/His B-AKR1B15.1 ( d ), pcDNA3.1(+)-AKR1B15.2 ( e
    Figure Legend Snippet: Subcellular distribution of the two AKR1B15 isoforms. HeLa cells were transiently transfected with either N-Myc-pcDNA3-AKR1B15.2 ( a ), N-Myc-pcDNA3-AKR1B15.1 ( b ), pcDNA4-Myc/His B-AKR1B15.2 ( c ), pcDNA4-Myc/His B-AKR1B15.1 ( d ), pcDNA3.1(+)-AKR1B15.2 ( e

    Techniques Used: Transfection

    Generation of specific polyclonal and monoclonal anti-AKR1B15 antibodies and detection of endogenous AKR1B15 isoforms. A , different His-tagged human AKRs (AKR6A3, AKR1B1, AKR1B10, AKR1B15.1, AKR1B15.2, and AKR1A1) were expressed in E. coli BL21 (DE3)
    Figure Legend Snippet: Generation of specific polyclonal and monoclonal anti-AKR1B15 antibodies and detection of endogenous AKR1B15 isoforms. A , different His-tagged human AKRs (AKR6A3, AKR1B1, AKR1B10, AKR1B15.1, AKR1B15.2, and AKR1A1) were expressed in E. coli BL21 (DE3)

    Techniques Used:

    9) Product Images from "A-to-I RNA editing in the rat brain is age-dependent, region-specific and sensitive to environmental stress across generations"

    Article Title: A-to-I RNA editing in the rat brain is age-dependent, region-specific and sensitive to environmental stress across generations

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4409-8

    Transgenerational effects of stress on A-to-I RNA editing and related gene expression levels in the rat brain. a Experimental Design: Transgenerational transmission of stress effects. b mRNA gene expression of Adar , Adarb1 and Htr2c ( b 1 ), and Htr2c A-D site editing ( b 2 ) In PFC of F1 (top row) and F2 (bottom row) offspring. c mRNA gene expression of Adar , Adarb1 and Htr2c ( c 1 ), and RNA editing levels of 4 Htr2c sites ( c 2 ), In AMY of F1 (top row) and F2 (bottom row) offspring. d Htr2c isoform distribution changes between C and PRS (F0), O1-C and O1-PRS (F1) and O2-C and O2-PRS (F2) in PFC ( d 1 ) and AMY ( d 2 ). * p
    Figure Legend Snippet: Transgenerational effects of stress on A-to-I RNA editing and related gene expression levels in the rat brain. a Experimental Design: Transgenerational transmission of stress effects. b mRNA gene expression of Adar , Adarb1 and Htr2c ( b 1 ), and Htr2c A-D site editing ( b 2 ) In PFC of F1 (top row) and F2 (bottom row) offspring. c mRNA gene expression of Adar , Adarb1 and Htr2c ( c 1 ), and RNA editing levels of 4 Htr2c sites ( c 2 ), In AMY of F1 (top row) and F2 (bottom row) offspring. d Htr2c isoform distribution changes between C and PRS (F0), O1-C and O1-PRS (F1) and O2-C and O2-PRS (F2) in PFC ( d 1 ) and AMY ( d 2 ). * p

    Techniques Used: Expressing, Transmission Assay

    Age-dependent changes in A-to-I RNA editing and gene expression in rat brain. a Significant age-dependent changes in RNA editing at non-synonymous editing sites in PFC ( a 1 ) and AMY ( a 2 ). b Age-dependent changes in Adar and Adarb1 mRNA expression in PFC ( b 1 ) and AMY ( b 2 ). c Age-dependent changes in Htr2c A-D site editing ( c 1 ) and mRNA expression ( c 2 ) in PFC. d Age-dependent changes in Htr2c A-D site editing ( d 1 ) and mRNA expression ( d 2 ) in AMY. e Age-dependent changes in Htr2c isoform prevalence in PFC ( e 1 ) and AMY ( e 2 ). Columns represent individual samples. Rows represent editing sites. * p
    Figure Legend Snippet: Age-dependent changes in A-to-I RNA editing and gene expression in rat brain. a Significant age-dependent changes in RNA editing at non-synonymous editing sites in PFC ( a 1 ) and AMY ( a 2 ). b Age-dependent changes in Adar and Adarb1 mRNA expression in PFC ( b 1 ) and AMY ( b 2 ). c Age-dependent changes in Htr2c A-D site editing ( c 1 ) and mRNA expression ( c 2 ) in PFC. d Age-dependent changes in Htr2c A-D site editing ( d 1 ) and mRNA expression ( d 2 ) in AMY. e Age-dependent changes in Htr2c isoform prevalence in PFC ( e 1 ) and AMY ( e 2 ). Columns represent individual samples. Rows represent editing sites. * p

    Techniques Used: Expressing

    Stress-induced changes in A-to-I RNA editing and related gene expression levels in rat brain. a stress-induced changes in Adar and Adarb1 mRNA expression ( a 1 ), RNA editing ( a 2 ) and Htr2c mRNA expression ( a 3 ) in PFC. b stress-induced changes in Adar and Adarb1 mRNA expression ( b 1 ), RNA editing ( b 2 ) and Htr2c mRNA expression ( b 3 ) in AMY. Only significant editing changes are shown. * p
    Figure Legend Snippet: Stress-induced changes in A-to-I RNA editing and related gene expression levels in rat brain. a stress-induced changes in Adar and Adarb1 mRNA expression ( a 1 ), RNA editing ( a 2 ) and Htr2c mRNA expression ( a 3 ) in PFC. b stress-induced changes in Adar and Adarb1 mRNA expression ( b 1 ), RNA editing ( b 2 ) and Htr2c mRNA expression ( b 3 ) in AMY. Only significant editing changes are shown. * p

    Techniques Used: Expressing

    10) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    11) Product Images from "Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1 [W]Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1 [W] [OPEN]"

    Article Title: Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1 [W]Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control 1 [W] [OPEN]

    Journal: Plant Physiology

    doi: 10.1104/pp.114.251009

    Complementation of smt15
    Figure Legend Snippet: Complementation of smt15

    Techniques Used:

    Elevated Glutathione Levels in smt15-1 Affect the Sulfur Acclimation Response
    Figure Legend Snippet: Elevated Glutathione Levels in smt15-1 Affect the Sulfur Acclimation Response

    Techniques Used:

    Complementation of the smt15-1 mutant. Expression levels are shown for SMT15 mRNA in the wild type (wt), smt15-1 , and three independently generated smt15-1 transformants that were complemented with pSMT15.1 (lines 57, 62, and 64).
    Figure Legend Snippet: Complementation of the smt15-1 mutant. Expression levels are shown for SMT15 mRNA in the wild type (wt), smt15-1 , and three independently generated smt15-1 transformants that were complemented with pSMT15.1 (lines 57, 62, and 64).

    Techniques Used: Mutagenesis, Expressing, Generated

    Complementation of smt15
    Figure Legend Snippet: Complementation of smt15

    Techniques Used:

    Regulation of SMT15 transcript abundance. A, Relative expression level of SMT15 or CDKB mRNA in light is marked by light blue columns. Relative expression levels of SMT15 or CDKB (L/D = 14h/10h) or 10-h-light/14-h-dark
    Figure Legend Snippet: Regulation of SMT15 transcript abundance. A, Relative expression level of SMT15 or CDKB mRNA in light is marked by light blue columns. Relative expression levels of SMT15 or CDKB (L/D = 14h/10h) or 10-h-light/14-h-dark

    Techniques Used: Expressing

    ) of the wild type (wt), smt15-1 , sac1 ) or after sulfur depletion for 16 h (−S). Strains that showed significant differences
    Figure Legend Snippet: ) of the wild type (wt), smt15-1 , sac1 ) or after sulfur depletion for 16 h (−S). Strains that showed significant differences

    Techniques Used:

    A, Viability of wild-type (wt) and smt15-1 strains following S deprivation in liquid medium. B, Expression patterns of SMT15
    Figure Legend Snippet: A, Viability of wild-type (wt) and smt15-1 strains following S deprivation in liquid medium. B, Expression patterns of SMT15

    Techniques Used: Expressing

    The Sulfur Acclimation Response Is Affected in smt15-1 Cells
    Figure Legend Snippet: The Sulfur Acclimation Response Is Affected in smt15-1 Cells

    Techniques Used:

    A, Graph showing passage through commitment (dashed lines) and mitotic index (solid lines) of synchronous cultures. Wild-type (wt) culture entered S/M phase at approximately 12 h; smt15-1 culture entered S/M phase at approximately 10 h. The cell cycle
    Figure Legend Snippet: A, Graph showing passage through commitment (dashed lines) and mitotic index (solid lines) of synchronous cultures. Wild-type (wt) culture entered S/M phase at approximately 12 h; smt15-1 culture entered S/M phase at approximately 10 h. The cell cycle

    Techniques Used:

    Molecular characterization of SMT15 . A, Schematic of smt15-1 insertion with chromosome number, coordinates, and genome version indicated. White boxes indicate exons. The inverted triangle indicates the position where insertion occurred. The locations
    Figure Legend Snippet: Molecular characterization of SMT15 . A, Schematic of smt15-1 insertion with chromosome number, coordinates, and genome version indicated. White boxes indicate exons. The inverted triangle indicates the position where insertion occurred. The locations

    Techniques Used:

    12) Product Images from "Protein and Antibody Engineering by Phage Display"

    Article Title: Protein and Antibody Engineering by Phage Display

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2016.05.005

    Kunkel mutagenesis. Single-stranded D NA with uracil incorporated (dU-ssDNA; green ( gray in the print version) above) is isolated from phage produced in CJ236 cells. Degenerate primers ( red ( black in the print version)) are annealed (mutagenesis regions indicated by asterices ) to the dU-ssDNA. T7 DNA polymerase and T4 DNA ligase and dNTPs are added to synthesize the complementary strand based on the dU-ssDNA template. This covalently closed circular double-stranded DNA (CCC-dsDNA) is then electroporated into E. coli SS320 cells, in which the uracil-containing template is deactivated and the new, mutagenic strand is preferentially replicated.
    Figure Legend Snippet: Kunkel mutagenesis. Single-stranded D NA with uracil incorporated (dU-ssDNA; green ( gray in the print version) above) is isolated from phage produced in CJ236 cells. Degenerate primers ( red ( black in the print version)) are annealed (mutagenesis regions indicated by asterices ) to the dU-ssDNA. T7 DNA polymerase and T4 DNA ligase and dNTPs are added to synthesize the complementary strand based on the dU-ssDNA template. This covalently closed circular double-stranded DNA (CCC-dsDNA) is then electroporated into E. coli SS320 cells, in which the uracil-containing template is deactivated and the new, mutagenic strand is preferentially replicated.

    Techniques Used: Mutagenesis, Isolation, Produced, Countercurrent Chromatography

    13) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    14) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    15) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    16) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.
    Figure Legend Snippet: Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.

