phospho erk  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Millipore phospho erk
    <t>ERK</t> and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the <t>MEK</t> inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P
    Phospho Erk, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phospho erk/product/Millipore
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    phospho erk - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "Regulation of Rac1 activation by the low density lipoprotein receptor-related protein"

    Article Title: Regulation of Rac1 activation by the low density lipoprotein receptor-related protein

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200207070

    ERK and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the MEK inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P
    Figure Legend Snippet: ERK and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the MEK inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P

    Techniques Used: Migration, Staining, Dominant Negative Mutation, Transfection, Plasmid Preparation, Fluorescence, Microscopy

    2) Product Images from "Interplay Between HGF/SF–Met-Ras Signaling, Tumor Metabolism and Blood Flow as a Potential Target for Breast Cancer Therapy"

    Article Title: Interplay Between HGF/SF–Met-Ras Signaling, Tumor Metabolism and Blood Flow as a Potential Target for Breast Cancer Therapy

    Journal: Oncoscience

    doi:

    Effect of Ras inhibition on HGF/SF-induced Ras-ERK signaling and cell motility (A), DA3 cells were treated with vehicle (DMSO 0.1% control) or with HGF/SF (80ng/mL), 50 μM FTS+HGF/SF, 100 μM FTS +HGF/SF or 100 μM FTS. After 24h, the cells were lysed and the lysates were subjected to immunoblotting. These results demonstrate that HGF/SF activates Met downstream signaling via the ERK and Ras pathways, while FTS inhibits both basal level signaling and HGF/SF induced signaling via Ras and ERK. The bottom tubulin panel was used as the loading control. (B), Histogram of the protein expression levels, normalized to tubulin. Black bars represents the intensity of Ras GTP in the different samples, white bars represent pERK and gray Bars represent total Ras. (C), a scratch assay was performed by growing DA3 cells to confluency and then scratching the monolayer. Cell media was then exchanged to serum starvation media containing the different treatments. The cells were treated as following: vehicle (DMSO 0.1% control) or with HGF/SF (80ng/mL), 5 μM FTS, 5 μM FTS +HGF/SF. Cell motility rates are compared in the graph that demonstrates that HGF/SF activation of Met increases cell motility (n = 14, P
    Figure Legend Snippet: Effect of Ras inhibition on HGF/SF-induced Ras-ERK signaling and cell motility (A), DA3 cells were treated with vehicle (DMSO 0.1% control) or with HGF/SF (80ng/mL), 50 μM FTS+HGF/SF, 100 μM FTS +HGF/SF or 100 μM FTS. After 24h, the cells were lysed and the lysates were subjected to immunoblotting. These results demonstrate that HGF/SF activates Met downstream signaling via the ERK and Ras pathways, while FTS inhibits both basal level signaling and HGF/SF induced signaling via Ras and ERK. The bottom tubulin panel was used as the loading control. (B), Histogram of the protein expression levels, normalized to tubulin. Black bars represents the intensity of Ras GTP in the different samples, white bars represent pERK and gray Bars represent total Ras. (C), a scratch assay was performed by growing DA3 cells to confluency and then scratching the monolayer. Cell media was then exchanged to serum starvation media containing the different treatments. The cells were treated as following: vehicle (DMSO 0.1% control) or with HGF/SF (80ng/mL), 5 μM FTS, 5 μM FTS +HGF/SF. Cell motility rates are compared in the graph that demonstrates that HGF/SF activation of Met increases cell motility (n = 14, P

    Techniques Used: Inhibition, Expressing, Wound Healing Assay, Activation Assay

    Inhibition of Ras in tumors affects Ras and pERK levels after a single dose of FTS (A), Activated Ras (Ras-GTP), pERK, and total Ras were assayed in xenografts prepared from DA3 tumors removed from mice at the indicated time periods after treatment with FTS (40 mg/kg) or vehicle (0.5% CMC). Western blot analysis demonstrates the rapid effect of FTS on ERK phosphorylation and on Ras activation and expression in vivo . (B), Bar graph depicting the average intensity (%) of each treatment relative to the control group. Black Bars represent Ras-GTP, white Bars represent pERK, and gray Bars represent total Ras. The results showed that FTS inhibits Ras-GTP, pERK, and total Ras as early as 4 hours after treatment.
    Figure Legend Snippet: Inhibition of Ras in tumors affects Ras and pERK levels after a single dose of FTS (A), Activated Ras (Ras-GTP), pERK, and total Ras were assayed in xenografts prepared from DA3 tumors removed from mice at the indicated time periods after treatment with FTS (40 mg/kg) or vehicle (0.5% CMC). Western blot analysis demonstrates the rapid effect of FTS on ERK phosphorylation and on Ras activation and expression in vivo . (B), Bar graph depicting the average intensity (%) of each treatment relative to the control group. Black Bars represent Ras-GTP, white Bars represent pERK, and gray Bars represent total Ras. The results showed that FTS inhibits Ras-GTP, pERK, and total Ras as early as 4 hours after treatment.

