phusion high fidelity dna polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher phusion high fidelity dna polymerase
    Phusion High Fidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1872 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 1872 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: The Cys3254Ser substitution in giantin protein was performed using the standard cloning and PCR-mediated site-directed mutagenesis (SDM) procedures. .. For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Amplification:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: .. To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. PCR 1: (barcode: CTCTTTCCCTACACGACGCTCTTCCGATCT) > forward (seg1): < barcode > AGGGTCGGCTAGCCATATG > forward (seg2): < barcode > GCCGGGTCAGAAAACCGAA > forward (seg3): < barcode > ATCCAACTGCACGGTCCG > forward (seg4): < barcode > GGTTCCGAATCTCGTTTCTTTG > reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCTACACTGTTGTTATCAGATCT The PCR product for each population (expressed and top 15% of binders for each of the four libraries) was cleaned using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England): > forward: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC > reverse: CAAGCAGAAGACGGCATACGAGAT < index > GTGACTGGAGTTCAGACGTGTGC Top 15% - index: CAATAGTC Expressed - index: TTGAGCCT All the primers were ordered as PAGE-purified oligos.

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: .. Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa). .. Restriction enzymes and T4 DNA ligase were purchased from TaKaRa Ltd. Plasmid extraction was achieved by using a plasmid minikit (Omega).

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: .. Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG. .. The thermal cycling conditions were established as follows: an initial denaturation at 98°C for 1 min, 35 cycles of 98°C for 10 s, 20 s at 56°C for amplicon 1 and 58°C for amplicons 2 and 3, and 72°C for 2 min, followed by 5 min for final extension at 72°C.

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific). .. The thermocycling conditions consisted of 30 s at 98 C for initial denaturation, followed by 35 cycles of 10 s at 98 C, 30 s at 60e65 C (CP) or 55 C (RdRp), and 30 s at 72 C, with a final extension for 10 min at 72 C. The amplified regions were 559 bp (CP) and 536 bp (RdRp) (Fig 1) .

    Article Title: Himalayan Saccharomyces eubayanus Genome Sequences Reveal Genetic Markers Explaining Heterotic Maltotriose Consumption by Saccharomyces pastorianus Hybrids
    Article Snippet: .. The coding sequence of ScMAL31 was amplified from CEN.PK113-7D genomic DNA with Phusion High-Fidelity DNA polymerase (Thermo Scientific), according to the supplier’s instructions, with the primer pair 9942/9943. .. Each primer carried a 40-bp extension complementary to the plasmid backbone of p426-TEF-amdS , which was PCR amplified using Phusion High-Fidelity DNA polymerase (Thermo Scientific) and the primer pair 7812/5921.

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. PCR products were amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific). .. Oligonucleotides were obtained from Stab Vida Corporation.

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: .. The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage. .. PCR conditions: 98 °C – 1 min; 18 cycles each for 98 °C – 5 s, 55 °C – 30 s and 72 °C – 30 s; finally 72 °C – 5 min. PCR products (expected size of 600 bp) were checked on 1.2% agarose gels and without purification used for third-stage PCR with primers MIDh-454-F and MIDh-454-R, containing barcodes (MIDx) and adapter sequences for sequencing on the 454 platform (GS Junior Systems, Roche, Switzerland).

