phusion hf dna polymerase new england biolabs  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units
    Catalog Number:
    500 units
    Thermostable DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs phusion hf dna polymerase new england biolabs
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units hf dna polymerase new england biolabs/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    phusion hf dna polymerase new england biolabs - by Bioz Stars, 2020-01
    90/100 stars

    Related Products / Commonly Used Together

    primers 5
    gblock dna


    Related Articles

    Clone Assay:

    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: These fragments were introduced into either XbaI- and BamHI-digested pBBRMCS-5 (lhfA ) or EcoRI-digested pBBPgdh (lhfE ) using In-Fusion PCR cloning system (Clontech). .. The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs).

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: Paragraph title: Library construction and cloning ... The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays. .. All cell lines were confirmed for the absence of mycoplasma using the PCR assay of .

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Paragraph title: 2.3. Cloning and Expression of Hydrolases ... Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany).

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: .. DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Article Title: Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W]Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W] [OA]
    Article Snippet: To generate the RbcSpro :HTA6:EYFP and Lhcpro :HTA6:EYFP lines, sequences upstream of RbcS or Lhc coding regions, respectively, were amplified from Arabidopsis ( Arabidopsis thaliana ) ecotype Columbia (Col-0) genomic DNA using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs) and gene-specific primers (Supplemental Table S1), integrated into pDONR221(Invitrogen) with BP clonase II (Invitrogen), sequence-checked, and recombined into the Gateway-adapted pFYTAG binary vector ( ) using LR clonase II (Invitrogen). .. To generate the UBQ10pro :EGFP:LTi6b line, the EGFP:LTi6b sequence was amplified from genomic DNA of a Ubi3pro :EGFP:LTi6b line ( ; a generous gift of M. Aida and B. Scheres) with the EYFP Kpn I Forw (TATGGTACCATGGTGAGCAAGGGCGAG) and pEGAD Sac I Rev (CCCGAGCTCAATAAATTCCTCACATAAACCAACG) primers using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs), subcloned, sequence-checked, and cloned into a derivative of the pC1300-PolyA binary vector (a kind gift of J. Mathur) to give rise to pC1300-EGFP:LTi6b.

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Modulates Dendritic Spine Maturation and Morphogenesis via MicroRNA-132 Upregulation
    Article Snippet: Paragraph title: Cloning of lentiviral vectors. ... To generate the CMV-miR-132-venus construct, PCR-based screening of miR-132 was performed using the forward primer 5′-GAATTCAAGGCGGCCGCTCGGGCACGCCTGTTC-3′ and the reverse primer 5′-CGATGTTAACTCTAGCGCCCGTTTTCTCGCCACCT-3′ by Phusion High Fidelity DNA Polymerase (New England BioLabs).


    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: .. The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. The resulting 2.3-kb fragment was incorporated into PstI-digested pJQ200SK using the In-Fusion PCR cloning system (Clontech).

    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). .. The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen) and quantified using Qubit dsDNA HS Assay Kit (Life Technologies).

    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: The SAT1 marker, amplified from yEP352-SAT1 plasmid using the primers HE4_F and HE4_R, was assembled with the SalI-digested yEPGAP-GFP and yEPGAP-YFP via Gibson assembly to create plasmid yEPGAP-GFP-SAT1 and yEPGAP-YFP-SAT1, respectively. .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour.

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: .. The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Next, the PCR-amplified fragment was ligated into the yeast display plasmid (after the original plasmid was digested with NheI and XhoI) via homologous recombination.

    Article Title: What drives phenotypic divergence among coral clonemates of Acropora palmata?. What drives phenotypic divergence among coral clonemates of Acropora palmata?
    Article Snippet: .. Barcodes were added in a second PCR amplification (total volume 20 µl), which contained 7 µl of gel‐extracted PCR product, 0.2 mm of each primer (p3 and index primer), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB). ..

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: .. DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Article Title: Patterns of PCR Amplification Artifacts of the Fungal Barcode Marker in a Hybrid Mushroom
    Article Snippet: .. This is because the Phusion® High-Fidelity DNA Polymerase has the 3′–5′ exonuclease activity while Taq DNA polymerase is devoid of 3′–5′ exonuclease activity and cannot excise mis-incorporated bases produced during PCR amplification ( ). .. However, we would like to mention that the fidelity of Phusion® High-Fidelity DNA Polymerase observed in our study was not 50 × higher than the highest reported so far for commonly used Taq Polymerases-based systems.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: .. The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Codon-optimized versions of the 1G4 α - and β -chains (GeneArt) generated in the pCR-Script vector (Stratagene) were used to carry out the initial screening of the TCR variants using RNA transfection methods that have been previously described ( ).