    Techniques Used: Time-lapse Microscopy, Fluorescence

    17) Product Images from "The Nucleotide Excision Repair System of Borrelia burgdorferi Is the Sole Pathway Involved in Repair of DNA Damage by UV Light"

    Article Title: The Nucleotide Excision Repair System of Borrelia burgdorferi Is the Sole Pathway Involved in Repair of DNA Damage by UV Light

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00043-13

    UV-induced DNA damage in B. burgdorferi . (A) Flowchart representation of the ESS assay used to detect DNA damage in B. burgdorferi ). Briefly, B. burgdorferi was resuspended in PBS and exposed to UV light. Genomic
    Figure Legend Snippet: UV-induced DNA damage in B. burgdorferi . (A) Flowchart representation of the ESS assay used to detect DNA damage in B. burgdorferi ). Briefly, B. burgdorferi was resuspended in PBS and exposed to UV light. Genomic

    Techniques Used:

    18) Product Images from "One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome"

    Article Title: One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome

    Journal:

    doi: 10.1073/pnas.0811011106

    The construction of JCVI-1.9 by an independent 25-piece assembly. ( A ) DNA was extracted from 10 yeast clones (c11–c20), and multiplex PCR, with primer set 3, was performed. Clone 11 generated all 10 predicted amplicons and thus was selected for
    Figure Legend Snippet: The construction of JCVI-1.9 by an independent 25-piece assembly. ( A ) DNA was extracted from 10 yeast clones (c11–c20), and multiplex PCR, with primer set 3, was performed. Clone 11 generated all 10 predicted amplicons and thus was selected for

    Techniques Used: Clone Assay, Multiplex Assay, Polymerase Chain Reaction, Generated

    Multiplex PCR analysis to screen for yeast cells that took up all 25 segments. ( A ) Forty amplicons were designed such that 10 products could be produced in four separate multiplex PCR reactions (set 1 [red], set 2 [green], set 3 [blue], set 4 [purple]).
    Figure Legend Snippet: Multiplex PCR analysis to screen for yeast cells that took up all 25 segments. ( A ) Forty amplicons were designed such that 10 products could be produced in four separate multiplex PCR reactions (set 1 [red], set 2 [green], set 3 [blue], set 4 [purple]).

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Produced

    19) Product Images from "Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries"

    Article Title: Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries

    Journal: Genome Biology

    doi: 10.1186/gb-2011-12-2-r18

    'PER' genome-wide base composition bias curves . (a,b) Shown is the GC bias in Illumina reads from a 400-bp fragment library amplified using the standard PCR protocol (Phusion HF, short denaturation) on a fast-ramping thermocycler (red squares), Phusion HF with long denaturation and 2M betaine (black triangles), AccuPrime Taq HiFi with long denaturation and primer extension at 65°C (blue diamonds) or 60°C (purple diamonds). To calculate the observed to expected (unbiased) read coverage, the number of reads aligning to 50-bp windows at a given %GC was divided by the number of 50-bp windows that fall in this %GC category. This value was then normalized relative to the average value from 48% through 52% GC and plotted on a log 10 scale (a) or linear scale (b).
    Figure Legend Snippet: 'PER' genome-wide base composition bias curves . (a,b) Shown is the GC bias in Illumina reads from a 400-bp fragment library amplified using the standard PCR protocol (Phusion HF, short denaturation) on a fast-ramping thermocycler (red squares), Phusion HF with long denaturation and 2M betaine (black triangles), AccuPrime Taq HiFi with long denaturation and primer extension at 65°C (blue diamonds) or 60°C (purple diamonds). To calculate the observed to expected (unbiased) read coverage, the number of reads aligning to 50-bp windows at a given %GC was divided by the number of 50-bp windows that fall in this %GC category. This value was then normalized relative to the average value from 48% through 52% GC and plotted on a log 10 scale (a) or linear scale (b).

    Techniques Used: Genome Wide, Amplification, Polymerase Chain Reaction

    Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).
    Figure Legend Snippet: Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).

    Techniques Used: Polymerase Chain Reaction

    Optimizing the PCR conditions . (a) Neither extending the denaturation times (dark red squares) nor adding 2M betaine (black triangles) is sufficient to recover extremely GC-rich DNA fragments by PCR with Phusion HF. (b) Combining long denaturation and 2M betaine is effective for the high-GC fraction (black triangles) but the profile is not as even over the entire GC spectrum as after PCR with AccuPrime Taq HiFi (blue diamonds) using extended denaturation times and a lower temperature (65°C) for primer annealing and extension.
    Figure Legend Snippet: Optimizing the PCR conditions . (a) Neither extending the denaturation times (dark red squares) nor adding 2M betaine (black triangles) is sufficient to recover extremely GC-rich DNA fragments by PCR with Phusion HF. (b) Combining long denaturation and 2M betaine is effective for the high-GC fraction (black triangles) but the profile is not as even over the entire GC spectrum as after PCR with AccuPrime Taq HiFi (blue diamonds) using extended denaturation times and a lower temperature (65°C) for primer annealing and extension.

    Techniques Used: Polymerase Chain Reaction

    20) Product Images from "Adaptable and Efficient Genome Editing by sgRNA-Cas9 Protein Co-injection into Drosophila"

    Article Title: Adaptable and Efficient Genome Editing by sgRNA-Cas9 Protein Co-injection into Drosophila

    Journal: bioRxiv

    doi: 10.1101/2020.05.07.080762

    Screening sgRNAs for cleavage activity in vivo. ( A ) Schematic of the screening assay. Individual embryos are injected with RNPs composed of a particular sgRNA. Genomic DNA from each embryo is PCR-amplified, and amplicons are denatured and re-annealed. Heteroduplexes with mismatches due to indels in embryonic DNA are cleaved by T7E1 enzyme. Gel electrophoresis identifies embryos with detectable cleavage events. ( B ) PCR products of a target site in the forked gene 892 bp in length were digested by T7E1 as indicated. Shown are two representative embryos out of the nine assayed that were injected with forked RNPs. Also shown are two out of the six embryos that were uninjected. The predicted T7E1 digest products are 393 and 436 bp. Although a minority of heteroduplexes derived from an embryo are T7E1-sensitive, they can be detected by this assay. ( C ) A T7E1 assay performed on a sgRNA that was inactive in vivo. The target region is located in non-coding DNA. Three of the 12 RNP-injected embryo samples are shown, and three of the six uninjected embryo samples are shown. Heteroduplexes from the uninjected samples show T7E1 sensitivity that is likely due to sequence polymorphisms or non-B form DNA structures. The predicted T7E1 digest products from NHEJ induced mismatches are 295 and 502 bp. Note that samples from RNP-injected embryos do not exhibit T7E1 products of those sizes.
    Figure Legend Snippet: Screening sgRNAs for cleavage activity in vivo. ( A ) Schematic of the screening assay. Individual embryos are injected with RNPs composed of a particular sgRNA. Genomic DNA from each embryo is PCR-amplified, and amplicons are denatured and re-annealed. Heteroduplexes with mismatches due to indels in embryonic DNA are cleaved by T7E1 enzyme. Gel electrophoresis identifies embryos with detectable cleavage events. ( B ) PCR products of a target site in the forked gene 892 bp in length were digested by T7E1 as indicated. Shown are two representative embryos out of the nine assayed that were injected with forked RNPs. Also shown are two out of the six embryos that were uninjected. The predicted T7E1 digest products are 393 and 436 bp. Although a minority of heteroduplexes derived from an embryo are T7E1-sensitive, they can be detected by this assay. ( C ) A T7E1 assay performed on a sgRNA that was inactive in vivo. The target region is located in non-coding DNA. Three of the 12 RNP-injected embryo samples are shown, and three of the six uninjected embryo samples are shown. Heteroduplexes from the uninjected samples show T7E1 sensitivity that is likely due to sequence polymorphisms or non-B form DNA structures. The predicted T7E1 digest products from NHEJ induced mismatches are 295 and 502 bp. Note that samples from RNP-injected embryos do not exhibit T7E1 products of those sizes.

    Techniques Used: Activity Assay, In Vivo, Screening Assay, Injection, Polymerase Chain Reaction, Amplification, Nucleic Acid Electrophoresis, Derivative Assay, Sequencing, Non-Homologous End Joining

    21) Product Images from "TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting"

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0082539

    Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .
    Figure Legend Snippet: Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .

    Techniques Used: Homologous Recombination, Binding Assay, Zinc-Fingers, Modification

    Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.
    Figure Legend Snippet: Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Incubation

    Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .
    Figure Legend Snippet: Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .

    Techniques Used: Activity Assay, Polymerase Chain Reaction, Plasmid Preparation, Non-Homologous End Joining, TALENs, Cotransfection, Expressing, Flow Cytometry, Cytometry, Transfection

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.
    Figure Legend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.

    Techniques Used: Activity Assay

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.
    Figure Legend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.

    Techniques Used: Activity Assay, Plasmid Preparation, Incubation, Concentration Assay, Polymerase Chain Reaction

    TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.
    Figure Legend Snippet: TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.

    Techniques Used: Binding Assay, Construct, Generated

    22) Product Images from "Enzymatic Assembly of Overlapping DNA Fragments"

    Article Title: Enzymatic Assembly of Overlapping DNA Fragments

    Journal: Methods in Enzymology

    doi: 10.1016/B978-0-12-385120-8.00015-2

    Assembly vector primer design . (A) A linear DNA sequence that is to be assembled into a vector. The first and last 40 bp of DNA sequence is underlined. (B) Two primers that could be used to PCR-amplify pUC19 to produce a vector containing overlaps to the sequence shown in (A), thus producing a circle. The primer sequences include regions that can anneal to pUC19 (nonbolded, lowercase), Not I restriction sites (bolded and italicized, uppercase) to release the insert from the vector, and 40-bp overlaps (underlined, uppercase) to the ends of the DNA sequence shown in (A).
    Figure Legend Snippet: Assembly vector primer design . (A) A linear DNA sequence that is to be assembled into a vector. The first and last 40 bp of DNA sequence is underlined. (B) Two primers that could be used to PCR-amplify pUC19 to produce a vector containing overlaps to the sequence shown in (A), thus producing a circle. The primer sequences include regions that can anneal to pUC19 (nonbolded, lowercase), Not I restriction sites (bolded and italicized, uppercase) to release the insert from the vector, and 40-bp overlaps (underlined, uppercase) to the ends of the DNA sequence shown in (A).