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: Then resulting plasmid pET28b-GOLGB1-C-terminus was amplified with mutagenic overlapping primers: Ser3254F (5′-GCTCATTCTGTCTTTTACGGGCCATCTAACGCGTACGCGG) and Ser3254R (5′-CCGTAAAAGACAGAATGAGCAGGACATGAATCATTAGAAAGTAGATGGCTGC). .. For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Synthesized:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting .. Bioruptor (Diagenode, cat. no. B01010002), including 1.5-ml tube holder Vortex-Genie 2 (VWR Scientific) Precision barrier tips (Denville Scientific, cat. no. P1126, P1122, P1096-FR) 1.5-ml TPX microtubes (Diagenode, cat. no. C30010010) 1.5-ml microtubes (Sarstedt, cat. no. 72.690) 0.2-ml PCR tubes (Thermo Scientific, cat. no. AB-045) Gel image acquisition system (Alpha Innotech, FluorChem SP) Magnet stand (Life Technologies, cat. no. 12321D) PCR machine (MJ Research, cat. no. PTC-200) Rotary mixer (Labindustries, cat. no. 400-110) Water Bath (Fisher Scientific, cat. no. 15-462-15Q) Miseq sequencer (Illumina) Centrifuge (Eppendorf, cat. no. 5415D) NanoDrop 2000 spectrophotometer (Thermo Scientific) Electrophoresis system (Fisher Scientific, cat. no. FB-SBR-2025) 0.22 μm Syringe filter (Fisher Scientific, cat. no. SLGP033RB)

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: First strand cDNA was synthesized using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H-). .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Construct:

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: Himalayan Saccharomyces eubayanus Genome Sequences Reveal Genetic Markers Explaining Heterotic Maltotriose Consumption by Saccharomyces pastorianus Hybrids
    Article Snippet: Plasmids used and constructed in this study are listed in , and oligonucleotide primers used in this study are listed in . .. The coding sequence of ScMAL31 was amplified from CEN.PK113-7D genomic DNA with Phusion High-Fidelity DNA polymerase (Thermo Scientific), according to the supplier’s instructions, with the primer pair 9942/9943.

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus
    Article Snippet: PCR products were amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific). .. To construct S. aureus strains constitutively expressing icaADBC , the ica promoter from positions +1 to −50 was replaced by the Phyper promoter ( ).

    Electrophoresis:

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific). .. Fungal collection The RT-PCR products were separated via electrophoresis in 1 % agarose gels (SERVA) containing 1 % TBE (1 mM Tris-Boric Table 2 e Specific RT PCR primers designed for the study.

    Random Hexamer Labeling:

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: The concentrations of pD(N)6 Random Hexamer primers, dNTP, and 5Â buffer were as recommended by the manufacturer. .. Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific).

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: First strand cDNA was synthesized using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H-). .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Infection:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting

    Expressing:

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus
    Article Snippet: PCR products were amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific). .. To construct S. aureus strains constitutively expressing icaADBC , the ica promoter from positions +1 to −50 was replaced by the Phyper promoter ( ).

    Modification:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting .. Bioruptor (Diagenode, cat. no. B01010002), including 1.5-ml tube holder Vortex-Genie 2 (VWR Scientific) Precision barrier tips (Denville Scientific, cat. no. P1126, P1122, P1096-FR) 1.5-ml TPX microtubes (Diagenode, cat. no. C30010010) 1.5-ml microtubes (Sarstedt, cat. no. 72.690) 0.2-ml PCR tubes (Thermo Scientific, cat. no. AB-045) Gel image acquisition system (Alpha Innotech, FluorChem SP) Magnet stand (Life Technologies, cat. no. 12321D) PCR machine (MJ Research, cat. no. PTC-200) Rotary mixer (Labindustries, cat. no. 400-110) Water Bath (Fisher Scientific, cat. no. 15-462-15Q) Miseq sequencer (Illumina) Centrifuge (Eppendorf, cat. no. 5415D) NanoDrop 2000 spectrophotometer (Thermo Scientific) Electrophoresis system (Fisher Scientific, cat. no. FB-SBR-2025) 0.22 μm Syringe filter (Fisher Scientific, cat. no. SLGP033RB)

    Hybridization:

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: Next, the 3′ ends of the DNA fragments were adenylated and ligated to the NEBNext adaptors with hairpin loop structures to prepare samples for hybridization, this was to select cDNA fragments that are 150–200 bp in length. .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Transfection:

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: Paragraph title: 2.2. Immunoprecipitation (IP), Plasmid Constructions and Transfection ... For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Concentration Assay:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol.

