phusion dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion High Fidelity DNA Polymerase
    Description:
    Phusion High Fidelity DNA Polymerase 500 units
    Catalog Number:
    M0530L
    Price:
    437
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs phusion dna polymerase
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/phusion dna polymerase/product/New England Biolabs
    Average 99 stars, based on 825 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete"

    Article Title: Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057792

    Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.
    Figure Legend Snippet: Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Techniques Used: Polymerase Chain Reaction, Amplification, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Molecular Weight, Marker, Sequencing, Generated, Clone Assay, In Vitro

    Affect of mutations in the 17 bp direct repeats on precise excision of the vlsE variable region. A) DNA sequences of the wild-type 17 bp direct repeat (DR) and a mutant 17 bp direct repeat (DR*) used in this study. Mutated bases are highlighted in red. B) Schematic showing the plasmid templates carrying wild-type DRs and a mutant DR at the left, right or both sides of the variable region. C ) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using the templates shown in Panel B with the indicated primers. Gel electrophoresis conditions were as noted in Fig. 2 .
    Figure Legend Snippet: Affect of mutations in the 17 bp direct repeats on precise excision of the vlsE variable region. A) DNA sequences of the wild-type 17 bp direct repeat (DR) and a mutant 17 bp direct repeat (DR*) used in this study. Mutated bases are highlighted in red. B) Schematic showing the plasmid templates carrying wild-type DRs and a mutant DR at the left, right or both sides of the variable region. C ) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using the templates shown in Panel B with the indicated primers. Gel electrophoresis conditions were as noted in Fig. 2 .

    Techniques Used: Mutagenesis, Plasmid Preparation, Staining, Agarose Gel Electrophoresis, Amplification, Nucleic Acid Electrophoresis

    2) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates "

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    3) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates "

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    4) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates"

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    5) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates "

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    6) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates "

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    7) Product Images from "Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses"

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0138650

    A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.
    Figure Legend Snippet: A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control, Sequencing

    8) Product Images from "Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease"

    Article Title: Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0181998

    RT-PCR amplification of five cassava eIF4E ORFs with gene-specific primers. Total RNA was extracted from TMS60444 cassava line. The first-strand cDNA was synthesized using SuperScript ™ III Reverse Transcriptase (Invitrogen) and PCR was performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and primers indicated in Table 1 . Lane 1: DNA marker; Lane 2: 016601 CDS amplified with primers 016601F and 016601R; Lane 3: 016620 CDS amplified with primers 016620F and 016620R; Lane 4: 015501 CDS amplified with 015501F and 015501R, Lane 5: 013223 CDS amplified with primers 013223lF and 013223R, Lane 6, 013223 CDS amplified with primers 013223sF and 013223R; Lane 7: 013732 CDS amplified with 013732lF and 013732R; Lane 8: 013732 CDS amplified with 013732sF and 013732R; and Lane 9: negative water control.
    Figure Legend Snippet: RT-PCR amplification of five cassava eIF4E ORFs with gene-specific primers. Total RNA was extracted from TMS60444 cassava line. The first-strand cDNA was synthesized using SuperScript ™ III Reverse Transcriptase (Invitrogen) and PCR was performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and primers indicated in Table 1 . Lane 1: DNA marker; Lane 2: 016601 CDS amplified with primers 016601F and 016601R; Lane 3: 016620 CDS amplified with primers 016620F and 016620R; Lane 4: 015501 CDS amplified with 015501F and 015501R, Lane 5: 013223 CDS amplified with primers 013223lF and 013223R, Lane 6, 013223 CDS amplified with primers 013223sF and 013223R; Lane 7: 013732 CDS amplified with 013732lF and 013732R; Lane 8: 013732 CDS amplified with 013732sF and 013732R; and Lane 9: negative water control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Synthesized, Polymerase Chain Reaction, Marker

    9) Product Images from "Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses"

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0138650

    A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.
    Figure Legend Snippet: A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control, Sequencing

    10) Product Images from "Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B"

    Article Title: Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.3344

    Deep-deamination approach to determine an optimal human A3A substrate A ssDNA library with a single target C and N’s on the 5′ and 3′ sides was reacted with human A3A (near-single hit kinetics). The resulting pool containing C-to-U deamination products was annealed to a bar-coded Illumina adaptor (IA) and T4 DNA polymerase was used to produce a complementary DNA strand. This intermediate was denatured, annealed to a 5′-IA, and converted to duplex by Phusion thermostable high fidelity DNA polymerase. Illumina Mi-Seq was used to generate reads for subsequent informatics analysis. A weblogo representation of deamination products unique to A3A shows enrichment for −1 T and +1 G that informed the ssDNA sequence for co-crystallization experiments (n=641; error bars are twice the sample correction value). Source data are provided as a spreadsheet (.xlsx) linked to the online legend.
    Figure Legend Snippet: Deep-deamination approach to determine an optimal human A3A substrate A ssDNA library with a single target C and N’s on the 5′ and 3′ sides was reacted with human A3A (near-single hit kinetics). The resulting pool containing C-to-U deamination products was annealed to a bar-coded Illumina adaptor (IA) and T4 DNA polymerase was used to produce a complementary DNA strand. This intermediate was denatured, annealed to a 5′-IA, and converted to duplex by Phusion thermostable high fidelity DNA polymerase. Illumina Mi-Seq was used to generate reads for subsequent informatics analysis. A weblogo representation of deamination products unique to A3A shows enrichment for −1 T and +1 G that informed the ssDNA sequence for co-crystallization experiments (n=641; error bars are twice the sample correction value). Source data are provided as a spreadsheet (.xlsx) linked to the online legend.