    Article Title: Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W]Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W] [OA]
    Article Snippet: .. To generate the RbcSpro :HTA6:EYFP and Lhcpro :HTA6:EYFP lines, sequences upstream of RbcS or Lhc coding regions, respectively, were amplified from Arabidopsis ( Arabidopsis thaliana ) ecotype Columbia (Col-0) genomic DNA using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs) and gene-specific primers (Supplemental Table S1), integrated into pDONR221(Invitrogen) with BP clonase II (Invitrogen), sequence-checked, and recombined into the Gateway-adapted pFYTAG binary vector ( ) using LR clonase II (Invitrogen). .. The RbcS2Bpro :ECFP:3xNLS line was generated by recombining the pDONR221-integrated RbcS2B upstream sequences into the Gateway-adapted pBGCN binary vector ( ) with LR clonase II (Invitrogen).

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. .. The resulting constructs were used for cross-linking, protein purification, and functional experiments. cDNA was amplified by polymerase chain reaction; EcoRI and NotI restriction sites were introduced at the 5′- and 3′-ends, respectively, by using the following primers: forward primer, GTGGGGAATTCGCCATGAACGGCACAGAGGG; and reverse primer, TCTGGGCGGCCGCTCAGGCTGGAGCGACCTGA.

    Stable Transfection:

    Article Title: Flightless I interacts with NMMIIA to promote cell extension formation, which enables collagen remodeling
    Article Snippet: .. Stable cell lines expressing HA-tagged FliI LRR-GLD 2–6 or GLD 2–6 Forward (5′-CTCGGAGTTCGCCAGTGGCTTCTATACTGTGGAAGATACACACT-3′) and reverse (5′-ACTGGCGAACTCCGAGTAGTCAAGGCGTGGCTTCTCCAGGCCCT-3′) primers were designed based on NCBI GenBank No. NM_022009.1 to delete (Phusion high-fidelity DNA polymerase; New England Biolabs) FliI GLD 1 (nt 1471–1815, aa 491–605) in pcDNA3-FliI-HA. .. The resulting HA-tagged FliI LRR-GLD 2–6 was subcloned into Hpa I/Eco RI linearized pMSCVpuro using In-fusion HD enzyme premix (Clontech) and sequenced (ACGT).


    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany).

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Blocking Assay:

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: .. The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Next, the PCR-amplified fragment was ligated into the yeast display plasmid (after the original plasmid was digested with NheI and XhoI) via homologous recombination.


    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: The HEKTLR6 line was maintained in Dulbecco’s Modified Eagle’s medium with Glutamax (Gibco) supplied with 10% fetal bovine serum (Gibco) and generated by transfection of pAAVS1-TLR6 together with sgRNA plasmid against AAVS1 and a Cas9 plasmid (750 ng each) using Xtreme-gene transfection reagent (Roche). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The wild type rod opsin-EGFP and rod opsinmCherry vectors were described in a previous study and used here without modification. .. The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol.


    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: The DNA samples incubated for primer extension as described previously were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) for second adaptor ligation. .. The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: Medium was replaced 24 h after transfection; 48 h after transfection, cells were harvested by incubation in Gentle Cell Dissociation Reagent (STEMCELL Technologies, 07174) for 7 min. Dissociation reagent was removed and cells were resuspended in cultivation medium, pipetted to single cells, and spin down for 5 min at 200g . .. PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate.

    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour. .. The 5′ and 3′ flanking regions for the fluorescent integration cassettes were amplified from genomic DNA (gDNA) of ATCC 2001 using the primer pairs HE6_F and HE6_R and HE7_F and HE7_R respectively, which contain homologous sequences to the pseudo gene CAGL0C01067g.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: .. The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Codon-optimized versions of the 1G4 α - and β -chains (GeneArt) generated in the pCR-Script vector (Stratagene) were used to carry out the initial screening of the TCR variants using RNA transfection methods that have been previously described ( ).

    Activity Assay:

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays. .. All cell lines were confirmed for the absence of mycoplasma using the PCR assay of .

    Article Title: Patterns of PCR Amplification Artifacts of the Fungal Barcode Marker in a Hybrid Mushroom
    Article Snippet: .. This is because the Phusion® High-Fidelity DNA Polymerase has the 3′–5′ exonuclease activity while Taq DNA polymerase is devoid of 3′–5′ exonuclease activity and cannot excise mis-incorporated bases produced during PCR amplification ( ). .. However, we would like to mention that the fidelity of Phusion® High-Fidelity DNA Polymerase observed in our study was not 50 × higher than the highest reported so far for commonly used Taq Polymerases-based systems.


    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Paragraph title: 2.3. Cloning and Expression of Hydrolases ... Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany).