    Techniques Used: Plasmid Preparation, Sequencing, Polymerase Chain Reaction

    23) Product Images from "Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo"

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo

    Journal: Nature protocols

    doi: 10.1038/nprot.2015.094

    The parent vector and competitor vector used in this study. ( a ) Plasmid maps of the parent vector (i.e., pTGFP-T7-Hha10T) and the competitor vector (i.e., pTGFP-T7-Hha10comp). ( b ) Sequences of the parent and competitor vectors between the NheI and EcoRI
    Figure Legend Snippet: The parent vector and competitor vector used in this study. ( a ) Plasmid maps of the parent vector (i.e., pTGFP-T7-Hha10T) and the competitor vector (i.e., pTGFP-T7-Hha10comp). ( b ) Sequences of the parent and competitor vectors between the NheI and EcoRI

    Techniques Used: Plasmid Preparation

    24) Product Images from "Single-stranded DNA and RNA origami"

    Article Title: Single-stranded DNA and RNA origami

    Journal: Science (New York, N.Y.)

    doi: 10.1126/science.aao2648

    Schematic of ssOrigami synthesis and replication by in vitro PCR and by in vivo cloning of ssOrigami genes. ( A ) One-step PCR with two double-stranded gBlock templates containing 30-bp sequence overlap (yellow sections) and two modified primers (phosphorothioate modification on green primer and phosphorylation modification on red primer). ( B ) Double-stranded PCR product with modified 5′ ends. (C) ssDNA product after lambda exonuclease digestion. Phosphorothioate modification protects the forward strand from being digested. ( D ) Folded ssOrigami structure. Note that the folded ssOrigami product can be directly used as a template for its PCR replication. ( E ) Double-stranded gBlock DNA fragments with restriction enzyme sites designed at both ends. ( F ) Ligation of two half fragments into linearized pGEM-7zf (−) vector to form the full-length ssOrigami gene. ( G ) The ligation products were transformed into E. coli NEB stable competent cells. ( H ) Full-length ssOrigami genes were amplified as plasmid DNA in E. coli NEB stable cells. ( I ) The harvested genes were treated by the nicking endonuclease Nb.BbvCI and the restriction endonuclease Hind III. ( J . ( K and L ) Schematic (K) and AFM images [(K), zoomed-in; (L), large field of view] of the 5 × 5 ssOrigami structures produced by the PCR synthesis [first cycle in (A) to (D)]. ( M ) AFM image of 5 × 5 ssOrigami structures produced by PCR replication method [the second cycle in (A) to (D), that is, the re-PCR product]. ( N ) AFM image of 5 × 5 rhombus ssOrigami produced by in vivo cloning method. Detailed experimental information is shown in sections S6 (in vitro PCR) and S7 (in vivo cloning).
    Figure Legend Snippet: Schematic of ssOrigami synthesis and replication by in vitro PCR and by in vivo cloning of ssOrigami genes. ( A ) One-step PCR with two double-stranded gBlock templates containing 30-bp sequence overlap (yellow sections) and two modified primers (phosphorothioate modification on green primer and phosphorylation modification on red primer). ( B ) Double-stranded PCR product with modified 5′ ends. (C) ssDNA product after lambda exonuclease digestion. Phosphorothioate modification protects the forward strand from being digested. ( D ) Folded ssOrigami structure. Note that the folded ssOrigami product can be directly used as a template for its PCR replication. ( E ) Double-stranded gBlock DNA fragments with restriction enzyme sites designed at both ends. ( F ) Ligation of two half fragments into linearized pGEM-7zf (−) vector to form the full-length ssOrigami gene. ( G ) The ligation products were transformed into E. coli NEB stable competent cells. ( H ) Full-length ssOrigami genes were amplified as plasmid DNA in E. coli NEB stable cells. ( I ) The harvested genes were treated by the nicking endonuclease Nb.BbvCI and the restriction endonuclease Hind III. ( J . ( K and L ) Schematic (K) and AFM images [(K), zoomed-in; (L), large field of view] of the 5 × 5 ssOrigami structures produced by the PCR synthesis [first cycle in (A) to (D)]. ( M ) AFM image of 5 × 5 ssOrigami structures produced by PCR replication method [the second cycle in (A) to (D), that is, the re-PCR product]. ( N ) AFM image of 5 × 5 rhombus ssOrigami produced by in vivo cloning method. Detailed experimental information is shown in sections S6 (in vitro PCR) and S7 (in vivo cloning).

    Techniques Used: In Vitro, Polymerase Chain Reaction, In Vivo, Clone Assay, Sequencing, Modification, Ligation, Plasmid Preparation, Transformation Assay, Amplification, Produced

    25) Product Images from "Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides"

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides

    Journal: Biological Procedures Online

    doi: 10.1186/s12575-015-0016-8

    Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.
    Figure Legend Snippet: Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.

    Techniques Used: Plasmid Preparation, Marker, Selection, Polymerase Chain Reaction, Amplification

    Construction of a semi-synthetic M. mycoides genome by RMCE. (A) Schematic diagram of three steps of RMCE. First step: replacement of a 100 kb segment with the landing pad (red bar) via homologous recombination (broken arrows) in yeast. Second step: transformation of the donor plasmid pRC60 carrying the 100 kb synthetic segment (gray solid arrow) to the yeast containing the landing pad genome. Third step: introduction of the synthetic DNA segment into the genome via the loxP sites catalyzed by Cre recombinase, represented by purple arrows. (B) BssHII restriction enzyme maps of M. mycoides genomes:(I) Wild type, (II) the landing pad replacement, and (III) the semi-synthetic genomes. Three BssHII sites exist in wild type M. mycoides genome and two sites are overlapped with each other. The target 100 kb segment (blue arrow) in the genome (I) was replaced with the landing pad (red arrow) shown in genome (II) which was subsequently exchanged with the synthetic counterpart (green arrow) shown in genome (III). An additional BssHII site exists in the synthetic DNA segment, closest to the 3′end of the segment. (C) Contour-clamped homogeneous electric field (CHEF) electrophoresis analysis of BssHII-digested M. mycoides genomes. M. mycoides genome purified from yeast was digested with BssHII shown in the left panel, lane 1: wild type, lane 2: the landing pad replacement, and lane 3: the semi-synthetic genomes. M. mycoides genomes purified from bacterial transplants were digested with BssHII shown in the right panel, lane 1: wild type, lane 2: semi-synthetic clone 1 and lane 3: semi-synthetic clone 2. M: 50 kb lambda DNA ladder.
    Figure Legend Snippet: Construction of a semi-synthetic M. mycoides genome by RMCE. (A) Schematic diagram of three steps of RMCE. First step: replacement of a 100 kb segment with the landing pad (red bar) via homologous recombination (broken arrows) in yeast. Second step: transformation of the donor plasmid pRC60 carrying the 100 kb synthetic segment (gray solid arrow) to the yeast containing the landing pad genome. Third step: introduction of the synthetic DNA segment into the genome via the loxP sites catalyzed by Cre recombinase, represented by purple arrows. (B) BssHII restriction enzyme maps of M. mycoides genomes:(I) Wild type, (II) the landing pad replacement, and (III) the semi-synthetic genomes. Three BssHII sites exist in wild type M. mycoides genome and two sites are overlapped with each other. The target 100 kb segment (blue arrow) in the genome (I) was replaced with the landing pad (red arrow) shown in genome (II) which was subsequently exchanged with the synthetic counterpart (green arrow) shown in genome (III). An additional BssHII site exists in the synthetic DNA segment, closest to the 3′end of the segment. (C) Contour-clamped homogeneous electric field (CHEF) electrophoresis analysis of BssHII-digested M. mycoides genomes. M. mycoides genome purified from yeast was digested with BssHII shown in the left panel, lane 1: wild type, lane 2: the landing pad replacement, and lane 3: the semi-synthetic genomes. M. mycoides genomes purified from bacterial transplants were digested with BssHII shown in the right panel, lane 1: wild type, lane 2: semi-synthetic clone 1 and lane 3: semi-synthetic clone 2. M: 50 kb lambda DNA ladder.

    Techniques Used: Homologous Recombination, Transformation Assay, Plasmid Preparation, Electrophoresis, Purification, Lambda DNA Preparation

    26) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Results of alanine scanning mutagenesis on two G protein-coupled receptors, cannabinoid CB2 receptor (CB2) and vasopressin V2 receptor (V2R) compared with the one-fragment mutagenesis approach used for arrestin-1 (Sun, Ostermaier et al . 13 ). Reason for failure and corresponding percentage within the total number of DNA samples sent for sequencing are given. In case of V2R and arrestin-1, the total number of analyzed samples is smaller than the sum of individual categories as in a few instances several failure reasons could be found within a sequenced sample. Category “failed sequencing” relates to instances with very noisy peaks or no peaks at all in a sequencing electrophoretogram. On the other hand, “lower sequence quality” denotes interpretable sequence traces that had some artefacts or were too short to provide reliable information about success of mutagenesis.
    Figure Legend Snippet: Results of alanine scanning mutagenesis on two G protein-coupled receptors, cannabinoid CB2 receptor (CB2) and vasopressin V2 receptor (V2R) compared with the one-fragment mutagenesis approach used for arrestin-1 (Sun, Ostermaier et al . 13 ). Reason for failure and corresponding percentage within the total number of DNA samples sent for sequencing are given. In case of V2R and arrestin-1, the total number of analyzed samples is smaller than the sum of individual categories as in a few instances several failure reasons could be found within a sequenced sample. Category “failed sequencing” relates to instances with very noisy peaks or no peaks at all in a sequencing electrophoretogram. On the other hand, “lower sequence quality” denotes interpretable sequence traces that had some artefacts or were too short to provide reliable information about success of mutagenesis.

    Techniques Used: Mutagenesis, Sequencing

    27) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Overview of the mutagenesis technique. Two PCR reactions are done per mutant, in each of them approximately half of the vector is amplified. Two fragments containing one mutation are combined, followed by DpnI digestion at 37 °C overnight. Reaction clean-up is performed to purify DNA fragments, which are then assembled by Gibson assembly reaction. Bacteria are transformed with the resulting circular plasmid and plated on selective LB agar plates. One clone per mutant is sent for sequencing either on a selective LB agar 96-well plate or as purified DNA. All steps excluding the plating of the bacteria are done in 96-well plates.
    Figure Legend Snippet: Overview of the mutagenesis technique. Two PCR reactions are done per mutant, in each of them approximately half of the vector is amplified. Two fragments containing one mutation are combined, followed by DpnI digestion at 37 °C overnight. Reaction clean-up is performed to purify DNA fragments, which are then assembled by Gibson assembly reaction. Bacteria are transformed with the resulting circular plasmid and plated on selective LB agar plates. One clone per mutant is sent for sequencing either on a selective LB agar 96-well plate or as purified DNA. All steps excluding the plating of the bacteria are done in 96-well plates.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Plasmid Preparation, Amplification, Transformation Assay, Sequencing, Purification

    Troubleshooting scheme. For mutants which were not obtained in the first round of cloning, another clone can be sequenced, if it exists. Furthermore, the Gibson assembly reaction can be redone with the same purified DNA fragments, followed by bacterial transformation and sequencing. For missing mutants, PCR conditions can be changed or PCR containing both mutagenesis primers (one-fragment approach) can be applied.
    Figure Legend Snippet: Troubleshooting scheme. For mutants which were not obtained in the first round of cloning, another clone can be sequenced, if it exists. Furthermore, the Gibson assembly reaction can be redone with the same purified DNA fragments, followed by bacterial transformation and sequencing. For missing mutants, PCR conditions can be changed or PCR containing both mutagenesis primers (one-fragment approach) can be applied.