    Techniques Used: IA, Sequencing, Crystallization Assay

    11) Product Images from "Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses"

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0138650

    A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.
    Figure Legend Snippet: A: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Phusion DNA polymerase, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: 1 kb DNA Ladder, 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). B: Simultaneous RT-PCR amplification of the eight segments of A/California/07/2009 (H1N1) vaccine viruses using Thermo Scientist Extensor Mix, 1: 1 kb DNA Ladder, 2: X-181-M1, 3: X-179A-M1, 4: X-181-M2, 5: X-179A-M2, 6: X-181-M3, 7: X-179A-M4, 8: Negative control (H 2 O), 9: 1 kb DNA Ladder, 10: 121XP-M4, 11: X-181-M4, 12: X-179A-M3, 13: X-179A-M5, 14: X-179A, 15: X-181, 16: Negative control (H 2 O). C: The distribution amount of sequencing reads between the eight segments of influenza virus using different approaches of library preparation followed by Illumina HiSeq sequencing.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control, Sequencing

    12) Product Images from "A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders"

    Article Title: A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders

    Journal:

    doi: 10.1016/j.jmoldx.2016.06.001

    The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.
    Figure Legend Snippet: The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.

    Techniques Used: Amplification, Mutagenesis, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Marker, Produced

    13) Product Images from "FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method"

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-92

    Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.
    Figure Legend Snippet: Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Transformation Assay, Negative Control, Construct

    14) Product Images from "FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method"

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-92

    Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.
    Figure Legend Snippet: Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Transformation Assay, Negative Control, Construct

    15) Product Images from "A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders"

    Article Title: A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders

    Journal:

    doi: 10.1016/j.jmoldx.2016.06.001

    The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.
    Figure Legend Snippet: The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.

    Techniques Used: Amplification, Mutagenesis, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Marker, Produced

    16) Product Images from "A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders"

    Article Title: A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders

    Journal:

    doi: 10.1016/j.jmoldx.2016.06.001

    The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.
    Figure Legend Snippet: The use of HiFi DNA polymerase and Phusion DNA polymerase in the amplification of normal (N), gray zone (GZ), premutation (PM), and full mutation (FM) alleles. Repeat amplification was performed on various samples using the protocol described in and either HiFi DNA polymerase or Phusion DNA polymerase. A: The products of the PCRs resolved by electrophoresis on a 1% agarose gel. Water (lane 1), DNA from a normal embryonic stem cell line (H1) (lane 2), from SC120, a PM induced pluripotent stem cell (iPSC) line (lane 3), from SC128, a FM iPSC line (lane 4), and from two FM cell lines, GM04025 (lane 5) and GM09237 (lane 6). The molecular weight marker (MW) was a 1-kb ladder. The asterisks indicate the repeat numbers corresponding to the amplified alleles. B: The electropheretograms produced on capillary electrophoresis for SC128 and GM09237 together with the LIZ1200 molecular weight marker. C: The results obtained for the amplification of DNA from a female (F) carrier of two normal alleles (30 repeats each), a male (M) carrier of a gray zone allele (GZ; 51 repeats), and their daughter who carries a normal allele and the paternal gray zone allele. Electrophoresis was performed on a 2% agarose gel.

    Techniques Used: Amplification, Mutagenesis, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Marker, Produced

    17) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates "

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates

    Journal:

    doi: 10.1128/JCM.02340-10

    Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then
    Figure Legend Snippet: Genome replication, virion secretion, and protein expression of PCR clones derived from two thermophilic DNA polymerases. The 4B genome was amplified by 30 cycles of PCR using either High Fidelity plus DNA polymerase or Phusion DNA polymerase and then

    Techniques Used: Expressing, Polymerase Chain Reaction, Clone Assay, Derivative Assay, Amplification

    18) Product Images from "Cellular reagents for diagnostics and synthetic biology"

    Article Title: Cellular reagents for diagnostics and synthetic biology

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0201681

    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.
    Figure Legend Snippet: PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Techniques Used: Polymerase Chain Reaction, Expressing, Incubation, Construct, Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Purification, Clone Assay

    19) Product Images from "Restriction enzyme-free mutagenesis via the light regulation of DNA polymerization"

    Article Title: Restriction enzyme-free mutagenesis via the light regulation of DNA polymerization

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp150

    Effects of a caged thymidine nucleobase on the PCR. ( A ) PCR product using Phusion DNA Polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product. ( B ) PCR product using Taq DNA polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product.
    Figure Legend Snippet: Effects of a caged thymidine nucleobase on the PCR. ( A ) PCR product using Phusion DNA Polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product. ( B ) PCR product using Taq DNA polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product.

    Techniques Used: Polymerase Chain Reaction

    20) Product Images from "Restriction enzyme-free mutagenesis via the light regulation of DNA polymerization"

    Article Title: Restriction enzyme-free mutagenesis via the light regulation of DNA polymerization

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp150

    Effects of a caged thymidine nucleobase on the PCR. ( A ) PCR product using Phusion DNA Polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product. ( B ) PCR product using Taq DNA polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product.
    Figure Legend Snippet: Effects of a caged thymidine nucleobase on the PCR. ( A ) PCR product using Phusion DNA Polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product. ( B ) PCR product using Taq DNA polymerase. Polymerization is halted in the presence of a caging group, which is confirmed using the truncated primer P3 that affords the same length product.

    Techniques Used: Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ).

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: The discovery of ZUFSP as a K63-DUB, making DNA-mediated interactions with RPA and SSBP1, will be instrumental for addressing these important questions. .. ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. For protein purification, all constructs were cloned in the pOPIN-S vector using the In-Fusion® HD cloning system (Takara Clontech).

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. PCR products were purified with a PCR purification kit (Qiagen, Germany).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Amplification:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ).