    Article Title: Flightless I interacts with NMMIIA to promote cell extension formation, which enables collagen remodeling
    Article Snippet: .. Stable cell lines expressing HA-tagged FliI LRR-GLD 2–6 or GLD 2–6 Forward (5′-CTCGGAGTTCGCCAGTGGCTTCTATACTGTGGAAGATACACACT-3′) and reverse (5′-ACTGGCGAACTCCGAGTAGTCAAGGCGTGGCTTCTCCAGGCCCT-3′) primers were designed based on NCBI GenBank No. NM_022009.1 to delete (Phusion high-fidelity DNA polymerase; New England Biolabs) FliI GLD 1 (nt 1471–1815, aa 491–605) in pcDNA3-FliI-HA. .. The resulting HA-tagged FliI LRR-GLD 2–6 was subcloned into Hpa I/Eco RI linearized pMSCVpuro using In-fusion HD enzyme premix (Clontech) and sequenced (ACGT).


    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: The PCR reaction for TLR Knockin was performed using primers ST_puro_gt_fw and ST_puro_gt_rv. .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Transformation Assay:

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Plasmids were isolated from yeast (D2004, Zymoprep II yeast miniprep kit, Zymo Research) and transformed into XL1-Blue (200228, Agilent Technologies) via electroporation.

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. Plasmid constructions were transformed into E. coli TOP10 competent cells prior to selection on LB agar supplemented with ampicillin.

    Derivative Assay:

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.


    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour. .. The fluorescent integration plasmids were then digested with SphI and integrated into the genome of ATCC 2001 by electroporation to generate the fluorescently marked strains MHCg-G and MHCg-Y, respectively.

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Plasmids were isolated from yeast (D2004, Zymoprep II yeast miniprep kit, Zymo Research) and transformed into XL1-Blue (200228, Agilent Technologies) via electroporation.


    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: Medium was replaced 24 h after transfection; 48 h after transfection, cells were harvested by incubation in Gentle Cell Dissociation Reagent (STEMCELL Technologies, 07174) for 7 min. Dissociation reagent was removed and cells were resuspended in cultivation medium, pipetted to single cells, and spin down for 5 min at 200g . .. PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: The HEKTLR6 line was maintained in Dulbecco’s Modified Eagle’s medium with Glutamax (Gibco) supplied with 10% fetal bovine serum (Gibco) and generated by transfection of pAAVS1-TLR6 together with sgRNA plasmid against AAVS1 and a Cas9 plasmid (750 ng each) using Xtreme-gene transfection reagent (Roche). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: The 1G4, DMF4, and DMF5 TCR variants used to carry out RNA transfection assays were generated using an overlapping PCR method ( ) using the general strategy outlined in and the primers detailed in . .. The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ).


    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: The DNA samples incubated for primer extension as described previously were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) for second adaptor ligation. .. The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: What drives phenotypic divergence among coral clonemates of Acropora palmata?. What drives phenotypic divergence among coral clonemates of Acropora palmata?
    Article Snippet: Ligation products were amplified in 40‐µl reactions containing 15 µl of ligated product, 0.2 mm of each primer (p1 and p2), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB). .. Barcodes were added in a second PCR amplification (total volume 20 µl), which contained 7 µl of gel‐extracted PCR product, 0.2 mm of each primer (p3 and index primer), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB).

    Atomic Absorption Spectroscopy:

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Overlapping fragments corresponding to the C-terminal region of the 1G4 α -chain that encoded substituted residues were generated using individual forward oligonucleotide primers that encoded the CDR3 α AAS, designated α 3.1F to α 3.20F, and the α 4.1 reverse primer, which consisted of 66 d(T) residues at the 5′ end followed by sequences complementary to the 3′ end of the α -chain C region.


    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. Site-directed mutagenesis of the resulting plasmid using the PCR-based QuikChange method (Agilent Technologies) was conducted to introduce the H532A substitution into the Rp BphP2 coding sequence or the H547A substitution into the Rp BphP3 coding sequence.


    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: Single clones were generated and genotyped using genomic DNA isolated using the Wizard genomic DNA purification kit (Promega #A1125). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: .. The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Codon-optimized versions of the 1G4 α - and β -chains (GeneArt) generated in the pCR-Script vector (Stratagene) were used to carry out the initial screening of the TCR variants using RNA transfection methods that have been previously described ( ).