    Techniques Used: Clone Assay, Purification, Electroporation Bacterial Transformation, Sequencing, Polymerase Chain Reaction, Mutagenesis

    28) Product Images from "Aldo-keto Reductase 1B15 (AKR1B15)"

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.610121

    Expression of AKR1B10 , AKR1B15.1 , and AKR1B15.2 in tissues and cell lines. A , semiquantitative end point RT-PCR with cDNA from tissues and cell lines shows different expression patterns for AKR1B15 and AKR1B10. GAPDH as well as reactions without reverse
    Figure Legend Snippet: Expression of AKR1B10 , AKR1B15.1 , and AKR1B15.2 in tissues and cell lines. A , semiquantitative end point RT-PCR with cDNA from tissues and cell lines shows different expression patterns for AKR1B15 and AKR1B10. GAPDH as well as reactions without reverse

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    29) Product Images from "In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering"

    Article Title: In situ functional dissection of RNA cis-regulatory elements by multiplex CRISPR-Cas9 genome engineering

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00686-2

    GenERA-based analysis of a predicted MRE network activity. a UDP repertoire ( blue gradient = number of UDPs overlapping a given nucleotide) across the miR-184 target network. Boundaries of the predicted miR-184 binding zone ( dashed line ), extended seed region ( shaded area), and Cas9 DNA double stranded break sites ( yellow dots ) are highlighted. b Spatial distribution of seed-deleting UDPs selected for MRE-score calculation ( top ). UDPs restricted to the miRNA binding zone ( green nt. 1–22) and extending to the full ROI ( gray ) were considered in the analysis. Ranked MRE-score distribution across the miR-184 MRE network ( white dots ) ( bottom ). Underlying UNS values (first to last quartiles) are shown with their sequencing depth (dot size) and spatial distribution ( green and gray ). Bar plot reflects total UDP counts contributing to each MRE-score calculation. Right y axis shows partitions in high , medium , and low MRE-score groups based on the empirical distribution of the data. c Generation of miR-184 mut cell line by CRISPR-Cas9 genome editing. d Quantification of mature miR-184 levels by RT-qPCR in wild type cells and miR-184 mut cells ( n = 3 for each group , error bar = SEM). e Validation of GenERA data. Analysis of crok cDNA and gDNA deletion frequency profiles in wild type and miR-184 mut cells at a control locus ( blue ) compared to the predicted miR-184 MRE locus ( red ) (left plots). Quantification of UNS fold change from MRE UDPs normalized to control UDPs in wild type and miR-184 mut cells ( right bar graphs, Error bar = SEM, Mann-Whitney test, ****P
    Figure Legend Snippet: GenERA-based analysis of a predicted MRE network activity. a UDP repertoire ( blue gradient = number of UDPs overlapping a given nucleotide) across the miR-184 target network. Boundaries of the predicted miR-184 binding zone ( dashed line ), extended seed region ( shaded area), and Cas9 DNA double stranded break sites ( yellow dots ) are highlighted. b Spatial distribution of seed-deleting UDPs selected for MRE-score calculation ( top ). UDPs restricted to the miRNA binding zone ( green nt. 1–22) and extending to the full ROI ( gray ) were considered in the analysis. Ranked MRE-score distribution across the miR-184 MRE network ( white dots ) ( bottom ). Underlying UNS values (first to last quartiles) are shown with their sequencing depth (dot size) and spatial distribution ( green and gray ). Bar plot reflects total UDP counts contributing to each MRE-score calculation. Right y axis shows partitions in high , medium , and low MRE-score groups based on the empirical distribution of the data. c Generation of miR-184 mut cell line by CRISPR-Cas9 genome editing. d Quantification of mature miR-184 levels by RT-qPCR in wild type cells and miR-184 mut cells ( n = 3 for each group , error bar = SEM). e Validation of GenERA data. Analysis of crok cDNA and gDNA deletion frequency profiles in wild type and miR-184 mut cells at a control locus ( blue ) compared to the predicted miR-184 MRE locus ( red ) (left plots). Quantification of UNS fold change from MRE UDPs normalized to control UDPs in wild type and miR-184 mut cells ( right bar graphs, Error bar = SEM, Mann-Whitney test, ****P

    Techniques Used: Activity Assay, Binding Assay, Sequencing, CRISPR, Quantitative RT-PCR, MANN-WHITNEY

    Experimental proof of concept for GenERA analysis. a pck genomic locus showing the 3′UTR relative coordinates of a control region, the predicted miR-184 MRE and the polyA signal. b – d Analysis of CRISPR-based mutagenesis results at each target region described in a . For each genomic locus, the identity of the PAM ( green ), Cas9-mediated DNA double stranded cut site ( arrow head ) and sgRNA protospacer target sequence ( blue , red and purple boxes ) are shown along the corresponding sequences within the pck 3′UTR. Differential analysis of nucleotide deletion profiles reflects negligible differences in cDNA/gDNA mutant read frequencies at the control region ( b ), a substantial enrichment of cDNA sequencing reads containing deletions in the miR-184 MRE seed ( c ), and a complete absence of cDNA reads with missing polyA signals ( d ). The percentage of deleted reads in cDNA and gDNA are shown in orange and green respectively; the position of predicted miR-184 MRE seed sequence and polyA signal are highlighted by shaded areas
    Figure Legend Snippet: Experimental proof of concept for GenERA analysis. a pck genomic locus showing the 3′UTR relative coordinates of a control region, the predicted miR-184 MRE and the polyA signal. b – d Analysis of CRISPR-based mutagenesis results at each target region described in a . For each genomic locus, the identity of the PAM ( green ), Cas9-mediated DNA double stranded cut site ( arrow head ) and sgRNA protospacer target sequence ( blue , red and purple boxes ) are shown along the corresponding sequences within the pck 3′UTR. Differential analysis of nucleotide deletion profiles reflects negligible differences in cDNA/gDNA mutant read frequencies at the control region ( b ), a substantial enrichment of cDNA sequencing reads containing deletions in the miR-184 MRE seed ( c ), and a complete absence of cDNA reads with missing polyA signals ( d ). The percentage of deleted reads in cDNA and gDNA are shown in orange and green respectively; the position of predicted miR-184 MRE seed sequence and polyA signal are highlighted by shaded areas

    Techniques Used: CRISPR, Mutagenesis, Sequencing

    GenERA-based high-content mutagenesis of a candidate 3′UTR. a Design and implementation of experimental steps underlying GenERA-based parallel functional interrogation of RNA regulatory elements. b Genomic coordinates of CG9257 3′UTR showing the position and distribution of protospacers corresponding to all sgRNAs used to target this region ( green ). Red bars show the position of Sp Cas9 cut site for each sgRNA in the library. The relative locations of gDNA and cDNA NGS library primers are indicated by blue and red arrows respectively. Blue histogram reflects the total number of UDPs covering each individual nucleotide across the targeted region. c Coverage and distribution of all UDPs sorted by the position of the first deleted nucleotide and length of deletion. The position of nucleotides across the CG9257 3′UTR is shown on the x axis and the cumulative unique deletions count on the y axis
    Figure Legend Snippet: GenERA-based high-content mutagenesis of a candidate 3′UTR. a Design and implementation of experimental steps underlying GenERA-based parallel functional interrogation of RNA regulatory elements. b Genomic coordinates of CG9257 3′UTR showing the position and distribution of protospacers corresponding to all sgRNAs used to target this region ( green ). Red bars show the position of Sp Cas9 cut site for each sgRNA in the library. The relative locations of gDNA and cDNA NGS library primers are indicated by blue and red arrows respectively. Blue histogram reflects the total number of UDPs covering each individual nucleotide across the targeted region. c Coverage and distribution of all UDPs sorted by the position of the first deleted nucleotide and length of deletion. The position of nucleotides across the CG9257 3′UTR is shown on the x axis and the cumulative unique deletions count on the y axis

    Techniques Used: Mutagenesis, Functional Assay, Next-Generation Sequencing

    Implementation of GenERA for combinatorial RRE analysis. a CG9257 3′UTR displaying the boundaries of Zone A and Zone B, identity and position of all predicted MREs ( red ; low stringency miRanda target prediction algorithm), final sgRNAs designed to target each MRE ( green ), and gDNA/cDNA NGS library primers ( black arrows ). b The efficiency of all sgRNAs was tested by NGS and represented as percentage of reads containing deletions in the gDNA library (y axis). Final sgRNAs ( green ) were selected based on their efficiency and position relative to the seven predicted MREs. Since sgRNAs α2 and α3 which targeted zone A miR-252 MRE had relatively low efficiencies (5.8 and 4.6% respectively), they were delivered together in all combinatorial pools in order to increase the chance of generating miR-252 MRE deletions. c sgRNA multiplex strategy. All possible individual and combinatorial sgRNA pools ( n = 63) were delivered to cells in an arrayed format. Green squares illustrate sgRNA identity in each given pool. Since sgRNAs α2 and α3 only targeted one MRE (Zone A miR-252) and had relatively low efficiencies ( a ), they were delivered together in all combinatorial pools in order to increase the chance of generating miR-252 MRE deletions. d Analysis of nucleotide deletion frequencies in cDNA ( orange ) and gDNA ( green ) generated by all combinatorial sgRNA pools in c reveals the regulatory activities associated with Zone A and Zone B. e Distribution of UNS values (first to last quartiles) calculated for all UDPs that overlap with Zone A ( green ), Zone B ( red ) and those concomitantly associated with Zone A and B ( blue ) ( n = 93 for Zone A, n = 300 for Zone B, n = 272 for Zone A + B, error bars = + / − SD, Mann-Whitney test, ****P
    Figure Legend Snippet: Implementation of GenERA for combinatorial RRE analysis. a CG9257 3′UTR displaying the boundaries of Zone A and Zone B, identity and position of all predicted MREs ( red ; low stringency miRanda target prediction algorithm), final sgRNAs designed to target each MRE ( green ), and gDNA/cDNA NGS library primers ( black arrows ). b The efficiency of all sgRNAs was tested by NGS and represented as percentage of reads containing deletions in the gDNA library (y axis). Final sgRNAs ( green ) were selected based on their efficiency and position relative to the seven predicted MREs. Since sgRNAs α2 and α3 which targeted zone A miR-252 MRE had relatively low efficiencies (5.8 and 4.6% respectively), they were delivered together in all combinatorial pools in order to increase the chance of generating miR-252 MRE deletions. c sgRNA multiplex strategy. All possible individual and combinatorial sgRNA pools ( n = 63) were delivered to cells in an arrayed format. Green squares illustrate sgRNA identity in each given pool. Since sgRNAs α2 and α3 only targeted one MRE (Zone A miR-252) and had relatively low efficiencies ( a ), they were delivered together in all combinatorial pools in order to increase the chance of generating miR-252 MRE deletions. d Analysis of nucleotide deletion frequencies in cDNA ( orange ) and gDNA ( green ) generated by all combinatorial sgRNA pools in c reveals the regulatory activities associated with Zone A and Zone B. e Distribution of UNS values (first to last quartiles) calculated for all UDPs that overlap with Zone A ( green ), Zone B ( red ) and those concomitantly associated with Zone A and B ( blue ) ( n = 93 for Zone A, n = 300 for Zone B, n = 272 for Zone A + B, error bars = + / − SD, Mann-Whitney test, ****P

    Techniques Used: Next-Generation Sequencing, Multiplex Assay, Generated, MANN-WHITNEY

