phusion dna polymerse  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher phusion dna polymerse
    Phusion Dna Polymerse, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion dna polymerse/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerse - by Bioz Stars, 2020-04
    86/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The Nde1 and Xho1 restriction sites then used for the direct cloning of the insert into the pET24 (Novagen) plasmid, with the addition of a C-terminal 6-His tag.

    Amplification:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The Nde1 and Xho1 restriction sites then used for the direct cloning of the insert into the pET24 (Novagen) plasmid, with the addition of a C-terminal 6-His tag.

    Isolation:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: In this study the coding sequence of AtHOL1 ( gene At2g43910; accession ) was isolated from the cDNA, of a mixture of Arabidopsis plants and cultures, by PCR amplification. .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min.

    Size-exclusion Chromatography:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The plasmid was transformed into Rosetta II (DE3) cells, over expressed O/N at 20°C, and was purified using Ni-Sepharose affinity beads and size exclusion chromatography.

    Purification:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The plasmid was transformed into Rosetta II (DE3) cells, over expressed O/N at 20°C, and was purified using Ni-Sepharose affinity beads and size exclusion chromatography.

    Polymerase Chain Reaction:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: The oligonucleotides HOL1F 5′ GCGCGC CATATG GCTGAAGAACAACAAAACTC 3′ and HOL1R PCR 5′ GCGCGCC TCGAG ATTGATCTTCTTCCACCTTCCC 3′ were used as the forward and reverse primers respectively containing the Nde1 and Xho1 restiction sites (underlined). .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min.

    Activity Assay:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Examples of the halo/thiocyanate methyltransferases plant enzymes have been isolated and studied from Batis maritima , Brassica oleracea , and Arabidopsis thaliana ., Collectively they have been termed halide methyltransferases (HMT), or halide/thiocyanate methyltransferases (HTMT), on the basis of their activity with halides alone, or additionally with thiol substrates such as bisulfide or thiocyanate a phylogenetic analysis using the A. thaliana structural gene (AtHOL1) suggests a wide distribution of these enzymes amongst the plant kingdom, with two other homologs within the A. thaliana genome itself (AtHOL2, and AtHOL3). .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min.

    Sequencing:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: In this study the coding sequence of AtHOL1 ( gene At2g43910; accession ) was isolated from the cDNA, of a mixture of Arabidopsis plants and cultures, by PCR amplification. .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min.

    Transformation Assay:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The plasmid was transformed into Rosetta II (DE3) cells, over expressed O/N at 20°C, and was purified using Ni-Sepharose affinity beads and size exclusion chromatography.

    Plasmid Preparation:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min. .. The Nde1 and Xho1 restriction sites then used for the direct cloning of the insert into the pET24 (Novagen) plasmid, with the addition of a C-terminal 6-His tag.

    HMT Assay:

    Article Title: Halomethane production in plants: Structure of the biosynthetic SAM-dependent halide methyltransferase from Arabidopsis thaliana
    Article Snippet: Examples of the halo/thiocyanate methyltransferases plant enzymes have been isolated and studied from Batis maritima , Brassica oleracea , and Arabidopsis thaliana ., Collectively they have been termed halide methyltransferases (HMT), or halide/thiocyanate methyltransferases (HTMT), on the basis of their activity with halides alone, or additionally with thiol substrates such as bisulfide or thiocyanate a phylogenetic analysis using the A. thaliana structural gene (AtHOL1) suggests a wide distribution of these enzymes amongst the plant kingdom, with two other homologs within the A. thaliana genome itself (AtHOL2, and AtHOL3). .. Amplification was performed through 25 cycles using Phusion DNA polymerse (Finnzymes), with cycling parameters of 98°C for 15min, 60°C for 15min and 72°C for 30min.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher phusion hot start ii high fidelity dna polymerase
    Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with <t>Phusion</t> Hot Start II High-Fidelity <t>DNA</t> Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.
    Phusion Hot Start Ii High Fidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hot start ii high fidelity dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 82 article reviews
    Price from $9.99 to $1999.99
    phusion hot start ii high fidelity dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher mutagenesis pcr
    Expression of poplar root TPS genes and emission of major TPS products. Expression of TPS genes was analyzed using <t>qRT-PCR.</t> TPS expression and emission of monoterpenes are displayed for M. melolontha -damaged (herb) and undamaged (ctr) roots from P. trichocarpa and P. nigra . Means ± SE are shown (n = 8). Asterisks indicate statistical significance in Student’s t-tests or from Mann-Whitney Rank Sum Tests. PtTPS13 ( P ≤ 0.001, T = 36.00); PtTPS21 ( P = 0.209, T = 42.00); <t>PtTPS16</t> ( P = 0.195, T = 55.00); PnTPS4 ( P ≤ 0.001, T = 36.00); PnTPS1 ( P ≤ 0.001, T = 36.00); P. trichocarpa : 1.8-cineole ( P = 0.048, t = 2.168); camphene ( P = 0.061, t = −2.042); p -cymene ( P = 0.458, t = −0.764); P. nigra : 1.8-cineole ( P = 0.578, t = −0.570); camphene ( P ≤ 0.001, T = 37.00).
    Mutagenesis Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutagenesis pcr/product/Thermo Fisher
    Average 95 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    mutagenesis pcr - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    99
    Thermo Fisher phusion dna polymerase
    ( A ) Template hybridization, extension, and denaturation on the flowcell surface. Templates are prepared so as to possess tails that are complementary to primers on the flowcell surface. This allows one end of a template strand to hybridize to a flowcell primer. Flowcell primers are extended by <t>Phusion</t> <t>DNA</t> polymerase (Thermo Scientific), resulting in a reverse complementary copy of the original template strand, which is covalently attached to the flowcell surface. The original template strand is then removed by flushing 0.1 M NaOH though the flowcell. ( B ) Cluster amplification. The free end of the tethered reverse complementary copy of the original template strand can anneal to the other type of flowcell primer, forming a bridge. The flowcell primer is extended by Bst polymerase, in an isothermal reaction, which generates a double-stranded product. Formamide is used to denature these strands, which can then anneal to other primers on the flowcell surface, which extend in the next cycle. In this way, repeated cycles of extension and denaturation result in a cluster of strands, all of which are derived from a single template strand.
    Phusion Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 320 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 320 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Journal: Scientific Reports