    Methylation:

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′. .. After PCR completion, the PCR reaction mixture was treated with DpnI restriction enzyme (to digest methylated template) and then used to transform E. coli TOP10 strain.

    Cell Culture:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: We have successfully applied LAM-HTGTS to human 293T (ATCC CRL-3216) and A549 (ATCC CCL-185) cell lines, mouse Abelson virus-transformed pro-B and CH12F3 cell lines, mouse bone marrow and splenic B cells, in vitro differentiated T cell precursors, and cultured primary mouse neural stem and progenitor cells. .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting

    Generated:

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: Given that the original plasmid GOLGB1 (giantin)–pCMV6–AC–GFP is too big for amplification (16 kb), we generated a smaller (8 kb) substrate for SDM as follows: 4 kb C-terminal fragment of the GOLGB1 from the GOLGB1 (giantin)–pCMV6–AC–GFP was subcloned into pET28b vector within EcoRV and NotI restriction sites. .. For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Polymerase Chain Reaction:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: .. To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. PCR 1: (barcode: CTCTTTCCCTACACGACGCTCTTCCGATCT) > forward (seg1): < barcode > AGGGTCGGCTAGCCATATG > forward (seg2): < barcode > GCCGGGTCAGAAAACCGAA > forward (seg3): < barcode > ATCCAACTGCACGGTCCG > forward (seg4): < barcode > GGTTCCGAATCTCGTTTCTTTG > reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCTACACTGTTGTTATCAGATCT The PCR product for each population (expressed and top 15% of binders for each of the four libraries) was cleaned using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England): > forward: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC > reverse: CAAGCAGAAGACGGCATACGAGAT < index > GTGACTGGAGTTCAGACGTGTGC Top 15% - index: CAATAGTC Expressed - index: TTGAGCCT All the primers were ordered as PAGE-purified oligos.

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: Primers used for PCR amplification of the pglX gene-flanking sequences are listed in . .. Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa).

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). .. Primers NRC4_D478V_F ( 5’-Phos/ATGTTGCATCAGTTCTGCAAAAAGGAGGCT ) and NRC4_D478V_R ( 5’-Phos/GACGTGAAGACGACATGTTTTTATTTGACC ) were used for introducing the mutation in the PCR.

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: VSV RNA was reverse transcribed and amplified in three overlapping PCR amplicons of approximately 4 kb each, covering the entire VSV genome except for 5′ and 3′ ends used for primer annealing. .. Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG.

    Article Title: Himalayan Saccharomyces eubayanus Genome Sequences Reveal Genetic Markers Explaining Heterotic Maltotriose Consumption by Saccharomyces pastorianus Hybrids
    Article Snippet: The coding sequence of ScMAL31 was amplified from CEN.PK113-7D genomic DNA with Phusion High-Fidelity DNA polymerase (Thermo Scientific), according to the supplier’s instructions, with the primer pair 9942/9943. .. Each primer carried a 40-bp extension complementary to the plasmid backbone of p426-TEF-amdS , which was PCR amplified using Phusion High-Fidelity DNA polymerase (Thermo Scientific) and the primer pair 7812/5921.

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. PCR products were amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific). .. Oligonucleotides were obtained from Stab Vida Corporation.

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: .. The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage. .. PCR conditions: 98 °C – 1 min; 18 cycles each for 98 °C – 5 s, 55 °C – 30 s and 72 °C – 30 s; finally 72 °C – 5 min. PCR products (expected size of 600 bp) were checked on 1.2% agarose gels and without purification used for third-stage PCR with primers MIDh-454-F and MIDh-454-R, containing barcodes (MIDx) and adapter sequences for sequencing on the 454 platform (GS Junior Systems, Roche, Switzerland).

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer. .. Finally, the PCR products were purified using the AMPure XP system and library quality was assessed on the Agilent Bioanalyzer 2100.