    Unbiased surveillance of 3′UTR cis -regulatory potential with GenERA. a Analysis of nucleotide deletion frequencies in cDNA ( orange ) and gDNA ( green ) across the CG9257 3′UTR shows robust regulatory activity in region proximal to the open reading frame (ORF) (Zone A) and marginal activity in the rest of the UTR (Zone B). b Distribution of Zone A and Zone B UDPs ( white lines ) and their corresponding UNS values ( blue gradient). The same number of UDPs was randomly sampled for both zones. c Comparative analysis of all UNS values (first to last quartiles) reflects significantly higher destabilising regulatory activity in Zone A compared to Zone B ( n = 259 for zone A, n = 1003 for zone B, error bars = mean+/− SD, Mann-Whitney test, ****P
    Figure Legend Snippet: Unbiased surveillance of 3′UTR cis -regulatory potential with GenERA. a Analysis of nucleotide deletion frequencies in cDNA ( orange ) and gDNA ( green ) across the CG9257 3′UTR shows robust regulatory activity in region proximal to the open reading frame (ORF) (Zone A) and marginal activity in the rest of the UTR (Zone B). b Distribution of Zone A and Zone B UDPs ( white lines ) and their corresponding UNS values ( blue gradient). The same number of UDPs was randomly sampled for both zones. c Comparative analysis of all UNS values (first to last quartiles) reflects significantly higher destabilising regulatory activity in Zone A compared to Zone B ( n = 259 for zone A, n = 1003 for zone B, error bars = mean+/− SD, Mann-Whitney test, ****P

    Techniques Used: Activity Assay, MANN-WHITNEY

    30) Product Images from "Evidence of Pathogen-Induced Immunogenetic Selection across the Large Geographic Range of a Wild Seabird"

    Article Title: Evidence of Pathogen-Induced Immunogenetic Selection across the Large Geographic Range of a Wild Seabird

    Journal: Molecular Biology and Evolution

    doi: 10.1093/molbev/msaa040

    Minimum spanning haplotype networks for mtDNA HVR1 ( A ), TLR4 ( C ), TLR5 ( D ), and TLR7 ( E ) for Gentoo penguin colonies, along with mtDNA HVR1 maximum clade credibility tree ( B ), using congeneric penguin species as outgroups. Location abbreviations are the same as in previous figures. For minimum spanning haplotype networks, pie charts represent single haplotypes, whereas segment size refers to the contribution of individual sampled sites to the proportion of overall haplotype frequency. Size of pie charts reflects the number of individual birds with the observed haplotype. Dashes on connecting lines each denote one nucleotide change.
    Figure Legend Snippet: Minimum spanning haplotype networks for mtDNA HVR1 ( A ), TLR4 ( C ), TLR5 ( D ), and TLR7 ( E ) for Gentoo penguin colonies, along with mtDNA HVR1 maximum clade credibility tree ( B ), using congeneric penguin species as outgroups. Location abbreviations are the same as in previous figures. For minimum spanning haplotype networks, pie charts represent single haplotypes, whereas segment size refers to the contribution of individual sampled sites to the proportion of overall haplotype frequency. Size of pie charts reflects the number of individual birds with the observed haplotype. Dashes on connecting lines each denote one nucleotide change.

    Techniques Used:

    Haplotype diversity across Gentoo penguin sample populations for ( A ) TLR4 , ( B ) TLR5 , and ( C ) TLR7 . For each locus, different colors represent unique haplotypes and each segment size reflects the proportion of birds in each location with that haplotype. Overall size of the pie chart reflects the number of birds sampled in each location. Location abbreviations are the same as in previous figures.
    Figure Legend Snippet: Haplotype diversity across Gentoo penguin sample populations for ( A ) TLR4 , ( B ) TLR5 , and ( C ) TLR7 . For each locus, different colors represent unique haplotypes and each segment size reflects the proportion of birds in each location with that haplotype. Overall size of the pie chart reflects the number of birds sampled in each location. Location abbreviations are the same as in previous figures.

    Techniques Used:

    31) Product Images from "Genomic Competition for Noise Reduction Shaped Evolutionary Landscape of Mir-4673"

    Article Title: Genomic Competition for Noise Reduction Shaped Evolutionary Landscape of Mir-4673

    Journal: bioRxiv

    doi: 10.1101/788984

    Evolutionary trajectory of the structural features of notch-1 intronic enhancer is aligned to structural maturation of the miR-4673. a, TCF3/4 recognition motifs in intron 4 were depleted in higher primates. Depletion of TCF3/4 recognition motifs was more obvious in the upstream flanking region of NPS miR (UFR miR ) (arrow shows the depletion trend of motifs). b, TFAP2A/B/C binding motifs were enriched in NPS miR towards the higher primates. Lines demonstrate [TFAP2A/B/C]:[TCF3/4] ratio in various mammalian species. c, In primate lineage, tendency of NPS miR to curve symmetrically gradually increased towards Hominins (top diagram, note the increased symmetry of the blue line with reference to the dyad region). This change can improve the translational stability of the nucleosome positioning sequence. d, DNA anisotropy evidenced by W/S dinucleotide oscillations did not change significantly in the primate lineage. e, The miR HR occupies superhelical locations +2.5 and +3 in the NPS with the palindromic sequence at superhelical locations +4.5 and +5 (middle). The superhelical symmetry accommodates 2-fold dyad symmetry of the nucleosome core particle and associated DNA (left, PDB ID: 3REI). In the transcribed RNA, superhelical positions +1 to +6.5 (65 bp) code pre-miR-4673.
    Figure Legend Snippet: Evolutionary trajectory of the structural features of notch-1 intronic enhancer is aligned to structural maturation of the miR-4673. a, TCF3/4 recognition motifs in intron 4 were depleted in higher primates. Depletion of TCF3/4 recognition motifs was more obvious in the upstream flanking region of NPS miR (UFR miR ) (arrow shows the depletion trend of motifs). b, TFAP2A/B/C binding motifs were enriched in NPS miR towards the higher primates. Lines demonstrate [TFAP2A/B/C]:[TCF3/4] ratio in various mammalian species. c, In primate lineage, tendency of NPS miR to curve symmetrically gradually increased towards Hominins (top diagram, note the increased symmetry of the blue line with reference to the dyad region). This change can improve the translational stability of the nucleosome positioning sequence. d, DNA anisotropy evidenced by W/S dinucleotide oscillations did not change significantly in the primate lineage. e, The miR HR occupies superhelical locations +2.5 and +3 in the NPS with the palindromic sequence at superhelical locations +4.5 and +5 (middle). The superhelical symmetry accommodates 2-fold dyad symmetry of the nucleosome core particle and associated DNA (left, PDB ID: 3REI). In the transcribed RNA, superhelical positions +1 to +6.5 (65 bp) code pre-miR-4673.

    Techniques Used: Binding Assay, Sequencing

    MiR-4673 targets are dormant immature pre-miRNAs. a, Near-perfect RNA stem-loops were identified in key modulators of Wnt cascade that are targeted by the miRNA. Selection for structural features of DNA that improve nucleosome positioning propels a parallel journey in the RNA world to superimpose a stem loop signature in the miR HR region of most targets similar to miR-4673 secondary structure. Arrows designate miR HR in the hairpins. b, Co-option of transposable elements into cis -clusters expanded the extant cis -clusters during the Eocene epoch prior to divergence of Catarrhini. Afterwards, a period of dormancy culminated in the evolution of the miRNA.
    Figure Legend Snippet: MiR-4673 targets are dormant immature pre-miRNAs. a, Near-perfect RNA stem-loops were identified in key modulators of Wnt cascade that are targeted by the miRNA. Selection for structural features of DNA that improve nucleosome positioning propels a parallel journey in the RNA world to superimpose a stem loop signature in the miR HR region of most targets similar to miR-4673 secondary structure. Arrows designate miR HR in the hairpins. b, Co-option of transposable elements into cis -clusters expanded the extant cis -clusters during the Eocene epoch prior to divergence of Catarrhini. Afterwards, a period of dormancy culminated in the evolution of the miRNA.

    Techniques Used: Selection

    Adaptive evolution of miR HR enhancers in target genes. a, Average dinucleotide usage map in target genes after symmetrisation to miR HR (left; arrows indicate AA/TT-rich boundaries). Enrichment of TCF3/4 upstream and TFAP2A/B/C downstream to miR HR in symmetrised sequences (middle, right). Background W/S dinucleotide oscillations (bottom) overlapped the TCF3/4 cis-clusters (left; n=101) or TFAP2A/B/C clusters (right, n=86) (red line: mean, grey margin: bootstrapped confidence interval). Box plots show phase offset between oscillations symmetrised to miR HR (linear heat map; see methods). The linear heat maps demonstrate the average value for pair-wise cross-correlation of 20-mer fragments in structurally aligned NPS sequences. b, Consensus motif for the miRNA hybridization region (in RNA world) is chimeric with TCF3/4 cis-motifs (black and grey arrows) in miR HR and TFAP2A/B/C binding motifs (turquoise arrows) upstream to it. c, Mutational revision of tandem TCF3/4 cis -motifs ([N] n : gap between tandem repeats) can generate TFAP2A/B/C recognition motif. d, Tandem repeats of palindromic TFAP2A/B/C cis -motifs (grey lines) coerce a supersymmetry in the underlying DNA (turquoise lines). e, SymCurv analysis of targets with peak TFAP2A/B/C values in the miR HR region (n=46 genes) localized the signature to the superhelical locations (SHL) +2.5 and +3 analogous to the miRNA in Figure 1e (left). The hairpin size that is formed by miR-4673 target regions in the interactome genes (right, Supplementary file 9).
    Figure Legend Snippet: Adaptive evolution of miR HR enhancers in target genes. a, Average dinucleotide usage map in target genes after symmetrisation to miR HR (left; arrows indicate AA/TT-rich boundaries). Enrichment of TCF3/4 upstream and TFAP2A/B/C downstream to miR HR in symmetrised sequences (middle, right). Background W/S dinucleotide oscillations (bottom) overlapped the TCF3/4 cis-clusters (left; n=101) or TFAP2A/B/C clusters (right, n=86) (red line: mean, grey margin: bootstrapped confidence interval). Box plots show phase offset between oscillations symmetrised to miR HR (linear heat map; see methods). The linear heat maps demonstrate the average value for pair-wise cross-correlation of 20-mer fragments in structurally aligned NPS sequences. b, Consensus motif for the miRNA hybridization region (in RNA world) is chimeric with TCF3/4 cis-motifs (black and grey arrows) in miR HR and TFAP2A/B/C binding motifs (turquoise arrows) upstream to it. c, Mutational revision of tandem TCF3/4 cis -motifs ([N] n : gap between tandem repeats) can generate TFAP2A/B/C recognition motif. d, Tandem repeats of palindromic TFAP2A/B/C cis -motifs (grey lines) coerce a supersymmetry in the underlying DNA (turquoise lines). e, SymCurv analysis of targets with peak TFAP2A/B/C values in the miR HR region (n=46 genes) localized the signature to the superhelical locations (SHL) +2.5 and +3 analogous to the miRNA in Figure 1e (left). The hairpin size that is formed by miR-4673 target regions in the interactome genes (right, Supplementary file 9).

    Techniques Used: Hybridization, Binding Assay

    32) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    33) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.
    Figure Legend Snippet: Time-lapse microscopy of FR/NIR FUCCI expressed in HEK293A cells. IFP2.0-hGem(1/110) and smURFP-hCdtI(30/120) fluorescence are shown in green and red, respectively. White and yellow arrows label original cells and their descendants. HEK293A cell division occurs with a doubling time of ~34 h. Green is EX / EM = 665(45) / 725(50) nm and red is EX / EX = 628(40) / 680(30) nm. EX is excitation; EM is emission; and scale bar = 50 µm.