    Article Title: The impact of storage buffer, DNA extraction method, and polymerase on microbial analysis

    doi: 10.1038/s41598-018-24573-y

    Figure Lengend Snippet: Clustering of samples amplified with two different polymerases on a non-metric multidimensional scaling (NMDS) plot of the Bray-Curtis dissimilarities. Points are colored by applied extraction kit. The encircled pairs correspond to a single sample where each data point represents one 16 S rRNA amplification with Phusion Hot Start II High-Fidelity DNA Polymerase and the another with Platinum SuperFi DNA Polymerase. Sample pairs labeled with * were stored in PBS.

    Article Snippet: Platinum SuperFi DNA Polymerase (Thermo Fisher Scientific) and the Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) were both tested for amplification.

    Techniques: Amplification, Labeling

    Identification of the exponential phase during PCR amplification of barcode sequences. A. Schematic of the strategy used to identify the transition point from exponential to linear PCR amplification. gDNA isolated from HEK293T cells transduced with the pooled shRNA library were amplified in replicate PCR reactions. A replicate reaction was stopped at each cycle from 15 to 27 cycles. Subsequently, PCR products were used as templates for SYBR qPCR reactions using nested primers targeting a common sequence (outside of the barcode region) to examine the ΔC q between cycles. B. Difference of C q obtained in the qPCR on diluted amplicons from every cycle of the Phusion HS II polymerase PCR reaction (C qN+1 −C qN ) as a function of the Phusion PCR cycle number (N). C. Gel analysis of the PCR product generated from amplification cycles 22 to 25. Sizes of DNA bands in DNA marker (lane M) are indicated on the left.

    Journal: PLoS ONE

    Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens

    doi: 10.1371/journal.pone.0042341

    Figure Lengend Snippet: Identification of the exponential phase during PCR amplification of barcode sequences. A. Schematic of the strategy used to identify the transition point from exponential to linear PCR amplification. gDNA isolated from HEK293T cells transduced with the pooled shRNA library were amplified in replicate PCR reactions. A replicate reaction was stopped at each cycle from 15 to 27 cycles. Subsequently, PCR products were used as templates for SYBR qPCR reactions using nested primers targeting a common sequence (outside of the barcode region) to examine the ΔC q between cycles. B. Difference of C q obtained in the qPCR on diluted amplicons from every cycle of the Phusion HS II polymerase PCR reaction (C qN+1 −C qN ) as a function of the Phusion PCR cycle number (N). C. Gel analysis of the PCR product generated from amplification cycles 22 to 25. Sizes of DNA bands in DNA marker (lane M) are indicated on the left.

    Article Snippet: For the cell viability screen in HEK293T cells, amplification of the barcode region for microarray analysis was performed using Phusion® Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific, Vantaa, Finland) and Decode negative selection primers.