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. In vitro run-off transcription was performed with T7 RNA polymerase at 37°C for 1 to 3 h in reaction mixtures ranging from 50 μl to 5 ml and consisting of 30 mM Na-HEPES pH 8.0, 27 mM MgCl2 , 4 mM NTP mix, 10 mM TCEP, 2 mM spermidine and 0.01% Triton X-100.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: This promoter construct was extended by 2 kb by amplification (5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′) of a more distal 5′ promoter region and cloned into the pGL3 KpnI site and Creb3l1 promoter KpnI cut site. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1. .. The primers used were FLC_F (5′GAGTACGGCTAGGCAATAGC3′) and FLC_RW (5′GGCAAGTAGCTATATCTGTAAC3′) whereby FLC stands for “full‐length cDNA”.

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Briefly, PP were harvested and kept in RNAlater (Sigma‐Aldrich) until processing. .. PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Phusion High‐Fidelity DNA Polymerase (New England Biolabs). .. IgA amplicons were cloned using TOPO TA Cloning Kit for Sequencing (Invitrogen), and DNA sequencing was performed by Eurofins MWG Operon (Germany).

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: The FLIP cassette including selection marker gene was then transferred to the vector pUC118 (3318, Clontech) using the restriction enzymes SacI (R0156S, NEB) and PstI (R0140S, NEB) and Mighty cloning (6027, Takara). .. Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB). .. After PCR product purification, both homologous arms and FLIP cassette-containing vector were mixed with the type II restriction enzyme SapI and T4 DNA ligase (M0202T, NEB).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions. .. PCR products were gel purified (28706, Qiagen) and sgRNAs were transcribed using T7 MegaShortScript transcription kits (AM1354, Ambion) and purified using RNeasy Mini kits (74104, Qiagen) according to the manufacturers’ instructions. sgRNA quality was checked by running on a 2% agarose gel, quantified using a Nanodrop spectrophotometer and stored in aliquots at -80°C.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Primer pairs were used to systematically truncate one or more domains either from the N-terminus or C-terminus with the resultant nomenclature being TGMΔ1 = TGM with domain 1 truncated; TGM Δ1,2 = TGM with domains 1 and 2 truncated, etc. .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold. .. PCRs were electrophoresed through a 1.2% agarose gel and a single band of each predicted size of insert was gel extracted, cloned into a pSECTag2A vector (Invitrogen) and transformed into JM109 bacterial cells, selecting with Ampicillin (100 µg/ml).

    Stable Transfection:

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies).

    Synthesized:

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: Template DNA for Homo sapiens mitochondrial pre-tRNA substrates were synthesized (Integrated DNA Technologies). .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Construct:

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: A series of smaller rat Creb3l1 luciferase reporter constructs were made by restriction enzyme digestion (BamHI, BstEII, SacI, StuI) at sites present in the Creb3l1 promoter, blunted (with exception of StuI) with T4 DNA polymerase and excised from pGL3 with XhoI. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool (crispr.mit.edu) to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV1 mutants lacking VP1 genes or portions thereof were constructed via LIPCR using EAI283 as template ( ). .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: Paragraph title: Constructs and cloning ... ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Concentration Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ). .. The 185 bp PCR product was purified by gel extraction (Thermo Scientific GeneJET Gel Extraction kit) and eluted using elution buffer.

    Real-time Polymerase Chain Reaction:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Paragraph title: Hyphochytrium catenoides genome qPCR size estimation ... Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Luciferase:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Paragraph title: Luciferase Assay ... Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Expressing:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Paragraph title: Heterologous expression in Pichia pastoris ... The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Transformation Assay:

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB). .. After PCR product purification, both homologous arms and FLIP cassette-containing vector were mixed with the type II restriction enzyme SapI and T4 DNA ligase (M0202T, NEB).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. Alternatively for co-expression and purification of two mutants of LpxB, lpxB genes were inserted into pRSF-Duet-1 (Novagen) at the EcoRI (TaKaRa) and HindIII (NEB) sites of MCS1 and at the NdeI (NEB) and KpnI (NEB) sites of MCS2, thus encoding one N-terminally His-tagged protein and one untagged protein.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ).

    Over Expression:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Transfection:

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold. .. PCRs were electrophoresed through a 1.2% agarose gel and a single band of each predicted size of insert was gel extracted, cloned into a pSECTag2A vector (Invitrogen) and transformed into JM109 bacterial cells, selecting with Ampicillin (100 µg/ml).

    DNA Ligation:

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. The complementary DNA products from second-round PCRs were annealed without purification (see Supplementary Table for annealing conditions).

    Southern Blot:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Segregants of the T1 generation negative in PCR were propagated to T2 and checked by Southern blot analysis. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Ligation:

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Paragraph title: PCR and ligation ... Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Cell Culture:

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Hemagglutination Assay:

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Generated:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The first round of PCRs were performed using primers (-NBRE2 set 1 5′-TGCAAGCAAACAAGGCAGGTTTACTTTGGGCCCACCACCACCCGGGGCCTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-CCCAAAGTAAACCTGCCTTGTTTGCTTGCA-3′; -NBRE3 5′-TGCATCCCAGCAAGAGCCTCACTCTTCGCCCAGGTCCCGGACAGACAGAGG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-GGCGAAGAGTGAGGCTCTTGCTGGGATGCA-3′).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool (crispr.mit.edu) to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. For protein purification, all constructs were cloned in the pOPIN-S vector using the In-Fusion® HD cloning system (Takara Clontech).

    DNA Sequencing:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Sequencing:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Paragraph title: IgA sequencing and faecal Ig detection ... PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Phusion High‐Fidelity DNA Polymerase (New England Biolabs).

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The bait plasmid pSST91 contains the LexA protein coding sequence under the control of the yeast ADH1 promoter. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Injection:

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions. .. Cas9 mRNA was purified by lithium chloride precipitation and stored in aliquots at -80°C.