    Techniques Used: Time-lapse Microscopy, Fluorescence

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    34) Product Images from "Discovery and characterization of a prevalent human gut bacterial enzyme sufficient for the inactivation of a family of plant toxins"

    Article Title: Discovery and characterization of a prevalent human gut bacterial enzyme sufficient for the inactivation of a family of plant toxins

    Journal: eLife

    doi: 10.7554/eLife.33953

    Cgr2 is sufficient for digoxin reduction and requires FAD and [4Fe-4S] cluster(s) for activity. ( A ) Whole cell assays using R. erythropoli ). ( B ) Annotation and amino acid numbering of Cgr2, including the predicted Tat secretion signal and three conserved flavin-binding motifs from the glutathione reductase family (X = any amino acid; h = hydrophobic residue). ( C ). FAD = flavin adenine dinucleotide; FMN = flavin mononucleotide. ( D ) Ultraviolet-visible (UV-Vis) absorption spectra of Cgr2 revealed an oxygen-sensitive peak centered around 400 nm that increased upon [Fe-S] cluster reconstitution, supporting the presence of [4Fe-4S] clusters in Cgr2. ( E ) Electron paramagnetic resonance (EPR) spectra of sodium dithionite-reduced Cgr2 reconstituted with iron ammonium sulfate hexahydrate ((NH 4 ) 2 Fe(SO 4 ) 2 ·6H 2 0) and sodium sulfide (Na 2 S·9H 2 0). G-values and decreased EPR signal intensity at higher temperatures (10 – 40 K) indicated the presence of low potential [4Fe-4S] 1+ clusters. Experimental conditions were microwave frequency 9.38 GHz, microwave power 0.2 mW, modulation amplitude 0.6 mT, and receiver gain 40 dB.
    Figure Legend Snippet: Cgr2 is sufficient for digoxin reduction and requires FAD and [4Fe-4S] cluster(s) for activity. ( A ) Whole cell assays using R. erythropoli ). ( B ) Annotation and amino acid numbering of Cgr2, including the predicted Tat secretion signal and three conserved flavin-binding motifs from the glutathione reductase family (X = any amino acid; h = hydrophobic residue). ( C ). FAD = flavin adenine dinucleotide; FMN = flavin mononucleotide. ( D ) Ultraviolet-visible (UV-Vis) absorption spectra of Cgr2 revealed an oxygen-sensitive peak centered around 400 nm that increased upon [Fe-S] cluster reconstitution, supporting the presence of [4Fe-4S] clusters in Cgr2. ( E ) Electron paramagnetic resonance (EPR) spectra of sodium dithionite-reduced Cgr2 reconstituted with iron ammonium sulfate hexahydrate ((NH 4 ) 2 Fe(SO 4 ) 2 ·6H 2 0) and sodium sulfide (Na 2 S·9H 2 0). G-values and decreased EPR signal intensity at higher temperatures (10 – 40 K) indicated the presence of low potential [4Fe-4S] 1+ clusters. Experimental conditions were microwave frequency 9.38 GHz, microwave power 0.2 mW, modulation amplitude 0.6 mT, and receiver gain 40 dB.

    Techniques Used: Activity Assay, Binding Assay, Electron Paramagnetic Resonance

    Clustal Omega alignment of Sanger-sequenced cgr2 confirms high degree of conservation.
    Figure Legend Snippet: Clustal Omega alignment of Sanger-sequenced cgr2 confirms high degree of conservation.

    Techniques Used:

    The substrate scope of Cgr2 is restricted to cardenolides. Rate of methyl viologen oxidation coupled to substrate reduction by Cgr2. Colors denote different substrate classes. With the exception of the cardenolides, a representative substrate structure is shown. Values represent mean ± SEM (n = 3 independent experiments). **p
    Figure Legend Snippet: The substrate scope of Cgr2 is restricted to cardenolides. Rate of methyl viologen oxidation coupled to substrate reduction by Cgr2. Colors denote different substrate classes. With the exception of the cardenolides, a representative substrate structure is shown. Values represent mean ± SEM (n = 3 independent experiments). **p

    Techniques Used:

    Cgr2 is widespread in the human gut microbiome. ( A ) Analysis of the cgr -associated gene cluster and E. lenta (via elenmrk1 ) prevalence in the gut metagenomes of 1872 individuals ( see Materials and methods) revealed that both E. lenta and cgr2 are highly prevalent (41.5% and 27.7% respectively) but frequently low in abundance. ( B ) Quantification of E. lenta and cgr2 abundances in individual gut metagenomes revealed a tight correlation between the two, providing evidence that cgr2 is restricted to E. lenta and that individuals may harbor sub-populations of both cgr2+ and cgr2 - strains. Red line denotes the expected linear relationship and dashed lines represent a ± half log deviation. (Inset) Histogram of cgr- ratio ( cgr/elnmrk1 ) demonstrates a significant skew away from communities that would have more cgr2 than expected by E. lenta abundance (p
    Figure Legend Snippet: Cgr2 is widespread in the human gut microbiome. ( A ) Analysis of the cgr -associated gene cluster and E. lenta (via elenmrk1 ) prevalence in the gut metagenomes of 1872 individuals ( see Materials and methods) revealed that both E. lenta and cgr2 are highly prevalent (41.5% and 27.7% respectively) but frequently low in abundance. ( B ) Quantification of E. lenta and cgr2 abundances in individual gut metagenomes revealed a tight correlation between the two, providing evidence that cgr2 is restricted to E. lenta and that individuals may harbor sub-populations of both cgr2+ and cgr2 - strains. Red line denotes the expected linear relationship and dashed lines represent a ± half log deviation. (Inset) Histogram of cgr- ratio ( cgr/elnmrk1 ) demonstrates a significant skew away from communities that would have more cgr2 than expected by E. lenta abundance (p

    Techniques Used:

    35) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    36) Product Images from "Evolution of kdr haplotypes in worldwide populations of Aedes aegypti: Independent origins of the F1534C kdr mutation"

    Article Title: Evolution of kdr haplotypes in worldwide populations of Aedes aegypti: Independent origins of the F1534C kdr mutation

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0008219

    Haplotype Network of the IIIS6 segment of the voltage gated sodium channel gene of Aedes aegypti populations from diverse continents. The network is the genealogy calculated by the TCS method [ 21 ]. Each dot represents a haplotype, connected by lines in which each slash indicates a mutational step between connected haplotypes. Red and blue dots indicate synonymous and non-synonymous substitutions, respectively. The most common haplotype 3s6_00 is in dark blue. A schematic representation with haplotypes containing non-synonymous SNPs is in the box, with SNPs in red.
    Figure Legend Snippet: Haplotype Network of the IIIS6 segment of the voltage gated sodium channel gene of Aedes aegypti populations from diverse continents. The network is the genealogy calculated by the TCS method [ 21 ]. Each dot represents a haplotype, connected by lines in which each slash indicates a mutational step between connected haplotypes. Red and blue dots indicate synonymous and non-synonymous substitutions, respectively. The most common haplotype 3s6_00 is in dark blue. A schematic representation with haplotypes containing non-synonymous SNPs is in the box, with SNPs in red.

    Techniques Used:

    Scheme of the voltage gated sodium channel. The IIS6 and IIIS6 segments are highlighted, indicating the primers (arrows showing orientation) used to amplify their corresponding DNA regions in this study. The kdr mutation sites previously found in Aedes aegypti in these segments (989, 1011, 1016, 1532 and 1534) are also indicated.
    Figure Legend Snippet: Scheme of the voltage gated sodium channel. The IIS6 and IIIS6 segments are highlighted, indicating the primers (arrows showing orientation) used to amplify their corresponding DNA regions in this study. The kdr mutation sites previously found in Aedes aegypti in these segments (989, 1011, 1016, 1532 and 1534) are also indicated.

    Techniques Used: Mutagenesis

    Frequencies of haplotypes with or without non-synonymous substitutions in IIS6 and IIIS6 Na V segments of Aedes aegypti worldwide populations. The populations contain one bar for each of the two Na V segments. In each bar it is presented the frequency of the haplotypes with non-synonymous SNPs and the sum of the remaining haplotypes (wild-type). Populations are grouped according to their continent.
    Figure Legend Snippet: Frequencies of haplotypes with or without non-synonymous substitutions in IIS6 and IIIS6 Na V segments of Aedes aegypti worldwide populations. The populations contain one bar for each of the two Na V segments. In each bar it is presented the frequency of the haplotypes with non-synonymous SNPs and the sum of the remaining haplotypes (wild-type). Populations are grouped according to their continent.

    Techniques Used:

    Evidence for at least two independent origins for the 1534C kdr mutation in Aedes aegypti . Bars show the haplotype frequencies of IIS6 and IIIS6 Na V segments found in five localities that are fixed for 3s6-01 haplotype ( A ). The IIS6 haplotypes from Clades A or B (see Fig 2 ) are represented as purple and green lines, respectively. Two different origins are proposed for the 1534C kdr mutation in B and C panels. The single origin for the other kdr mutations is also suggested in panel C . Phased haplotypes are followed by the name of the populations where they were found. Kdr SNPs are shown in red.
    Figure Legend Snippet: Evidence for at least two independent origins for the 1534C kdr mutation in Aedes aegypti . Bars show the haplotype frequencies of IIS6 and IIIS6 Na V segments found in five localities that are fixed for 3s6-01 haplotype ( A ). The IIS6 haplotypes from Clades A or B (see Fig 2 ) are represented as purple and green lines, respectively. Two different origins are proposed for the 1534C kdr mutation in B and C panels. The single origin for the other kdr mutations is also suggested in panel C . Phased haplotypes are followed by the name of the populations where they were found. Kdr SNPs are shown in red.

    Techniques Used: Mutagenesis

    37) Product Images from "AmgRS-mediated envelope stress-inducible expression of the mexXY multidrug efflux operon of Pseudomonas aeruginosa"

    Article Title: AmgRS-mediated envelope stress-inducible expression of the mexXY multidrug efflux operon of Pseudomonas aeruginosa

    Journal: MicrobiologyOpen

    doi: 10.1002/mbo3.226

    Schematic representation of ArmZ and AmgRS regulation of mexXY in Pseudomonas aeruginosa . In the absence of ribosome-perturbing agents, protein synthesis occurs normally and native, functional proteins are synthesized. In the presence of ribosome-targeting antimicrobials including aminoglycosides (AG), which promote mistranslation and aberrant polypeptide synthesis, and nonaminoglycosides (non-AG), which halt protein synthesis, expression of the amrZ gene is induced. ArmZ, an anti-repressor, modulates the activity of the mexXY repressor, MexZ, leading to expression of mexXY and, ultimately, production and assembly of the MexXY-OprM multidrug efflux system. Additionally, AG-generated aberrant polypeptides disrupt the inner membrane (IM) activating AmgS, the sensor component of the AmgRS two-component system, which in turn activates AmgR to drive expression of the htpX and PA5528 genes. The activities of the htpX and PA5528 gene products in some, as yet unknown way promote expression of the mexXY operon, dependent on ArmZ-mediated loss of MexZ repression of mexXY . Nonaminoglycoside ribosome inhibitors may also promote mexXY expression via additional, as yet unknown regulatory pathway(s), also dependent on ArmZ-mediated loss of MexZ repression. OM, outer membrane.
    Figure Legend Snippet: Schematic representation of ArmZ and AmgRS regulation of mexXY in Pseudomonas aeruginosa . In the absence of ribosome-perturbing agents, protein synthesis occurs normally and native, functional proteins are synthesized. In the presence of ribosome-targeting antimicrobials including aminoglycosides (AG), which promote mistranslation and aberrant polypeptide synthesis, and nonaminoglycosides (non-AG), which halt protein synthesis, expression of the amrZ gene is induced. ArmZ, an anti-repressor, modulates the activity of the mexXY repressor, MexZ, leading to expression of mexXY and, ultimately, production and assembly of the MexXY-OprM multidrug efflux system. Additionally, AG-generated aberrant polypeptides disrupt the inner membrane (IM) activating AmgS, the sensor component of the AmgRS two-component system, which in turn activates AmgR to drive expression of the htpX and PA5528 genes. The activities of the htpX and PA5528 gene products in some, as yet unknown way promote expression of the mexXY operon, dependent on ArmZ-mediated loss of MexZ repression of mexXY . Nonaminoglycoside ribosome inhibitors may also promote mexXY expression via additional, as yet unknown regulatory pathway(s), also dependent on ArmZ-mediated loss of MexZ repression. OM, outer membrane.