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: .. Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) was used for PCR of DNA fragments up to 3 kb, PrimeSTAR HS DNA Polymerase (Clontech) was used for PCRs with products longer than 3 kb. .. PCR products were digested with FastDigest DpnI (Thermo Fisher Scientific) for 2 h at 37 °C, before being purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific).

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: .. For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′. .. After PCR completion, the PCR reaction mixture was treated with DpnI restriction enzyme (to digest methylated template) and then used to transform E. coli TOP10 strain.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: .. Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific). .. In the case of both CP and RdRp RT-PCR, the final reaction volume was 25 ml, with the following components: 0.5 U of the enzyme, 1Â Phusion HF buffer, 200 mM dNTPs, 0.5 mM each specific primer (PAR_CP_1F/PAR_CP_1R and SpRdRpgap1F/SpRdRpgap1R) ( Table 2 ) and 2 ml of cDNA (250 ng).

    Recombinant:

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: Fungal collection A total of 100 ng of RNA was employed for the synthesis of first-strand cDNA using the recombinant M-MuLV Reverse Transcriptase (Thermo Scientific First Strand cDNA Synthesis kit). .. Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific).

    DNA Extraction:

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage.

    Magnetic Beads:

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads, followed by fragmentation carried out using divalent cations at elevated temperature in NEBNext First Strand Synthesis Reaction Buffer (5×). .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Mutagenesis:

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). .. To generate an autoactive mutant of N. benthamiana NRC4, the aspartic acid (D) in the MHD motif was substituted to valine (V) by site-directed mutagenesis using Phusion High-Fidelity DNA Polymerase (Thermo Fisher). pCR8::NRC4WT ( ) was used as a template.

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: The Cys3254Ser substitution in giantin protein was performed using the standard cloning and PCR-mediated site-directed mutagenesis (SDM) procedures. .. For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Labeling:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. PCR 1: (barcode: CTCTTTCCCTACACGACGCTCTTCCGATCT) > forward (seg1): < barcode > AGGGTCGGCTAGCCATATG > forward (seg2): < barcode > GCCGGGTCAGAAAACCGAA > forward (seg3): < barcode > ATCCAACTGCACGGTCCG > forward (seg4): < barcode > GGTTCCGAATCTCGTTTCTTTG > reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCTACACTGTTGTTATCAGATCT The PCR product for each population (expressed and top 15% of binders for each of the four libraries) was cleaned using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England): > forward: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC > reverse: CAAGCAGAAGACGGCATACGAGAT < index > GTGACTGGAGTTCAGACGTGTGC Top 15% - index: CAATAGTC Expressed - index: TTGAGCCT All the primers were ordered as PAGE-purified oligos.

    Purification:

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: Viral RNA was purified using the Quick-RNA viral kit (Zymo Research), following the manufacturer’s instructions. .. Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG.

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: .. The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage. .. PCR conditions: 98 °C – 1 min; 18 cycles each for 98 °C – 5 s, 55 °C – 30 s and 72 °C – 30 s; finally 72 °C – 5 min. PCR products (expected size of 600 bp) were checked on 1.2% agarose gels and without purification used for third-stage PCR with primers MIDh-454-F and MIDh-454-R, containing barcodes (MIDx) and adapter sequences for sequencing on the 454 platform (GS Junior Systems, Roche, Switzerland).

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: Library fragments were then purified using an Agencourt AMPure XP system (Beckman Coulter, Brea, CA, USA), and 3 μl USER enzyme (New England Biolabs, Ipswich, MA, USA) was added to the size-selected, adaptor-ligated cDNA at 37 °C for 15 min followed by 5 min at 95 °C before PCR. .. PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) was used for PCR of DNA fragments up to 3 kb, PrimeSTAR HS DNA Polymerase (Clontech) was used for PCRs with products longer than 3 kb. .. PCR products were digested with FastDigest DpnI (Thermo Fisher Scientific) for 2 h at 37 °C, before being purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific).