    Article Title: Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W]Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W] [OA]
    Article Snippet: To generate the RbcSpro :HTA6:EYFP and Lhcpro :HTA6:EYFP lines, sequences upstream of RbcS or Lhc coding regions, respectively, were amplified from Arabidopsis ( Arabidopsis thaliana ) ecotype Columbia (Col-0) genomic DNA using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs) and gene-specific primers (Supplemental Table S1), integrated into pDONR221(Invitrogen) with BP clonase II (Invitrogen), sequence-checked, and recombined into the Gateway-adapted pFYTAG binary vector ( ) using LR clonase II (Invitrogen). .. The RbcS2Bpro :ECFP:3xNLS line was generated by recombining the pDONR221-integrated RbcS2B upstream sequences into the Gateway-adapted pBGCN binary vector ( ) with LR clonase II (Invitrogen).


    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. Site-directed mutagenesis of the resulting plasmid using the PCR-based QuikChange method (Agilent Technologies) was conducted to introduce the H532A substitution into the Rp BphP2 coding sequence or the H547A substitution into the Rp BphP3 coding sequence.

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The amino acid sequence of the peptide linker (SPNSASHSGSAPNTSSAPGSQ) was chosen for its non-repetitive nature ( ). .. The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block.

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. PCR fragments were digested by Kpn I /Eco RI or Pst I /Kpn I and cloned in-frame downstream of the hexa-His box sequence in the pBAD/His B vector (Invitrogen) precut with the same restriction enzymes using T4 DNA Ligase (Roche, Basel, Switzerland).

    Article Title: What drives phenotypic divergence among coral clonemates of Acropora palmata?. What drives phenotypic divergence among coral clonemates of Acropora palmata?
    Article Snippet: Barcodes were added in a second PCR amplification (total volume 20 µl), which contained 7 µl of gel‐extracted PCR product, 0.2 mm of each primer (p3 and index primer), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB). .. Libraries were run on an Illumina HiSeq 2500 sequencer using 50 nt single read sequencing.

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: .. DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Article Title: Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W]Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W] [OA]
    Article Snippet: .. To generate the RbcSpro :HTA6:EYFP and Lhcpro :HTA6:EYFP lines, sequences upstream of RbcS or Lhc coding regions, respectively, were amplified from Arabidopsis ( Arabidopsis thaliana ) ecotype Columbia (Col-0) genomic DNA using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs) and gene-specific primers (Supplemental Table S1), integrated into pDONR221(Invitrogen) with BP clonase II (Invitrogen), sequence-checked, and recombined into the Gateway-adapted pFYTAG binary vector ( ) using LR clonase II (Invitrogen). .. The RbcS2Bpro :ECFP:3xNLS line was generated by recombining the pDONR221-integrated RbcS2B upstream sequences into the Gateway-adapted pBGCN binary vector ( ) with LR clonase II (Invitrogen).

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Modulates Dendritic Spine Maturation and Morphogenesis via MicroRNA-132 Upregulation
    Article Snippet: The RFP reporter sequence was exchanged with the tdTomato or Venus with SalI and BamHI and inserted into the multicloning site of the RFP-QM512B vector from the SpaQ Cumate Switch system (System Bioscience) to generate CMV-tdTomato-QM512B or CMV-Venus-QM512B. .. To generate the CMV-miR-132-venus construct, PCR-based screening of miR-132 was performed using the forward primer 5′-GAATTCAAGGCGGCCGCTCGGGCACGCCTGTTC-3′ and the reverse primer 5′-CGATGTTAACTCTAGCGCCCGTTTTCTCGCCACCT-3′ by Phusion High Fidelity DNA Polymerase (New England BioLabs).


    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. Site-directed mutagenesis of the resulting plasmid using the PCR-based QuikChange method (Agilent Technologies) was conducted to introduce the H532A substitution into the Rp BphP2 coding sequence or the H547A substitution into the Rp BphP3 coding sequence.


    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Plasmids were isolated from yeast (D2004, Zymoprep II yeast miniprep kit, Zymo Research) and transformed into XL1-Blue (200228, Agilent Technologies) via electroporation.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: Single clones were generated and genotyped using genomic DNA isolated using the Wizard genomic DNA purification kit (Promega #A1125). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.


    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: .. The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). .. The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen) and quantified using Qubit dsDNA HS Assay Kit (Life Technologies).

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: Linear epitope tags for detection (Myc) and purification (heptahistidine) were added to the C terminus of the VH domain. .. The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block.

    Article Title: What drives phenotypic divergence among coral clonemates of Acropora palmata?. What drives phenotypic divergence among coral clonemates of Acropora palmata?
    Article Snippet: Barcodes were added in a second PCR amplification (total volume 20 µl), which contained 7 µl of gel‐extracted PCR product, 0.2 mm of each primer (p3 and index primer), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB). .. PCR products were purified using a QIAquick minElute PCR purification kit (Qiagen) and then with Ampure XP beads (Agencourt).