    Recombinant:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Cellular Antioxidant Activity Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. Barcodes were introduced by a second PCR with platform-specific barcode-bearing primers.

    Imaging:

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    DNA Extraction:

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: The supernatant was removed and genomic DNA was extracted from the remaining cells using a PowerSoil DNA isolation kit (MO BIO Laboratories). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Molecular Cloning:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: Paragraph title: Molecular cloning of ggTLR21 cDNA ... A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer.

    In Vivo:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Methylation:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The site-directed deletions (-NBRE2 and -NBRE3) were ligated into Kpn1 digested 4.9 kb Creb3l1 promoter pGL3 construct.

    Mutagenesis:

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Isolation:

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Purification:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: Total RNAs were purified from grouper splenocytes using TRIzol, and first-strand cDNA libraries were then prepared using the SuperScript® III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA), as previously described . .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: The DR274 plasmid (a gift from Keith Young – Addgene plasmid #42250) was linearised by BsaI (R0535, NEB) digestion according to manufacturer’s instructions and gel purified (28706, Qiagen). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ). .. The 185 bp PCR product was purified by gel extraction (Thermo Scientific GeneJET Gel Extraction kit) and eluted using elution buffer.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Polymerase Chain Reaction:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ).

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. In vitro run-off transcription was performed with T7 RNA polymerase at 37°C for 1 to 3 h in reaction mixtures ranging from 50 μl to 5 ml and consisting of 30 mM Na-HEPES pH 8.0, 27 mM MgCl2 , 4 mM NTP mix, 10 mM TCEP, 2 mM spermidine and 0.01% Triton X-100.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. Products were purified using the AMPure purification kit (Agencourt, Beverly, MA, United States) and after beads purification, the targeted band was checked on a 1.8% agarose gel.

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The first round of PCRs were performed using primers (-NBRE2 set 1 5′-TGCAAGCAAACAAGGCAGGTTTACTTTGGGCCCACCACCACCCGGGGCCTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-CCCAAAGTAAACCTGCCTTGTTTGCTTGCA-3′; -NBRE3 5′-TGCATCCCAGCAAGAGCCTCACTCTTCGCCCAGGTCCCGGACAGACAGAGG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-GGCGAAGAGTGAGGCTCTTGCTGGGATGCA-3′).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1. .. The primers used were FLC_F (5′GAGTACGGCTAGGCAATAGC3′) and FLC_RW (5′GGCAAGTAGCTATATCTGTAAC3′) whereby FLC stands for “full‐length cDNA”.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: The primer sequences used in this study were listed in Supplementary Table . .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. The PCR conditions are listed in Supplementary Table and Supplementary Table .

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: DNA restriction enzymes were used as recommended by the manufacturer (New England Biolabs, NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. The gene-specific primers are listed in .

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    CRISPR:

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    cDNA Library Assay:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ).

    Activated Clotting Time Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Plasmid Preparation:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: For luciferase assays, Creb3l1 promoter fragments were cloned into luciferase reporter construct pGL3 basic vector (Promega, Madison, WI, USA). .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Southern blot was performed by digesting 10 μg of genomic DNA with EcoR I and using a 32 P‐labelled probe covering the HPT gene of the p6U vector as described previously (Risk et al ., ). .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: Paragraph title: Addition of homologous arms to the FLIP cassette – FLIP targeting vector generation ... Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    RNA Extraction:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: Paragraph title: RNA Extraction and 16S rRNA Library Preparation ... The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Agarose Gel Electrophoresis:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    In Vitro:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The site-directed deletions (-NBRE2 and -NBRE3) were ligated into Kpn1 digested 4.9 kb Creb3l1 promoter pGL3 construct.

    Transgenic Assay:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Paragraph title: Detection of transgenic barley and determination of transgene copy number and full‐length cDNA amplification ... The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Spectrophotometry:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Produced:

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: The tRNA constructs were either directly produced by run-off transcription or were joined 5′ of the GlmS ribozyme. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Activation Assay:

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Alkaline Lysis:

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Marker:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Total genomic DNA was extracted from leaves using the CTAB method (Stein et al ., ), and presence of Ta ‐Lr34res was assessed using the marker csffr1 (Lagudah et al ., ). .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Gel Extraction:

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Homologous Recombination:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs phusion high fidelity dna polymerase phusion
    Proofreading <t>DNA</t> polymerases can be inhibited by certain primers. ( A ) Example of inhibitory primer using PSGXL. A slightly longer target DNA fragment can be successfully amplified by the primers OuterR and Stat3F, but use Stat3R instead of OuterR caused PCR failure. ( B ) Primers Stat3R and GfapR are inhibitory to PSGXL and PS, but not to LATaq and Taq. The 2 kb targets were amplified using primers Olig2F and Olig2R, additional primer Olig2.6F, Stat3R, GfapR were added to the reaction. ( C ) Primers Stat3R and GfapR are inhibitory to all the tested proofreading DNA polymerases. Primers pBSIIF and pBSIIR were used to amplify the entire plasmid pBlueScript II KS (−). Adding the additional primer Stat3R or GfapR substantially reduced the PCR yield using the proofreading DNA polymerases such as <t>Phusion,</t> Q5, Cobuddy, PS, PSGXL and PfuFly. Arrowheads indicate target DNA fragments.
    Phusion High Fidelity Dna Polymerase Phusion, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase phusion/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase phusion - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs high fidelity dna polymerase
    Specific and non-specific binding of <t>DNA</t> by <t>ParB:</t> a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).
    High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 875 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 875 article reviews
    Price from $9.99 to $1999.99
    high fidelity dna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier


    Image Search Results


    Proofreading DNA polymerases can be inhibited by certain primers. ( A ) Example of inhibitory primer using PSGXL. A slightly longer target DNA fragment can be successfully amplified by the primers OuterR and Stat3F, but use Stat3R instead of OuterR caused PCR failure. ( B ) Primers Stat3R and GfapR are inhibitory to PSGXL and PS, but not to LATaq and Taq. The 2 kb targets were amplified using primers Olig2F and Olig2R, additional primer Olig2.6F, Stat3R, GfapR were added to the reaction. ( C ) Primers Stat3R and GfapR are inhibitory to all the tested proofreading DNA polymerases. Primers pBSIIF and pBSIIR were used to amplify the entire plasmid pBlueScript II KS (−). Adding the additional primer Stat3R or GfapR substantially reduced the PCR yield using the proofreading DNA polymerases such as Phusion, Q5, Cobuddy, PS, PSGXL and PfuFly. Arrowheads indicate target DNA fragments.

    Journal: Scientific Reports

    Article Title: Guanine-rich sequences inhibit proofreading DNA polymerases

    doi: 10.1038/srep28769

    Figure Lengend Snippet: Proofreading DNA polymerases can be inhibited by certain primers. ( A ) Example of inhibitory primer using PSGXL. A slightly longer target DNA fragment can be successfully amplified by the primers OuterR and Stat3F, but use Stat3R instead of OuterR caused PCR failure. ( B ) Primers Stat3R and GfapR are inhibitory to PSGXL and PS, but not to LATaq and Taq. The 2 kb targets were amplified using primers Olig2F and Olig2R, additional primer Olig2.6F, Stat3R, GfapR were added to the reaction. ( C ) Primers Stat3R and GfapR are inhibitory to all the tested proofreading DNA polymerases. Primers pBSIIF and pBSIIR were used to amplify the entire plasmid pBlueScript II KS (−). Adding the additional primer Stat3R or GfapR substantially reduced the PCR yield using the proofreading DNA polymerases such as Phusion, Q5, Cobuddy, PS, PSGXL and PfuFly. Arrowheads indicate target DNA fragments.

    Article Snippet: Phusion® High-Fidelity DNA Polymerase (Phusion) and Q5® High-Fidelity DNA Polymerase (Q5) are from New England Biolabs.

    Techniques: Amplification, Polymerase Chain Reaction, Plasmid Preparation

    Engineered proofreading DNA polymerases have good performance. ( A ) Testing various DNA polymerases for the amplification of a 1 kb fragment with 70% GC-content. ( B ) Testing different DNA polymerases for the amplification of an 18 kb fragment from λ DNA. ( C ) Amplification of the ORF of insulin-like growth factor I receptor (Igf1r) from mouse cDNA. The 3′ untranslated region of Igf1r is longer than 7 kb. ( D ) Amplification of the entire LCas9 plasmid. The 10.9 kb LCas9 plasmid contains a high GC-rich region. Pfu: Pfu DNA polymerase. LATaq: LA Taq Version 2.0. TransHF: TransTaq DNA polymerase High Fidelity. Phusion: Phusion High-Fidelity DNA polymerase. Q5: Q5 High-Fidelity DNA polymerase. Cobuddy: Cobuddy Super Fidelity DNA polymerase. PSGXL: PrimeSTAR GXL DNA polymerase. PfuFly: TransStart FastPfu Fly DNA polymerase. Enh: 0–10 μl of GC enhancer was added into the 25 μl PCR reagent.

    Journal: Scientific Reports

    Article Title: Guanine-rich sequences inhibit proofreading DNA polymerases

    doi: 10.1038/srep28769

    Figure Lengend Snippet: Engineered proofreading DNA polymerases have good performance. ( A ) Testing various DNA polymerases for the amplification of a 1 kb fragment with 70% GC-content. ( B ) Testing different DNA polymerases for the amplification of an 18 kb fragment from λ DNA. ( C ) Amplification of the ORF of insulin-like growth factor I receptor (Igf1r) from mouse cDNA. The 3′ untranslated region of Igf1r is longer than 7 kb. ( D ) Amplification of the entire LCas9 plasmid. The 10.9 kb LCas9 plasmid contains a high GC-rich region. Pfu: Pfu DNA polymerase. LATaq: LA Taq Version 2.0. TransHF: TransTaq DNA polymerase High Fidelity. Phusion: Phusion High-Fidelity DNA polymerase. Q5: Q5 High-Fidelity DNA polymerase. Cobuddy: Cobuddy Super Fidelity DNA polymerase. PSGXL: PrimeSTAR GXL DNA polymerase. PfuFly: TransStart FastPfu Fly DNA polymerase. Enh: 0–10 μl of GC enhancer was added into the 25 μl PCR reagent.

    Article Snippet: Phusion® High-Fidelity DNA Polymerase (Phusion) and Q5® High-Fidelity DNA Polymerase (Q5) are from New England Biolabs.

    Techniques: Amplification, Gas Chromatography, Plasmid Preparation, Polymerase Chain Reaction

    Proofreading DNA polymerases but not Taq DNA polymerase bind to G-rich sequences. Biotin-labeled oligonucleotide Bio-G6 was subjected to electrophoresis mobility shift assay. Electrophoresis of the Bio-G6 alone showed 3 bands in the gel, as the 6 consecutive G in Bio-G6 tends to form intermolecular G-quadruplex. Taq didn’t cause any band shift. However, when the proofreading DNA polymerase Phusion or PSGXL was added, the bands corresponding to intermolecular G-quadruplex were retarded. The band shift caused by proofreading DNA polymerases were disappeared by adding excess amount of competitor G6 but not non-specific competitor MG. Note that the anti-PSGXL antibody also caused a weak supershift.