    Sequencing:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: .. To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. PCR 1: (barcode: CTCTTTCCCTACACGACGCTCTTCCGATCT) > forward (seg1): < barcode > AGGGTCGGCTAGCCATATG > forward (seg2): < barcode > GCCGGGTCAGAAAACCGAA > forward (seg3): < barcode > ATCCAACTGCACGGTCCG > forward (seg4): < barcode > GGTTCCGAATCTCGTTTCTTTG > reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCTACACTGTTGTTATCAGATCT The PCR product for each population (expressed and top 15% of binders for each of the four libraries) was cleaned using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England): > forward: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC > reverse: CAAGCAGAAGACGGCATACGAGAT < index > GTGACTGGAGTTCAGACGTGTGC Top 15% - index: CAATAGTC Expressed - index: TTGAGCCT All the primers were ordered as PAGE-purified oligos.

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: .. Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa). .. Restriction enzymes and T4 DNA ligase were purchased from TaKaRa Ltd. Plasmid extraction was achieved by using a plasmid minikit (Omega).

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: Paragraph title: Sample preparation for deep sequencing. ... Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG.

    Article Title: Himalayan Saccharomyces eubayanus Genome Sequences Reveal Genetic Markers Explaining Heterotic Maltotriose Consumption by Saccharomyces pastorianus Hybrids
    Article Snippet: .. The coding sequence of ScMAL31 was amplified from CEN.PK113-7D genomic DNA with Phusion High-Fidelity DNA polymerase (Thermo Scientific), according to the supplier’s instructions, with the primer pair 9942/9943. .. Each primer carried a 40-bp extension complementary to the plasmid backbone of p426-TEF-amdS , which was PCR amplified using Phusion High-Fidelity DNA polymerase (Thermo Scientific) and the primer pair 7812/5921.

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage.

    Article Title: De novo sequencing of the transcriptome reveals regulators of the floral transition in Fargesia macclureana (Poaceae)
    Article Snippet: Paragraph title: Library preparation for transcriptome sequencing ... PCR was performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, Waltham, MA, USA), universal PCR primers, and the Index (X) Primer.

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′. .. A positive clone was confirmed by restriction analysis and Sanger sequencing.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Design of a basigin-mimicking inhibitor targeting the malaria invasion protein RH5
    Article Snippet: To connect the DNA adaptors for deep sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol. .. PCR 1: (barcode: CTCTTTCCCTACACGACGCTCTTCCGATCT) > forward (seg1): < barcode > AGGGTCGGCTAGCCATATG > forward (seg2): < barcode > GCCGGGTCAGAAAACCGAA > forward (seg3): < barcode > ATCCAACTGCACGGTCCG > forward (seg4): < barcode > GGTTCCGAATCTCGTTTCTTTG > reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCTACACTGTTGTTATCAGATCT The PCR product for each population (expressed and top 15% of binders for each of the four libraries) was cleaned using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England): > forward: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC > reverse: CAAGCAGAAGACGGCATACGAGAT < index > GTGACTGGAGTTCAGACGTGTGC Top 15% - index: CAATAGTC Expressed - index: TTGAGCCT All the primers were ordered as PAGE-purified oligos.

    Gel Extraction:

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa). .. A gel extraction kit (Omega) or Cycle-Pure kit (Omega) was used for linear DNA purification.

    Agarose Gel Electrophoresis:

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG. .. PCR products were verified by agarose gel electrophoresis, purified with the DNA Clean & Concentrator kit (Zymo Research), and quantified by spectrometry (NanoDrop One; Thermo Scientific).

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: RNA quality and quantity were tested through agarose gel electrophoresis and using a Qubit Ò 2.0 Fluorometer (Invitrogen), respectively. .. Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific).

    Plasmid Preparation:

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa). .. Restriction enzymes and T4 DNA ligase were purchased from TaKaRa Ltd. Plasmid extraction was achieved by using a plasmid minikit (Omega).

    Article Title: An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species
    Article Snippet: .. Plasmid constructions To generate NRC41-29 -YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). ..