    Protein Purification:

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. .. The resulting constructs were used for cross-linking, protein purification, and functional experiments. cDNA was amplified by polymerase chain reaction; EcoRI and NotI restriction sites were introduced at the 5′- and 3′-ends, respectively, by using the following primers: forward primer, GTGGGGAATTCGCCATGAACGGCACAGAGGG; and reverse primer, TCTGGGCGGCCGCTCAGGCTGGAGCGACCTGA.

    Polymerase Chain Reaction:

    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: .. The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. The resulting 2.3-kb fragment was incorporated into PstI-digested pJQ200SK using the In-Fusion PCR cloning system (Clontech).

    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: .. The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). .. The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen) and quantified using Qubit dsDNA HS Assay Kit (Life Technologies).

    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: .. PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate. .. Primer for the PCR were the following: (fwd) 5ʹCTACGACCCAGGCTTCATGGCʹ3, (rev) 5ʹGACGGCTTGCACACCATGC3ʹ.

    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: The PCR products and the vector yEPGAP-cherry were digested with EcoRI and XhoI. .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour.

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Next, the PCR-amplified fragment was ligated into the yeast display plasmid (after the original plasmid was digested with NheI and XhoI) via homologous recombination.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays. .. All cell lines were confirmed for the absence of mycoplasma using the PCR assay of .

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany).

    Article Title: Flightless I interacts with NMMIIA to promote cell extension formation, which enables collagen remodeling
    Article Snippet: Stable cell lines expressing HA-tagged FliI LRR-GLD 2–6 or GLD 2–6 Forward (5′-CTCGGAGTTCGCCAGTGGCTTCTATACTGTGGAAGATACACACT-3′) and reverse (5′-ACTGGCGAACTCCGAGTAGTCAAGGCGTGGCTTCTCCAGGCCCT-3′) primers were designed based on NCBI GenBank No. NM_022009.1 to delete (Phusion high-fidelity DNA polymerase; New England Biolabs) FliI GLD 1 (nt 1471–1815, aa 491–605) in pcDNA3-FliI-HA. .. To obtain HA-tagged FliI GLD 2–6 (2.011 kb, including ATG transcription start codon, aa 619–1271-HA), a primer pair (forward, 5′-AGATCTCTCGAGGTTAACCGCCACCATGACCAGGATGTACCGTG-3′; reverse, 5′-CTACCCGGTAGAATTCTCATTAAGCATAGTCGGGC-3′) was designed based on NCBI GenBank No. NM_022009.1 to perform PCR (Phusion high-fidelity DNA polymerase) by using pcDNA3-FliI-HA as template.

    Article Title: What drives phenotypic divergence among coral clonemates of Acropora palmata?. What drives phenotypic divergence among coral clonemates of Acropora palmata?
    Article Snippet: .. Barcodes were added in a second PCR amplification (total volume 20 µl), which contained 7 µl of gel‐extracted PCR product, 0.2 mm of each primer (p3 and index primer), 0.3 mm dNTP, 1 × Phusion HF buffer and 0.4 U Phusion high‐fidelity DNA polymerase (NEB). ..

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: .. DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Article Title: Patterns of PCR Amplification Artifacts of the Fungal Barcode Marker in a Hybrid Mushroom
    Article Snippet: .. This is because the Phusion® High-Fidelity DNA Polymerase has the 3′–5′ exonuclease activity while Taq DNA polymerase is devoid of 3′–5′ exonuclease activity and cannot excise mis-incorporated bases produced during PCR amplification ( ). .. However, we would like to mention that the fidelity of Phusion® High-Fidelity DNA Polymerase observed in our study was not 50 × higher than the highest reported so far for commonly used Taq Polymerases-based systems.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: .. The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Codon-optimized versions of the 1G4 α - and β -chains (GeneArt) generated in the pCR-Script vector (Stratagene) were used to carry out the initial screening of the TCR variants using RNA transfection methods that have been previously described ( ).

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Modulates Dendritic Spine Maturation and Morphogenesis via MicroRNA-132 Upregulation
    Article Snippet: .. To generate the CMV-miR-132-venus construct, PCR-based screening of miR-132 was performed using the forward primer 5′-GAATTCAAGGCGGCCGCTCGGGCACGCCTGTTC-3′ and the reverse primer 5′-CGATGTTAACTCTAGCGCCCGTTTTCTCGCCACCT-3′ by Phusion High Fidelity DNA Polymerase (New England BioLabs). .. The PCR product, digested with NotI and XbaI , was inserted into the CMV-Venus-QM512B construct.