    Journal: Scientific Reports

    Article Title: Guanine-rich sequences inhibit proofreading DNA polymerases

    doi: 10.1038/srep28769

    Figure Lengend Snippet: Proofreading DNA polymerases but not Taq DNA polymerase bind to G-rich sequences. Biotin-labeled oligonucleotide Bio-G6 was subjected to electrophoresis mobility shift assay. Electrophoresis of the Bio-G6 alone showed 3 bands in the gel, as the 6 consecutive G in Bio-G6 tends to form intermolecular G-quadruplex. Taq didn’t cause any band shift. However, when the proofreading DNA polymerase Phusion or PSGXL was added, the bands corresponding to intermolecular G-quadruplex were retarded. The band shift caused by proofreading DNA polymerases were disappeared by adding excess amount of competitor G6 but not non-specific competitor MG. Note that the anti-PSGXL antibody also caused a weak supershift.

    Article Snippet: Phusion® High-Fidelity DNA Polymerase (Phusion) and Q5® High-Fidelity DNA Polymerase (Q5) are from New England Biolabs.

    Techniques: Labeling, Electrophoresis, Mobility Shift, Electrophoretic Mobility Shift Assay

    Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific and non-specific binding of DNA by ParB: a speculative model for spreading at parS sites. ( A ) A region of a DNA molecule containing a specific binding site is shown. ( B ) Specific binding. At low concentrations, ParB binds to parS sequences via the central helix-turn-helix motifs to form a ParB 2 :DNA complex (supporting data in Figures 1 , 3 and 4 ). ( C ) Non-specific DNA binding. Elevated concentrations of ParB allow co-operative non-specific binding via a second (hypothetical) DNA binding domain (supporting data in Figures 1 and 2 ). The continued self-association of ParB (indicated with arrows) via at least two interfaces subsequently leads to formation of higher order networks and DNA condensation. This transition is not dependent on the presence of parS . ( D ) The condensed nucleoprotein network (supporting data in Figures 5 – 8 ) may contain both specific and non-specific DNA binding sites (see main text for justification) that trap loops of DNA that are anchored around parS if the parS site is present. For simplicity, the specific binding sites for most of the ParB dimers are shown unoccupied. Such structures might bridge larger distances, including between distant parS loci, through the sharing of segments of DNA, or via additional protein:protein interactions (indicated with the faded nucleoprotein complex).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay

    Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of ParB to the parS sequence. Electrophoretic mobility shift assay of ParB binding to a radiolabelled 147-bp substrate in a magnesium acetate containing gel-running buffer. ( A ) Titration of ParB on DNA containing a single parS site in the centre. ( B ) ParB titration on an equivalent substrate that is lacking a parS site (see Supplementary Table S1 for details). The species assigned as specific and non-specific complexes are labelled. The lower panels show the quantification of the gels revealing a highly sigmoidal pattern for non-specific binding. These data were fit to Equation ( 1 ) to yield the values shown.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Titration

    Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Specific binding of parS to ParB protects the helix-turn-helix region from proteolysis. ParB (2-μM dimer) was progressively digested into a large and a small fragment by trypsin, with approximate weights of 26 and 15 kDa, respectively, as determined by a comparison to molecular weight markers. N-terminal sequencing of the excised bands revealed the N-terminal sequences of these fragments to be MAKX and KXIN, respectively. The N-terminus of the large fragment is M1, with the C-terminus lying within the linker region between the central and C-terminal domains of ParB. The N-terminus of the small fragment is K7, which lies within the Box I motif, and the C-terminus is within the helix-turn-helix motif (K132 or K143). The lower panel shows a cartoon representation of the primary structure indicating the major degradation products. In the presence of parS DNA (20 μM), the degradation of the large fragment to the small fragment (and therefore cleavage near the helix-turn-helix motif) is substantially reduced, whereas an equivalent non-specific DNA does not have this effect.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Molecular Weight, Sequencing

    Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: Condensation of DNA by ParB monitored by magnetic tweezers. ( A ) Experimental configuration used to measure condensation dynamics mediated by ParB proteins with magnetic tweezers. ( B ) Schematic representation of the parS DNA substrate. ( C ) Condensation assay. At 4-pN stretching force, 1-μM ParB 2 was injected in the fluid cell and incubated for 2 min. Following incubation, the force was reduced to 0.34 pN. In the absence of protein this leads to the change in extension represented in the grey trace. However, in the presence of ParB we observed a progressive decrease of the extension until reaching a final extension near the surface. Raw data were acquired at 60 Hz (red) and filtered down to 2.4 Hz (black).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Incubation

    The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The stoichiometry of the ParB– parS complex. ( A ) Binding of ParB 2 (9 μM) to 24-bp Hex-labelled DNA (10 μM) analysed by SEC-MALS. Only DNA-containing species were observed by monitoring the (normalized) absorbance at 535 nm. With a parS containing DNA substrate (solid line) the major complex has a calculated Mw of 81.6 ± 1.9 kDa, consistent with a single ParB dimer bound to DNA. A lower abundance species is also seen with a calculated Mw of 112.1 ± 3. In contrast, ParB is unable to bind a non-specific substrate (dotted line). In that case, the DNA is found in a late eluting peak, for which no weight could be assigned due to poor light scattering. ( B ) Native-mass spectrometry of ParB binding to a 100-bp substrate containing a single parS sequence predominantly showed a single dimer bound to the DNA, as well as free DNA. The peak assignments are indicated using cartoons on the graph. Binding of ParB to non-specific DNA was not observed.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Size-exclusion Chromatography, Mass Spectrometry, Sequencing