    Article Title: Himalayan Saccharomyces eubayanus Genome Sequences Reveal Genetic Markers Explaining Heterotic Maltotriose Consumption by Saccharomyces pastorianus Hybrids
    Article Snippet: Paragraph title: Plasmid construction. ... The coding sequence of ScMAL31 was amplified from CEN.PK113-7D genomic DNA with Phusion High-Fidelity DNA polymerase (Thermo Scientific), according to the supplier’s instructions, with the primer pair 9942/9943.

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: Paragraph title: Plasmid and strain construction ... Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) was used for PCR of DNA fragments up to 3 kb, PrimeSTAR HS DNA Polymerase (Clontech) was used for PCRs with products longer than 3 kb.

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: Paragraph title: 2.2. Immunoprecipitation (IP), Plasmid Constructions and Transfection ... For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    Sample Prep:

    Article Title: Collective Viral Spread Mediated by Virion Aggregates Promotes the Evolution of Defective Interfering Particles
    Article Snippet: Paragraph title: Sample preparation for deep sequencing. ... Output cDNAs were subsequently amplified with Phusion high-fidelity DNA polymerase (Thermo Scientific) in 50-μl reaction mixtures containing 3% (vol/vol) dimethyl sulfoxide (DMSO) using the following pairs of primers: amplicon 1, 5′-CCATTATTATCATTAAAAGGCTC and 5′-AGCTAAGATGAAGATCGGAG; amplicon 2, 5′-CTACCACAGAAAGGGAACTG and 5′-GTCTTTAACAAGTTCGCTGG; and amplicon 3, 5′-CAGATCCCGTAACAGAAAGT and 5′-ACGAAGACCACAAAACCAG.

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage. .. Sample preparation was carried out with a protocol for the sequencing of amplicons Lib-A.

    In Vitro:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: We have successfully applied LAM-HTGTS to human 293T (ATCC CRL-3216) and A549 (ATCC CCL-185) cell lines, mouse Abelson virus-transformed pro-B and CH12F3 cell lines, mouse bone marrow and splenic B cells, in vitro differentiated T cell precursors, and cultured primary mouse neural stem and progenitor cells. .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting

    Laser Capture Microdissection:

    Article Title: Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS)
    Article Snippet: We have successfully applied LAM-HTGTS to human 293T (ATCC CRL-3216) and A549 (ATCC CCL-185) cell lines, mouse Abelson virus-transformed pro-B and CH12F3 cell lines, mouse bone marrow and splenic B cells, in vitro differentiated T cell precursors, and cultured primary mouse neural stem and progenitor cells. .. Proteinase K (Thermo Scientific, cat. no. 25530-031) Isopropanol (Fisher Scientific, BP26184) Ethanol (Pharmco-AAPER, cat. no. 111000200) Hydrochloric acid (HCl, Fisher Scientific, cat. no. A144-500LB) 2.5-N Sodium hydroxide solution (NaOH, Fisher Scientific, SS414-1) Phusion High-Fidelity DNA Polymerase (Thermo Scientific, cat. no. F530) 5x Phusion HF buffer (Thermo Scientific, cat. no. F518) dNTPs (Fisher Scientific, cat. no. 28406522, 2840502, 2840532, 2840512), four dNTPs are mixed equally and diluted with H2 O to 2.5 mM each, stored at −20 °C for up to 3 months Oligos and primers (synthesized by Integrated DNA Technologies, check for sequences), modified primers are synthesized at 100 nmol scale with standard desalting

    Immunoprecipitation:

    Article Title: Post-ER Stress Biogenesis of Golgi Is Governed by Giantin
    Article Snippet: Paragraph title: 2.2. Immunoprecipitation (IP), Plasmid Constructions and Transfection ... For SDM PCR we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and cycler program: 95 °C 2′ + 15 × [95 °C 30″ + 60 °C 1′ + 72 °C (12′ + 6″)] + 72 °C 6′.