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. .. The resulting constructs were used for cross-linking, protein purification, and functional experiments. cDNA was amplified by polymerase chain reaction; EcoRI and NotI restriction sites were introduced at the 5′- and 3′-ends, respectively, by using the following primers: forward primer, GTGGGGAATTCGCCATGAACGGCACAGAGGG; and reverse primer, TCTGGGCGGCCGCTCAGGCTGGAGCGACCTGA.


    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: .. The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. The resulting 2.3-kb fragment was incorporated into PstI-digested pJQ200SK using the In-Fusion PCR cloning system (Clontech).

    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: The fluorescent C . glabrata strains, MHCg-Y and MHCg-G (as KKY and KKG, respectively, previously used in ), were constructed as follows: the gene encoding green fluorescent protein (GFP) was amplified from pGS62 plasmid using primer pair of HE1_F and HE1_R; the gene encoding yellow fluorescent protein (YFP) was amplified from pGS63 using primer pair HE2_F and HE2_R. .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: PCR was performed for knock-in of the TLR6 construct (puro 5′) as well as the AAVS1 WT locus specific as a control. .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The resulting constructs were designated as 35S:ERF10, 35S:ERF32, 35S:ERF121, 35S:ERF221, 35S:MYC2a, 35S:PMT1a, 35S:QPT2, 35S:A622, GmUBI3:ERF10, GmUBI3:ERF32, GmUBI3:ERF121, GmUBI3:ERF221, GmUBI3:MYC2a, GmUBI3:PMT1a, GmUBI3:QPT2, GmUBI3:A622, 4GAG:ERF10, 4GAG:ERF32, 4GAG:ERF121, 4GAG:ERF221, 4GAG:MYC2a, 4GAG:PMT1a, 4GAG:QPT2, and 4GAG:A622.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: Paragraph title: Generation of WT and variant TCR constructs used for in vitro RNA-screening assays ... The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ).

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Modulates Dendritic Spine Maturation and Morphogenesis via MicroRNA-132 Upregulation
    Article Snippet: .. To generate the CMV-miR-132-venus construct, PCR-based screening of miR-132 was performed using the forward primer 5′-GAATTCAAGGCGGCCGCTCGGGCACGCCTGTTC-3′ and the reverse primer 5′-CGATGTTAACTCTAGCGCCCGTTTTCTCGCCACCT-3′ by Phusion High Fidelity DNA Polymerase (New England BioLabs). .. The PCR product, digested with NotI and XbaI , was inserted into the CMV-Venus-QM512B construct.

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: .. The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. ..


    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays. .. All cell lines were confirmed for the absence of mycoplasma using the PCR assay of .

    Chromatin Immunoprecipitation:

    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: Paragraph title: ChIP-exo preparation ... The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs).

    Plasmid Preparation:

    Article Title: Redox Regulation of a Light-Harvesting Antenna Complex in an Anoxygenic Phototroph
    Article Snippet: The vectors used for allelic exchange of wild-type (WT) bphP2 for bphP2 H532A or WT bphP3 for bphP3 H547S were constructed by PCR amplification of bphP2 or bphP3 using Phusion high-fidelity DNA polymerase (New England Biolabs). .. Site-directed mutagenesis of the resulting plasmid using the PCR-based QuikChange method (Agilent Technologies) was conducted to introduce the H532A substitution into the Rp BphP2 coding sequence or the H547A substitution into the Rp BphP3 coding sequence.

    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: The SAT1 marker, amplified from yEP352-SAT1 plasmid using the primers HE4_F and HE4_R, was assembled with the SalI-digested yEPGAP-GFP and yEPGAP-YFP via Gibson assembly to create plasmid yEPGAP-GFP-SAT1 and yEPGAP-YFP-SAT1, respectively. .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour.

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was flanked with N-terminal NheI and C-terminal XhoI restriction sites as well as 45 bp of homology at each end with complementary sites in the yeast display plasmid (pCTCON2). .. The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block.

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: The HEKTLR6 line was maintained in Dulbecco’s Modified Eagle’s medium with Glutamax (Gibco) supplied with 10% fetal bovine serum (Gibco) and generated by transfection of pAAVS1-TLR6 together with sgRNA plasmid against AAVS1 and a Cas9 plasmid (750 ng each) using Xtreme-gene transfection reagent (Roche). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. PCR fragments were digested by Kpn I /Eco RI or Pst I /Kpn I and cloned in-frame downstream of the hexa-His box sequence in the pBAD/His B vector (Invitrogen) precut with the same restriction enzymes using T4 DNA Ligase (Roche, Basel, Switzerland).