    The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: The ParB– parS complex does not recruit additional ParB molecules to neighbouring non-specific DNA. The binding of ParB to a 147-bp DNA labelled with Cy3 (Supplementary Table S1) results in an increase in fluorescence intensity. ( A ) Titration of ParB dimer on DNA containing a parS site in its centre. ( B ) Titration on an equivalent substrate that is lacking the parS site. These data were fit to Equation ( 1 ) to yield the values shown. The error bars represent the standard errors from three independent experiments.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Binding Assay, Fluorescence, Titration

    ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-dependent condensation of DNA is reversible. ( A ) Decondensation of DNA by force. Characteristic force-induced decondensation traces for parS substrates are characterized by multiple small steps and a gradual increase of extension. ( B ) Decondensation of DNA by parS competitor DNA. Following condensation by reduction of force, a 5-μM parS competitor DNA was injected into the flow cell resulting in a process of decondensation characterized by large discrete steps. Decondensation stopped at the extension expected for 0.34 pN applied force in the absence of protein (indicated by the grey dashed line). The lack of protein bound to DNA was checked by raising the force up to 4 pN and reduction down to 0 pN; no (de)condensation effects were observed. ( C ) Condensation force dependency on ParB concentration. A maximum condensation force of 2.1 pN was measured at saturating protein concentration for both parS and non-specific DNA substrates. Errors are the standard deviation of measurements on different molecules ( N ≥ 5 molecules). ( D ) Mean force-extension curve of DNA molecules in the presence of 1-μM ParB 2 (circles). The solid line is included as a guide for the eye. Data in squares are the control experiment in the absence of protein and the solid line is a fit to the worm-like chain model. Errors are the standard deviation of measurements on different molecules ( N ≥ 15 molecules).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection, Flow Cytometry, Concentration Assay, Protein Concentration, Standard Deviation

    ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB stabilizes crossovers and writhe formed by DNA braiding and bridging. ( A ) Cartoon of the experiment to braid DNA segments in trans . The application of one turn (clockwise or anti-clockwise) to doubly tethered beads promotes the cross-over of both DNAs, leading to a change of the extension (Δ z ). Subsequent untwisting to zero rotation immediately recovers the original extension. ( B ) Time trace of an experiment with two doubly tethered beads recorded simultaneously on bare DNA. ( C ) In the presence of ParB the cross-over is stabilized, and the extension does not recover after untwisting to zero rotation or even when one additional turn in the direction opposite to the cross-over is applied. ( D ) Injection of 5-μM parS DNA competitor oligonucleotide promotes the recovery of the full extension following ParB-mediated stabilization of a braid. ( E ) Cartoon of the experiment to bridge DNA segments in cis . Single torsionally constrained DNA molecules ( 1 ) are positively supercoiled at 4-pN force by applying 60 turns ( 2 ). Then, 1-μM ParB 2 is injected into the fluid cell ( 3 ). After full exchange of buffer, all of the turns are released ( 4 ). ( F ) DNA extension is displayed as a function of turns to highlight the hysteresis observed due to bridging of different regions of supercoiled DNA after introduction of ParB. The numbers indicate the different stages of the experiment as per the cartoon in part (E).

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques: Injection

    ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Journal: Nucleic Acids Research

    Article Title: Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    doi: 10.1093/nar/gku1295

    Figure Lengend Snippet: ParB-mediated DNA condensation parameters. ( A ) Mean condensation curves for parS (black) and non-specific (red) DNA substrates ( N > 20). ( B ) Distribution of condensation times for parS (black) and non-specific (red) DNA substrates. ( C ) Distribution of final extensions after condensation for parS (black) and non-specific (red) DNA substrates. ( D ) Scatter plot of initial and final extensions for lambda-based substrates (black), parS -based substrates (blue) and pSP73-based substrates (green). All of the data shown were obtained from condensation curves at 0.34 pN.

    Article Snippet: The central part was produced by PCR using a high-fidelity DNA polymerase (Phusion Polymerase, NEB) and the pET28a(+) ParB plasmid with existing NotI and XhoI sites having been removed by site-directed mutagenesis (QuikChange kit, Stratagene).

    Techniques:

    HERV-W env sequence mapping and detection. The human genome contains several endogenous retroviral envelope sequences similar to ERVWE1 . ( A ) Chromosomal loci (arrows) depicting sequences similar to ERVWE1 (accession No. NM_014590). The genomic location of the ERVWE1 locus on chromosome 7 is indicated with a box. ( B ) Phylogenetic analysis of HERV-W env gene at 12 different putative gene loci; the dendrogram was constructed based on DNA sequence by the Neighbor-Joining method using the MEGA4 program. The tree is rooted to the MSRV prototype env sequence, which was used as an out-group gene sequence. ( C ) Amplification and cloning of the 650 bp region of HERV-W env gene: ( i ) ethidium bromide-stained agarose gel showing HERV-W env gene amplicons JEG and BeWo cell lines, ( ii ) frequency of HERV-W env cDNA sequences cloned from human fetal astrocytes (HFA), neurons (HFN), microglia (HFM) and immortalized cell lines. In primary cells, HERV-W env sequences were derived from the 7q21.2 (ERVWE1) locus as well as other loci, while all HERV-W env sequences from immortalized cell lines appeared to be encoded by 7q21.2. The values in parenthesis indicate percent diversity among clones for each patient relative to ERVWE1. (ND = none detected).