    Techniques Used: Functional Assay, Synthesized, Expressing, Activity Assay, Generated

    Contribution of AmgRS target genes to aminoglycoside-inducible mexXY expression. Expression of mexXY (A and B) and armZ (C and D) was assessed in late-log phase cultures of the indicated strains without (open bars) and with (filled bars) exposure to paromomycin using real-time quantitative PCR. The status of the htpX , PA5528 and yccA genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.
    Figure Legend Snippet: Contribution of AmgRS target genes to aminoglycoside-inducible mexXY expression. Expression of mexXY (A and B) and armZ (C and D) was assessed in late-log phase cultures of the indicated strains without (open bars) and with (filled bars) exposure to paromomycin using real-time quantitative PCR. The status of the htpX , PA5528 and yccA genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Impact of gentamicin on expression of AmgRS target genes. Expression of mexXY , htpX, and PA5528 was assessed in late-log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to gentamicin. The status of the amgR gene (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.
    Figure Legend Snippet: Impact of gentamicin on expression of AmgRS target genes. Expression of mexXY , htpX, and PA5528 was assessed in late-log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to gentamicin. The status of the amgR gene (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

    Techniques Used: Expressing

    38) Product Images from "Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides"

    Article Title: Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp687

    Assembly of 38 overlapping 60-mer oligonucleotides in yeast. ( a ) The 38 oligonucleotides, named 1–38 u, have 30 bp overlaps and produce a 1170 bp synthetic DNA fragment following assembly. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Ten nucleotide gaps (green) are repaired inside the yeast cell. ( b ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector depicted in (a). The primers used for this PCR analysis and for DNA sequencing are M13F and M13R and are shown in (a). The predicted amplicon size for a complete assembly is 1393 bp and is indicated by an asterisk. The presence (+) or absence (−) of the expected product is noted for each clone screened. L indicates the 1 kb DNA ladder (NEB).
    Figure Legend Snippet: Assembly of 38 overlapping 60-mer oligonucleotides in yeast. ( a ) The 38 oligonucleotides, named 1–38 u, have 30 bp overlaps and produce a 1170 bp synthetic DNA fragment following assembly. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Ten nucleotide gaps (green) are repaired inside the yeast cell. ( b ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector depicted in (a). The primers used for this PCR analysis and for DNA sequencing are M13F and M13R and are shown in (a). The predicted amplicon size for a complete assembly is 1393 bp and is indicated by an asterisk. The presence (+) or absence (−) of the expected product is noted for each clone screened. L indicates the 1 kb DNA ladder (NEB).

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Transformation Assay, DNA Sequencing, Amplification

    Twenty base-pair overlaps are sufficient for oligonucleotide assembly in yeast. ( a and b ) Schematic demonstrating the assembly of eight 60-mers, named A–H, or their reverse complements, named Arc–Hrc. The oligonucleotides each contain 20 bp overlaps and were assembled into a vector to produce a 340 bp synthetic DNA fragment. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Twenty nucleotide gaps (green) were repaired inside the yeast cell. ( c and d ) PCR analysis of four randomly selected yeast clones following transformation and assembly of oligonucleotides A–H (c) as depicted in (a) or oligonucleotides A–rc–H–rc (d) as depicted in (b). The predicted amplicon size for a complete assembly is 563 bp and is indicated by an asterisk. M indicates the 100 bp DNA ladder (NEB). ( e ) Assembly of 28 60-mers, named 1–28 g, containing 20 bp overlaps, to produce a 1140 bp synthetic DNA fragment. ( f ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector shown in (e). The predicted amplicon size for a complete assembly is 1363 bp and is indicated by an asterisk.
    Figure Legend Snippet: Twenty base-pair overlaps are sufficient for oligonucleotide assembly in yeast. ( a and b ) Schematic demonstrating the assembly of eight 60-mers, named A–H, or their reverse complements, named Arc–Hrc. The oligonucleotides each contain 20 bp overlaps and were assembled into a vector to produce a 340 bp synthetic DNA fragment. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Twenty nucleotide gaps (green) were repaired inside the yeast cell. ( c and d ) PCR analysis of four randomly selected yeast clones following transformation and assembly of oligonucleotides A–H (c) as depicted in (a) or oligonucleotides A–rc–H–rc (d) as depicted in (b). The predicted amplicon size for a complete assembly is 563 bp and is indicated by an asterisk. M indicates the 100 bp DNA ladder (NEB). ( e ) Assembly of 28 60-mers, named 1–28 g, containing 20 bp overlaps, to produce a 1140 bp synthetic DNA fragment. ( f ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector shown in (e). The predicted amplicon size for a complete assembly is 1363 bp and is indicated by an asterisk.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Transformation Assay, Amplification

    39) Product Images from "Knocking out Ornithine Decarboxylase Antizyme 1 (OAZ1) Improves Recombinant Protein Expression in the HEK293 Cell Line"

    Article Title: Knocking out Ornithine Decarboxylase Antizyme 1 (OAZ1) Improves Recombinant Protein Expression in the HEK293 Cell Line

    Journal: Medical Sciences

    doi: 10.3390/medsci6020048

    Clustered regularly interspaced short palindromic repeats (CRISPR)-mediated disruption of the ornithine decarboxylase antizyme ( OAZ1 ) gene in human embryonic kidney 293 (HEK293)-luc cells and the generation of OAZ1 knockout cell lines. ( a ) Clustal Omega DNA sequence alignment of the CRISPR OAZ1 guide RNA (gRNA) target and surrounding regions, showing mutations in the OAZ1 gene in the CRISPR-treated cell lines, 775–1 and 775–3. Highlighted region is the gRNA target sequence; ( b ) Real time quantitative polymerase chain reaction (RT-qPCR) of reverse-transcribed total cellular mRNA, using primers targeting OAZ1 cDNA, confirms lower transcriptional levels of OAZ1 mRNA in the CRISPR-treated cell lines, 775–1 and 775–3, of 0.7-fold (****, p -value
    Figure Legend Snippet: Clustered regularly interspaced short palindromic repeats (CRISPR)-mediated disruption of the ornithine decarboxylase antizyme ( OAZ1 ) gene in human embryonic kidney 293 (HEK293)-luc cells and the generation of OAZ1 knockout cell lines. ( a ) Clustal Omega DNA sequence alignment of the CRISPR OAZ1 guide RNA (gRNA) target and surrounding regions, showing mutations in the OAZ1 gene in the CRISPR-treated cell lines, 775–1 and 775–3. Highlighted region is the gRNA target sequence; ( b ) Real time quantitative polymerase chain reaction (RT-qPCR) of reverse-transcribed total cellular mRNA, using primers targeting OAZ1 cDNA, confirms lower transcriptional levels of OAZ1 mRNA in the CRISPR-treated cell lines, 775–1 and 775–3, of 0.7-fold (****, p -value

    Techniques Used: CRISPR, Knock-Out, Sequencing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    40) Product Images from "A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein"

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein

    Journal: Nature methods

    doi: 10.1038/nmeth.3935

    Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P
    Figure Legend Snippet: Increasing chromophore concentration within cells increases fluorescence. HO-1 expression produces BV in situ and increases fluorescence of FPs. ( a,b ) Quantitation of images in Supplementary Fig. 8 . Fluorescence was normalized to FP IRES eGFP without exogenous BV. Expression of HO-1 + 5-ALA + FeSO 4 significantly increases fluorescence of all FPs. BV was added for 3 h and 5-ALA + FeSO 4 for 18 h. Error bars were calculated using error propagation. P -values were determined by a one-way ANOVA using the mean fluorescence intensity. ( c ) Crystal structure of D. radiodurans BPH+BV (parent protein of IFP1.4 and IFP2.0). All amino acids ≤3 Å of BV carboxylic acids are shown in yellow. Carboxylic acid recognition explains why BVMe 2 does not bind the BPH FPs. C24 covalent attachment (cyan) and pyrrole rings are designated by letter. Created from 1ZTU.pdb. ( d ) Homology model of smURFP+BV showing lack of BV carboxylic acid recognition. No amino acid is ≤4 Å from the carboxylic acids. C52 covalent attachment (cyan) and pyrrole rings are designated by letter. BVMe 2 increases membrane permeability and smURFP/TDsmURFP fluorescence. ( e ) Quantitation of images in Supplementary Fig. 9 . All FPs show significant increased fluorescence with BV. SmURFP+BVMe 2 fluorescence is > 32-fold increased relative to smURFP and brighter than the BPH FPs even when excited off peak (right). Chromophore incubation time is 3 h. ( a,b,e ) Only selected significant differences are shown. EX is excitation maximum; EM is emission maximum; error bars are s.e.m.; n = 30; and * is P

    Techniques Used: Concentration Assay, Fluorescence, Expressing, In Situ, Quantitation Assay, Permeability, Incubation

    Related Articles

    Amplification:

    Article Title: Genome-scale reconstruction of the sigma factor network in Escherichia coli: topology and functional states
    Article Snippet: .. The cDNA samples were amplified using a mixture of 1 μl cDNA, 10 μl Phusion HF buffer (NEB), 1 μl dNTPs (10 mM), 1 μl SYBR Green (Qiagen), 0.5 μl HotStart Phusion (NEB), and 5 pM small RNA PCR primer mix. .. The amplification primers used are shown in Table .

    Purification:

    Article Title: Restriction Enzyme Based Enriched L1Hs Sequencing (REBELseq): A Scalable Technique for Detection of Ta Subfamily L1Hs in the Human Genome
    Article Snippet: .. The purified secondary PCR library was then used as a template for the addition of one of six single indexed Illumina flow cell adapters in a 50 µL reaction (Tertiary PCR, ), containing 11 µL purified secondary PCR library, 1X Phusion HF Polymerase Buffer (New England Biolabs #B0518S), 2.5 U Phusion Hot Start HF polymerase (New England Biolabs #M0535L), 0.2 mM dNTPs (Thermo #R0191), 0.5 pmol/µL Adapt2-Seq1 primer and 0.5 pmol/µL Adapt1-Barcode-Seq2 primer (See Supplemental Oligomers). .. Tertiary PCR was thermally cycled as 98° for 0:30 min, then 15 cycles of 98° for 0:05 min, 72° for 0:15 min, then 72° for 1:00 min, and finally a 4° hold.