    Article Title: Increased Leaf Nicotine Content by Targeting Transcription Factor Gene Expression in Commercial Flue-Cured Tobacco (Nicotiana tabacum L.)
    Article Snippet: .. DNA Cloning and Vector Construction Coding regions (CDS) of NtERF10 (CQ808845), NtERF32 (AB828154), NtERF121 (AY655738), NtERF221 (CQ808982), NtMYC2a (HM466974), NtPMT1a (AF126810), NtQPT2 (AB038494), and NtA622 (D28505) were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and introduced into Gateway pDONR221 vector via BP recombination reaction for sequence verification. .. The PCR-amplified promoter sequence of Glycine max Ubiquitin-3 (GmUBI3 ) gene and artificially synthesized 4XGAG promoter derived from NtPMT1a gene were used to replace the original dual cauliflower mosaic virus (CaMV) 35S promoter in the binary vector pMDC32, namely pGmUBI3-MDC and p4GAG-MDC, for Gateway compatibility.

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ). .. Codon-optimized versions of the 1G4 α - and β -chains (GeneArt) generated in the pCR-Script vector (Stratagene) were used to carry out the initial screening of the TCR variants using RNA transfection methods that have been previously described ( ).

    Article Title: Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W]Unique and Overlapping Expression Patterns among Members of Photosynthesis-Associated Nuclear Gene Families in Arabidopsis 1 [W] [OA]
    Article Snippet: .. To generate the RbcSpro :HTA6:EYFP and Lhcpro :HTA6:EYFP lines, sequences upstream of RbcS or Lhc coding regions, respectively, were amplified from Arabidopsis ( Arabidopsis thaliana ) ecotype Columbia (Col-0) genomic DNA using Finnzymes Phusion high-fidelity DNA polymerase (New England BioLabs) and gene-specific primers (Supplemental Table S1), integrated into pDONR221(Invitrogen) with BP clonase II (Invitrogen), sequence-checked, and recombined into the Gateway-adapted pFYTAG binary vector ( ) using LR clonase II (Invitrogen). .. The RbcS2Bpro :ECFP:3xNLS line was generated by recombining the pDONR221-integrated RbcS2B upstream sequences into the Gateway-adapted pBGCN binary vector ( ) with LR clonase II (Invitrogen).

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Modulates Dendritic Spine Maturation and Morphogenesis via MicroRNA-132 Upregulation
    Article Snippet: The RFP reporter sequence was exchanged with the tdTomato or Venus with SalI and BamHI and inserted into the multicloning site of the RFP-QM512B vector from the SpaQ Cumate Switch system (System Bioscience) to generate CMV-tdTomato-QM512B or CMV-Venus-QM512B. .. To generate the CMV-miR-132-venus construct, PCR-based screening of miR-132 was performed using the forward primer 5′-GAATTCAAGGCGGCCGCTCGGGCACGCCTGTTC-3′ and the reverse primer 5′-CGATGTTAACTCTAGCGCCCGTTTTCTCGCCACCT-3′ by Phusion High Fidelity DNA Polymerase (New England BioLabs).

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. .. The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were subcloned into a pcDNA3.1(+) vector according to the manufacturer’s protocol.

    Functional Assay:

    Article Title: The Retinitis Pigmentosa-Linked Mutations in Transmembrane Helix 5 of Rhodopsin Disrupt Cellular Trafficking Regardless of Oligomerization State
    Article Snippet: The RP-causing rod opsin mutants (V209M, P215L, F220C, and C222R) were constructed by using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. .. The resulting constructs were used for cross-linking, protein purification, and functional experiments. cDNA was amplified by polymerase chain reaction; EcoRI and NotI restriction sites were introduced at the 5′- and 3′-ends, respectively, by using the following primers: forward primer, GTGGGGAATTCGCCATGAACGGCACAGAGGG; and reverse primer, TCTGGGCGGCCGCTCAGGCTGGAGCGACCTGA.


    Article Title: The Escherichia coli transcriptome mostly consists of independently regulated modules
    Article Snippet: .. The DNA sample purified by GeneRead Size Selection Kit (Qiagen) was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). .. The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen) and quantified using Qubit dsDNA HS Assay Kit (Life Technologies).

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: Antibiotic selection was performed using 0.4 μg/ml Puromycin. .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. Plasmid constructions were transformed into E. coli TOP10 competent cells prior to selection on LB agar supplemented with ampicillin.

    Agarose Gel Electrophoresis:

    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate. .. PCR product of untransfected and transfected samples were analyzed on 2.5% MetaPhore Agarose Gel (Lonza, Basel, Switzerland) PCR products were analyzed using GeneArt Genomic Cleavage Detection Kit (Invitrogen, Carlsbad, California, A24372) according to manufacturer’s protocol.

    In Vitro:

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: Paragraph title: Generation of WT and variant TCR constructs used for in vitro RNA-screening assays ... The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ).