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Transduction, shRNA, Real-time Polymerase Chain Reaction, Sequencing, Generated, Marker

    Expression of poplar root TPS genes and emission of major TPS products. Expression of TPS genes was analyzed using qRT-PCR. TPS expression and emission of monoterpenes are displayed for M. melolontha -damaged (herb) and undamaged (ctr) roots from P. trichocarpa and P. nigra . Means ± SE are shown (n = 8). Asterisks indicate statistical significance in Student’s t-tests or from Mann-Whitney Rank Sum Tests. PtTPS13 ( P ≤ 0.001, T = 36.00); PtTPS21 ( P = 0.209, T = 42.00); PtTPS16 ( P = 0.195, T = 55.00); PnTPS4 ( P ≤ 0.001, T = 36.00); PnTPS1 ( P ≤ 0.001, T = 36.00); P. trichocarpa : 1.8-cineole ( P = 0.048, t = 2.168); camphene ( P = 0.061, t = −2.042); p -cymene ( P = 0.458, t = −0.764); P. nigra : 1.8-cineole ( P = 0.578, t = −0.570); camphene ( P ≤ 0.001, T = 37.00).

    Journal: Scientific Reports

    Article Title: The occurrence and formation of monoterpenes in herbivore-damaged poplar roots

    doi: 10.1038/s41598-018-36302-6

    Figure Lengend Snippet: Expression of poplar root TPS genes and emission of major TPS products. Expression of TPS genes was analyzed using qRT-PCR. TPS expression and emission of monoterpenes are displayed for M. melolontha -damaged (herb) and undamaged (ctr) roots from P. trichocarpa and P. nigra . Means ± SE are shown (n = 8). Asterisks indicate statistical significance in Student’s t-tests or from Mann-Whitney Rank Sum Tests. PtTPS13 ( P ≤ 0.001, T = 36.00); PtTPS21 ( P = 0.209, T = 42.00); PtTPS16 ( P = 0.195, T = 55.00); PnTPS4 ( P ≤ 0.001, T = 36.00); PnTPS1 ( P ≤ 0.001, T = 36.00); P. trichocarpa : 1.8-cineole ( P = 0.048, t = 2.168); camphene ( P = 0.061, t = −2.042); p -cymene ( P = 0.458, t = −0.764); P. nigra : 1.8-cineole ( P = 0.578, t = −0.570); camphene ( P ≤ 0.001, T = 37.00).

    Article Snippet: In vitro mutagenesis For site-directed mutagenesis, 100 ng pET100/D-TOPO® vector containing the N-terminal truncated ORF of PtTPS16 was used as template in a mutagenesis PCR (18 cycles, Phusion® High-Fidelity DNA Polymerase (ThermoFisher Scientific), according to manufacturer’s instructions.

    Techniques: Expressing, Quantitative RT-PCR, MANN-WHITNEY

    ( A ) Template hybridization, extension, and denaturation on the flowcell surface. Templates are prepared so as to possess tails that are complementary to primers on the flowcell surface. This allows one end of a template strand to hybridize to a flowcell primer. Flowcell primers are extended by Phusion DNA polymerase (Thermo Scientific), resulting in a reverse complementary copy of the original template strand, which is covalently attached to the flowcell surface. The original template strand is then removed by flushing 0.1 M NaOH though the flowcell. ( B ) Cluster amplification. The free end of the tethered reverse complementary copy of the original template strand can anneal to the other type of flowcell primer, forming a bridge. The flowcell primer is extended by Bst polymerase, in an isothermal reaction, which generates a double-stranded product. Formamide is used to denature these strands, which can then anneal to other primers on the flowcell surface, which extend in the next cycle. In this way, repeated cycles of extension and denaturation result in a cluster of strands, all of which are derived from a single template strand.

    Journal: Current protocols in human genetics / editorial board, Jonathan L. Haines ... [et al.]

    Article Title: Improved Protocols for Illumina Sequencing

    doi: 10.1002/0471142905.hg1802s62

    Figure Lengend Snippet: ( A ) Template hybridization, extension, and denaturation on the flowcell surface. Templates are prepared so as to possess tails that are complementary to primers on the flowcell surface. This allows one end of a template strand to hybridize to a flowcell primer. Flowcell primers are extended by Phusion DNA polymerase (Thermo Scientific), resulting in a reverse complementary copy of the original template strand, which is covalently attached to the flowcell surface. The original template strand is then removed by flushing 0.1 M NaOH though the flowcell. ( B ) Cluster amplification. The free end of the tethered reverse complementary copy of the original template strand can anneal to the other type of flowcell primer, forming a bridge. The flowcell primer is extended by Bst polymerase, in an isothermal reaction, which generates a double-stranded product. Formamide is used to denature these strands, which can then anneal to other primers on the flowcell surface, which extend in the next cycle. In this way, repeated cycles of extension and denaturation result in a cluster of strands, all of which are derived from a single template strand.

    Article Snippet: Flowcell primers are extended, by Phusion DNA polymerase (Thermo Scientific), generating a reverse complementary copy of the original template strand that is tethered to the flowcell surface.

    Techniques: Hybridization, Amplification, Derivative Assay