    DNA Purification:

    Article Title: A Novel Bacteriophage Exclusion (BREX) System Encoded by the pglX Gene in Lactobacillus casei Zhang
    Article Snippet: Flanking sequence fragments were amplified by using Phusion high-fidelity DNA polymerase (Thermo Fisher) and 2*PrimeSTAR max premix (TaKaRa). .. A gel extraction kit (Omega) or Cycle-Pure kit (Omega) was used for linear DNA purification.

    Marker:

    Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
    Article Snippet: The rbcL marker was sequenced on the 454 platform (GS Junior, Roche, Switzerland). .. The PCR conditions were as follows: 98 °C – 3 min; 7 cycles of 98 °C – 5 s, 50 °C – 30 s, and 72 °C – 30 s; finally 72 °C – 5 min. Amplification products were used without purification for the second round of PCR which was performed using primers rbcLa-454-F and rbcLa-454-R. PCR was performed using a reaction mixture of a total volume of 20 µl: 4 μl 5× buffer of Phusion high fidelity DNA-polymerase, 250 μM dNTP (Thermo Scientific, USA), 0.2 μl of Phusion high fidelity DNA-polymerase, 0.3 pM of each primer, 4 μl of amplification products of the previous stage.

    Lysis:

    Article Title: The European race of Gremmeniella abietina hosts a single species of Gammapartitivirus showing a global distribution and possible recombinant events in its history.
    Article Snippet: This step was repeated after adding the RNeasy Lysis Buffer complemented with 10 ml of b-mercaptoethanol. .. Reverse transcription-polymerase chain reaction (RT-PCR) was successively carried out twice with Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher high fidelity dna polymerase enzyme
    Optimization of PCR amplification of the glutamyl-tRNA reductase gene by using various <t>DMSO</t> concentrations (A); Lane 1: 3% (w/v); Lane 2: 5% (w/v); Lane 3: 7% (w/v); Lane 4: 9% (w/v); and Lane 5: 11% (w/v). PCR product after tailoring the ends and purification by gel extraction kit (B). EcoR V cut, dephosphorylated and purified pBBR1MCS2 (C). <t>DNA</t> ladder (SM0331 Fermentas, M) was loaded into the first well.
    High Fidelity Dna Polymerase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase enzyme/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase enzyme - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Optimization of PCR amplification of the glutamyl-tRNA reductase gene by using various DMSO concentrations (A); Lane 1: 3% (w/v); Lane 2: 5% (w/v); Lane 3: 7% (w/v); Lane 4: 9% (w/v); and Lane 5: 11% (w/v). PCR product after tailoring the ends and purification by gel extraction kit (B). EcoR V cut, dephosphorylated and purified pBBR1MCS2 (C). DNA ladder (SM0331 Fermentas, M) was loaded into the first well.

    Journal: Biotechnology, Biotechnological Equipment

    Article Title: Heterologous expression of glutamyl-tRNA reductase gene in Rhodobacter sphaeroides O.U.001 to enhance 5-aminolevulinic acid production

    doi: 10.1080/13102818.2014.978170

    Figure Lengend Snippet: Optimization of PCR amplification of the glutamyl-tRNA reductase gene by using various DMSO concentrations (A); Lane 1: 3% (w/v); Lane 2: 5% (w/v); Lane 3: 7% (w/v); Lane 4: 9% (w/v); and Lane 5: 11% (w/v). PCR product after tailoring the ends and purification by gel extraction kit (B). EcoR V cut, dephosphorylated and purified pBBR1MCS2 (C). DNA ladder (SM0331 Fermentas, M) was loaded into the first well.

    Article Snippet: The reaction was performed in the presence of 3%, 5%, 7%, 9% or 11% (w/v) dimethyl sulphoxide (DMSO), using a high-fidelity DNA polymerase enzyme (Phusion, Thermo Scientific) in a total volume of 20 μL.

    Techniques: Polymerase Chain Reaction, Amplification, Purification, Gel Extraction