    Journal: PLoS ONE

    Article Title: Age- and Disease-Dependent HERV-W Envelope Allelic Variation in Brain: Association with Neuroimmune Gene Expression

    doi: 10.1371/journal.pone.0019176

    Figure Lengend Snippet: HERV-W env sequence mapping and detection. The human genome contains several endogenous retroviral envelope sequences similar to ERVWE1 . ( A ) Chromosomal loci (arrows) depicting sequences similar to ERVWE1 (accession No. NM_014590). The genomic location of the ERVWE1 locus on chromosome 7 is indicated with a box. ( B ) Phylogenetic analysis of HERV-W env gene at 12 different putative gene loci; the dendrogram was constructed based on DNA sequence by the Neighbor-Joining method using the MEGA4 program. The tree is rooted to the MSRV prototype env sequence, which was used as an out-group gene sequence. ( C ) Amplification and cloning of the 650 bp region of HERV-W env gene: ( i ) ethidium bromide-stained agarose gel showing HERV-W env gene amplicons JEG and BeWo cell lines, ( ii ) frequency of HERV-W env cDNA sequences cloned from human fetal astrocytes (HFA), neurons (HFN), microglia (HFM) and immortalized cell lines. In primary cells, HERV-W env sequences were derived from the 7q21.2 (ERVWE1) locus as well as other loci, while all HERV-W env sequences from immortalized cell lines appeared to be encoded by 7q21.2. The values in parenthesis indicate percent diversity among clones for each patient relative to ERVWE1. (ND = none detected).

    Article Snippet: Complementary DNA derived from the RNA of the cells and samples was subjected to nested PCR using a High-Fidelity DNA Polymerase (Phusion, NEB) and varied combinations of HERV-W env gene specific primer pairs spanning over the surface unit-transmembrane (SU-TM) region.

    Techniques: Sequencing, Construct, Amplification, Clone Assay, Staining, Agarose Gel Electrophoresis, Derivative Assay

    HERV-W env sequence analyses from autopsied brain white matter. ( A ) Chromosomal loci encoding HERV-W env sequences in MS and non-MS samples showed 7q21.2 was the predominant locus in MS and non-MS samples, while placental clones were derived from multiple chromosomal locations. Values in parenthesis indicate percent diversity among clones for each patient relative to ERVWE1. ( B ) Phylogenetic analysis of HERV-W env sequences from MS and non-MS samples, based on DNA sequence by the neighbor-joining method. The tree was rooted to MSRV prototype env sequence, which was used as an out-group gene sequence. ( C ) Correlation between sequence diversity within samples with respect to ERVWE1 and HERV-W env abundance in MS and non-MS samples. (ND = none detected).

    Journal: PLoS ONE

    Article Title: Age- and Disease-Dependent HERV-W Envelope Allelic Variation in Brain: Association with Neuroimmune Gene Expression

    doi: 10.1371/journal.pone.0019176

    Figure Lengend Snippet: HERV-W env sequence analyses from autopsied brain white matter. ( A ) Chromosomal loci encoding HERV-W env sequences in MS and non-MS samples showed 7q21.2 was the predominant locus in MS and non-MS samples, while placental clones were derived from multiple chromosomal locations. Values in parenthesis indicate percent diversity among clones for each patient relative to ERVWE1. ( B ) Phylogenetic analysis of HERV-W env sequences from MS and non-MS samples, based on DNA sequence by the neighbor-joining method. The tree was rooted to MSRV prototype env sequence, which was used as an out-group gene sequence. ( C ) Correlation between sequence diversity within samples with respect to ERVWE1 and HERV-W env abundance in MS and non-MS samples. (ND = none detected).

    Article Snippet: Complementary DNA derived from the RNA of the cells and samples was subjected to nested PCR using a High-Fidelity DNA Polymerase (Phusion, NEB) and varied combinations of HERV-W env gene specific primer pairs spanning over the surface unit-transmembrane (SU-TM) region.

    Techniques: Sequencing, Mass Spectrometry, Clone Assay, Derivative Assay

    Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Journal: PLoS ONE

    Article Title: Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete

    doi: 10.1371/journal.pone.0057792

    Figure Lengend Snippet: Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Article Snippet: PCR conditions for the 50 µl reactions were as follows: 1X Phusion High Fidelity (GC) buffer (New England Biolabs), 3% DMSO, 0.1 mM dNTPs, 0.02 units/µl Phusion DNA polymerase (New England Biolabs), 0.4 pmol/µl of each and 1.5 ng/µl plasmid DNA template.

    Techniques: Polymerase Chain Reaction, Amplification, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Molecular Weight, Marker, Sequencing, Generated, Clone Assay, In Vitro

    Affect of mutations in the 17 bp direct repeats on precise excision of the vlsE variable region. A) DNA sequences of the wild-type 17 bp direct repeat (DR) and a mutant 17 bp direct repeat (DR*) used in this study. Mutated bases are highlighted in red. B) Schematic showing the plasmid templates carrying wild-type DRs and a mutant DR at the left, right or both sides of the variable region. C ) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using the templates shown in Panel B with the indicated primers. Gel electrophoresis conditions were as noted in Fig. 2 .

    Journal: PLoS ONE

    Article Title: Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete

    doi: 10.1371/journal.pone.0057792

    Figure Lengend Snippet: Affect of mutations in the 17 bp direct repeats on precise excision of the vlsE variable region. A) DNA sequences of the wild-type 17 bp direct repeat (DR) and a mutant 17 bp direct repeat (DR*) used in this study. Mutated bases are highlighted in red. B) Schematic showing the plasmid templates carrying wild-type DRs and a mutant DR at the left, right or both sides of the variable region. C ) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using the templates shown in Panel B with the indicated primers. Gel electrophoresis conditions were as noted in Fig. 2 .

    Article Snippet: PCR conditions for the 50 µl reactions were as follows: 1X Phusion High Fidelity (GC) buffer (New England Biolabs), 3% DMSO, 0.1 mM dNTPs, 0.02 units/µl Phusion DNA polymerase (New England Biolabs), 0.4 pmol/µl of each and 1.5 ng/µl plasmid DNA template.

    Techniques: Mutagenesis, Plasmid Preparation, Staining, Agarose Gel Electrophoresis, Amplification, Nucleic Acid Electrophoresis