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Article Title: Single-stranded DNA and RNA origami
    Article Snippet: .. Phusion High-Fidelity PCR Master Mix with HF Buffer(100 reactions/50-liter volume) and Lambda Exonuclease (1000 units) was purchased from New England Biolabs, Inc. MinElute PCR Purification Kit was purchased from QIAGEN. .. Nicking endonuclease Nb.BbvCI (1000 units), restriction endonucleases Eco RI (5000 units), Xho I (5000 units) and Hind III (5000 units), T7 and T3 RNA polymerases (5000 units), PCR Cloning Kit (20 reactions), NEB 10-beta and NEB stable competent E. coli were purchased from New England Biolabs, Inc. pGEM-7zf (−) vector, Pure-yield plasmid miniprep system, and the Wizard SV Gel and PCR Clean-UP System were purchased from Promega.

    SYBR Green Assay:

    Article Title: Genome-scale reconstruction of the sigma factor network in Escherichia coli: topology and functional states
    Article Snippet: .. The cDNA samples were amplified using a mixture of 1 μl cDNA, 10 μl Phusion HF buffer (NEB), 1 μl dNTPs (10 mM), 1 μl SYBR Green (Qiagen), 0.5 μl HotStart Phusion (NEB), and 5 pM small RNA PCR primer mix. .. The amplification primers used are shown in Table .

    Polyacrylamide Gel Electrophoresis:

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Polymerase Chain Reaction:

    Article Title: Structural toggle in the RNaseH domain of Prp8 helps balance splicing fidelity and catalytic efficiency
    Article Snippet: .. Reactions were performed in 20 μL volume, with 10 μL DNA sample precipitated from gel, 1× Phusion HF buffer (NEB), dNTPs (0.25 mM each), 0.25 μM Illumina P5 PCR primer, 0.25 μM Illumina P7 PCR primer, and Phusion polymerase. .. The PCR protocol was an initial denaturation step of 98 °C for 30 s, followed by 8–10 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s. Final extension was at 72 °C for 5 min.

    Article Title: Genome-scale reconstruction of the sigma factor network in Escherichia coli: topology and functional states
    Article Snippet: .. The cDNA samples were amplified using a mixture of 1 μl cDNA, 10 μl Phusion HF buffer (NEB), 1 μl dNTPs (10 mM), 1 μl SYBR Green (Qiagen), 0.5 μl HotStart Phusion (NEB), and 5 pM small RNA PCR primer mix. .. The amplification primers used are shown in Table .

    Article Title: Restriction Enzyme Based Enriched L1Hs Sequencing (REBELseq): A Scalable Technique for Detection of Ta Subfamily L1Hs in the Human Genome
    Article Snippet: .. The purified secondary PCR library was then used as a template for the addition of one of six single indexed Illumina flow cell adapters in a 50 µL reaction (Tertiary PCR, ), containing 11 µL purified secondary PCR library, 1X Phusion HF Polymerase Buffer (New England Biolabs #B0518S), 2.5 U Phusion Hot Start HF polymerase (New England Biolabs #M0535L), 0.2 mM dNTPs (Thermo #R0191), 0.5 pmol/µL Adapt2-Seq1 primer and 0.5 pmol/µL Adapt1-Barcode-Seq2 primer (See Supplemental Oligomers). .. Tertiary PCR was thermally cycled as 98° for 0:30 min, then 15 cycles of 98° for 0:05 min, 72° for 0:15 min, then 72° for 1:00 min, and finally a 4° hold.

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Article Title: Single-stranded DNA and RNA origami
    Article Snippet: .. Phusion High-Fidelity PCR Master Mix with HF Buffer(100 reactions/50-liter volume) and Lambda Exonuclease (1000 units) was purchased from New England Biolabs, Inc. MinElute PCR Purification Kit was purchased from QIAGEN. .. Nicking endonuclease Nb.BbvCI (1000 units), restriction endonucleases Eco RI (5000 units), Xho I (5000 units) and Hind III (5000 units), T7 and T3 RNA polymerases (5000 units), PCR Cloning Kit (20 reactions), NEB 10-beta and NEB stable competent E. coli were purchased from New England Biolabs, Inc. pGEM-7zf (−) vector, Pure-yield plasmid miniprep system, and the Wizard SV Gel and PCR Clean-UP System were purchased from Promega.

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach
    Article Snippet: .. For truncations of the AtETR1 and LeETR1 plasmids by the two-fragment approach, a slightly different PCR protocol was used: 20 μL PCR mixture prepared with nuclease-free water (Cell Signaling Technology) contained 1 ng DNA template, 500 nM each primer, 200 μM each dNTP (deoxynucleoside triphosphate; NEB), 0.4 U μL−1 Phusion High-Fidelity DNA Polymerase (NEB), and either 1× Phusion buffer HF (NEB) or 3% (v/v) DMSO (NEB) with 1× Phusion buffer GC (NEB). .. Also, PCR thermocycling described above was modified in case of the ETR1 plasmids to have: (1) 11 step-down cycles with annealing starting from 65 °C down to 60 °C (i.e. decreasing by 0.5 °C in each subsequent cycle); (2) elongation time of at least 30 s per kbp of the target product (up to 200 s for the longest PCR products); and (3) final elongation time of 5 min.

    Chromatin Immunoprecipitation:

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. DNase-free water 5× Phusion Buffer HF (NEB) 10 mM dNTP 25 µM primer Solexa PE.1 (5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT) 25 µM primer Solexa PE.2 (5'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTT CCGATCT) Phusion Polymerase (NEB) AMPure-XP (SPRI) Beads (Agencourt) EB buffer; 10 mM Tris-Cl, pH 8.5 70% ethanol Qubit Fluorometer and dsDNA HS Assay Kit (Invitrogen) Bioanalyzer 2100 HS DNA chip (Agilent) Bioanalyzer 2100 (Agilent) .. Set up PCR reactions in duplicate for each library.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs yes pcr polymerase kit phusion high fidelity dna polymerase
    Screening sgRNAs for cleavage activity in vivo. ( A ) Schematic of the screening assay. Individual embryos are injected with RNPs composed of a particular sgRNA. Genomic <t>DNA</t> from each embryo is <t>PCR-amplified,</t> and amplicons are denatured and re-annealed. Heteroduplexes with mismatches due to indels in embryonic DNA are cleaved by T7E1 enzyme. Gel electrophoresis identifies embryos with detectable cleavage events. ( B ) PCR products of a target site in the forked gene 892 bp in length were digested by T7E1 as indicated. Shown are two representative embryos out of the nine assayed that were injected with forked RNPs. Also shown are two out of the six embryos that were uninjected. The predicted T7E1 digest products are 393 and 436 bp. Although a minority of heteroduplexes derived from an embryo are T7E1-sensitive, they can be detected by this assay. ( C ) A T7E1 assay performed on a sgRNA that was inactive in vivo. The target region is located in non-coding DNA. Three of the 12 RNP-injected embryo samples are shown, and three of the six uninjected embryo samples are shown. Heteroduplexes from the uninjected samples show T7E1 sensitivity that is likely due to sequence polymorphisms or non-B form DNA structures. The predicted T7E1 digest products from NHEJ induced mismatches are 295 and 502 bp. Note that samples from RNP-injected embryos do not exhibit T7E1 products of those sizes.
    Yes Pcr Polymerase Kit Phusion High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yes pcr polymerase kit phusion high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    yes pcr polymerase kit phusion high fidelity dna polymerase - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Screening sgRNAs for cleavage activity in vivo. ( A ) Schematic of the screening assay. Individual embryos are injected with RNPs composed of a particular sgRNA. Genomic DNA from each embryo is PCR-amplified, and amplicons are denatured and re-annealed. Heteroduplexes with mismatches due to indels in embryonic DNA are cleaved by T7E1 enzyme. Gel electrophoresis identifies embryos with detectable cleavage events. ( B ) PCR products of a target site in the forked gene 892 bp in length were digested by T7E1 as indicated. Shown are two representative embryos out of the nine assayed that were injected with forked RNPs. Also shown are two out of the six embryos that were uninjected. The predicted T7E1 digest products are 393 and 436 bp. Although a minority of heteroduplexes derived from an embryo are T7E1-sensitive, they can be detected by this assay. ( C ) A T7E1 assay performed on a sgRNA that was inactive in vivo. The target region is located in non-coding DNA. Three of the 12 RNP-injected embryo samples are shown, and three of the six uninjected embryo samples are shown. Heteroduplexes from the uninjected samples show T7E1 sensitivity that is likely due to sequence polymorphisms or non-B form DNA structures. The predicted T7E1 digest products from NHEJ induced mismatches are 295 and 502 bp. Note that samples from RNP-injected embryos do not exhibit T7E1 products of those sizes.

    Journal: bioRxiv

    Article Title: Adaptable and Efficient Genome Editing by sgRNA-Cas9 Protein Co-injection into Drosophila

    doi: 10.1101/2020.05.07.080762

    Figure Lengend Snippet: Screening sgRNAs for cleavage activity in vivo. ( A ) Schematic of the screening assay. Individual embryos are injected with RNPs composed of a particular sgRNA. Genomic DNA from each embryo is PCR-amplified, and amplicons are denatured and re-annealed. Heteroduplexes with mismatches due to indels in embryonic DNA are cleaved by T7E1 enzyme. Gel electrophoresis identifies embryos with detectable cleavage events. ( B ) PCR products of a target site in the forked gene 892 bp in length were digested by T7E1 as indicated. Shown are two representative embryos out of the nine assayed that were injected with forked RNPs. Also shown are two out of the six embryos that were uninjected. The predicted T7E1 digest products are 393 and 436 bp. Although a minority of heteroduplexes derived from an embryo are T7E1-sensitive, they can be detected by this assay. ( C ) A T7E1 assay performed on a sgRNA that was inactive in vivo. The target region is located in non-coding DNA. Three of the 12 RNP-injected embryo samples are shown, and three of the six uninjected embryo samples are shown. Heteroduplexes from the uninjected samples show T7E1 sensitivity that is likely due to sequence polymorphisms or non-B form DNA structures. The predicted T7E1 digest products from NHEJ induced mismatches are 295 and 502 bp. Note that samples from RNP-injected embryos do not exhibit T7E1 products of those sizes.

    Article Snippet: To design ideal primers to generate DNA fragments for Gibson assembly, use the NEBuilder tool with the following build settings: http://nebuilder.neb.com/#!/ Product Kit: NEBuilder HiFi DNA Assembly Master Mix Minimum Overlap: 30 nt Circularize: Yes PCR Polymerase/Kit: Phusion High-Fidelity DNA Polymerase (HF Buffer) PCR Primer Conc.

    Techniques: Activity Assay, In Vivo, Screening Assay, Injection, Polymerase Chain Reaction, Amplification, Nucleic Acid Electrophoresis, Derivative Assay, Sequencing, Non-Homologous End Joining