    Article Title: Patterns of PCR Amplification Artifacts of the Fungal Barcode Marker in a Hybrid Mushroom
    Article Snippet: .. This is because the Phusion® High-Fidelity DNA Polymerase has the 3′–5′ exonuclease activity while Taq DNA polymerase is devoid of 3′–5′ exonuclease activity and cannot excise mis-incorporated bases produced during PCR amplification ( ). .. However, we would like to mention that the fidelity of Phusion® High-Fidelity DNA Polymerase observed in our study was not 50 × higher than the highest reported so far for commonly used Taq Polymerases-based systems.

    Concentration Assay:

    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: Cas9 and cmgRNA were mixed at a concentration of 0.3 μM each in 25 μl of OptiMEM. .. PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate.

    DNA Purification:

    Article Title: Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors
    Article Snippet: Single clones were generated and genotyped using genomic DNA isolated using the Wizard genomic DNA purification kit (Promega #A1125). .. Phusion HF DNA polymerase (NEB # M0530 L) and 200 ng genomic DNA using following conditions; initial denaturation at 98°C for 3 min, followed by 35 cycles of 98°C 30 s, 58°C 30 s and 72°C for 90 s. final extension was done at 72°C for 5 min. AAVS1 WT PCR was performed using primers hAAVS1-For and hAAVS1-Rev by amplifying at 98°C for 5 min, followed by 40 cycles of 98°C 30 s, 60°C 30 s, 72°C for 45 s and final extension at 72°C for 5 min. After confirmation of TLR insertion by genotyping, selected clones were tested for activity of the TLR allele by FACS-based assay and a single clone was chosen for further assays.


    Article Title: High-throughput micropatterning platform reveals Nodal-dependent bisection of peri-gastrulation–associated versus preneurulation-associated fate patterning
    Article Snippet: Cells were resuspended in 25 μl of Cell Lysis Buffer mixed with 1 μl Protein Degrader, both from the GeneArtTM Genomic Cleavage Detection Kit (Invitrogen, A24372). .. PCR was performed using Phusion High Fidelity DNA Polymerase (NEB, M0530) according to manufactures protocol using 2 μl of the cell lysate.


    Article Title: CgSTE11 mediates cross tolerance to multiple environmental stressors in Candida glabrata
    Article Snippet: The SAT1 marker, amplified from yEP352-SAT1 plasmid using the primers HE4_F and HE4_R, was assembled with the SalI-digested yEPGAP-GFP and yEPGAP-YFP via Gibson assembly to create plasmid yEPGAP-GFP-SAT1 and yEPGAP-YFP-SAT1, respectively. .. Gibson assembly reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB), Taq DNA ligase (NEB), and T5 exonuclease (NEB); and the reaction was incubated at 50 °C for 1 hour.

    Gel Extraction:

    Article Title: Cell-Wall Hydrolases as Antimicrobials against Staphylococcus Species: Focus on Sle1
    Article Snippet: .. Amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and the amplicons were then gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). .. PCR fragments were digested by Kpn I /Eco RI or Pst I /Kpn I and cloned in-frame downstream of the hexa-His box sequence in the pBAD/His B vector (Invitrogen) precut with the same restriction enzymes using T4 DNA Ligase (Roche, Basel, Switzerland).

    Variant Assay:

    Article Title: Single and Dual Amino Acid Substitutions in TCR CDRs Can Enhance Antigen-Specific T Cell Functions
    Article Snippet: Paragraph title: Generation of WT and variant TCR constructs used for in vitro RNA-screening assays ... The PCR products were generated using 1 U/50 μ l of Phusion high-fidelity DNA polymerase (New England Biolabs) 0.5 μ M primers, and 0.5 μ M dNTPs by incubation at 98°C for 30 s, followed by 35 amplification cycles of 98°C for 20 s, 58°C for 20 s, and 72°C for 20 s and sequences as previously described ( ).

    Homologous Recombination:

    Article Title: Arginine mutations in antibody complementarity-determining regions display context-dependent affinity/specificity trade-offs
    Article Snippet: The gene block was amplified (Phusion High-Fidelity DNA polymerase, M0530L, New England Biolabs) with terminal primers that were complementary to the gene block. .. Next, the PCR-amplified fragment was ligated into the yeast display plasmid (after the original plasmid was digested with NheI and XhoI) via homologous recombination.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs phusion master mix
    Phusion Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more master mix/product/New England Biolabs
    Average 90 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    phusion master mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    New England Biolabs phusion hf dna polymerase
    Phusion Hf Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hf dna polymerase/product/New England Biolabs
    Average 90 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    phusion hf dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results