    Techniques Used: Inhibition, Mouse Assay, Western Blot, Activation Assay, Expressing, In Vivo

    3) Product Images from "Vascular endothelial growth factor regulates adult hippocampal cell proliferation through MEK/ERK- and PI3K/Akt-dependent signaling"

    Article Title: Vascular endothelial growth factor regulates adult hippocampal cell proliferation through MEK/ERK- and PI3K/Akt-dependent signaling

    Journal: Neuropharmacology

    doi: 10.1016/j.neuropharm.2012.04.033

    VEGF stimulation of adult hippocampal neural stem/progenitor cell proliferation requires MAPK/ERK and PI3K/Akt signaling
    Figure Legend Snippet: VEGF stimulation of adult hippocampal neural stem/progenitor cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Techniques Used:

    VEGF stimulation of hippocampal cell proliferation requires MAPK/ERK and PI3K/Akt signaling
    Figure Legend Snippet: VEGF stimulation of hippocampal cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Techniques Used:

    Phospho-activated forms of Flk-1, ERK, and Akt among proliferating cells
    Figure Legend Snippet: Phospho-activated forms of Flk-1, ERK, and Akt among proliferating cells

    Techniques Used:

    4) Product Images from "The Effect of Agmatine on Expression of IL-1? and TLX Which Promotes Neuronal Differentiation in Lipopolysaccharide-Treated Neural Progenitors"

    Article Title: The Effect of Agmatine on Expression of IL-1? and TLX Which Promotes Neuronal Differentiation in Lipopolysaccharide-Treated Neural Progenitors

    Journal: Experimental Neurobiology

    doi: 10.5607/en.2013.22.4.268

    Effects of agmatine mediated by the ERK pathway under LPS-induced inflammation. (A) The expression of cleaved caspase 3 protein decreases in the Agm-treat group compared with the control group under LPS-induced inflammation. (B) The expression of cleaved caspase 3 does not differ much between 0 and 6 DIV. (C) The expression of PI3K protein increases more i n the Agm-only and the Agm- and LPS-treated groups than in the LPS-only group. (D) The expression of phospho-ERK increases more in the Agm-only and the Agm- and LPS-treat groups than in the LPS-only group. (E)The expression of phospho- AKT expression increases more in the Agm-only and the Agm- and LPS-treated groups than in the LPS-only group. #p
    Figure Legend Snippet: Effects of agmatine mediated by the ERK pathway under LPS-induced inflammation. (A) The expression of cleaved caspase 3 protein decreases in the Agm-treat group compared with the control group under LPS-induced inflammation. (B) The expression of cleaved caspase 3 does not differ much between 0 and 6 DIV. (C) The expression of PI3K protein increases more i n the Agm-only and the Agm- and LPS-treated groups than in the LPS-only group. (D) The expression of phospho-ERK increases more in the Agm-only and the Agm- and LPS-treat groups than in the LPS-only group. (E)The expression of phospho- AKT expression increases more in the Agm-only and the Agm- and LPS-treated groups than in the LPS-only group. #p

    Techniques Used: Expressing

    5) Product Images from "Global evaluation of Eph receptors and ephrins in lung adenocarcinomas identifies EphA4 as an inhibitor of cell migration and invasion"

    Article Title: Global evaluation of Eph receptors and ephrins in lung adenocarcinomas identifies EphA4 as an inhibitor of cell migration and invasion

    Journal: Molecular cancer therapeutics

    doi: 10.1158/1535-7163.MCT-12-0030

    EphA4 increases occludin expression and decreases ERK activation
    Figure Legend Snippet: EphA4 increases occludin expression and decreases ERK activation

    Techniques Used: Expressing, Activation Assay

    6) Product Images from "Fibroblast Growth Factor Receptor 3 Interacts with and Activates TGF?-Activated Kinase 1 Tyrosine Phosphorylation and NF?B Signaling in Multiple Myeloma and Bladder Cancer"

    Article Title: Fibroblast Growth Factor Receptor 3 Interacts with and Activates TGF?-Activated Kinase 1 Tyrosine Phosphorylation and NF?B Signaling in Multiple Myeloma and Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0086470

    TAK1 knockdown inhibits FGFR3-dependent NFκB activation. ( A ) 8226 (FGFR3 negative) MM cells were transfected with 5 µg FGFR3 constructs or empty vector, and NF-κB-Luc and pRL-TK control Renilla reporter at a ratio of 3∶1, respectively for 48 hours. Cells were then lysed and assayed for dual-luciferase activity. ( B, C ) FGFR3-expressing bladder and MM cell lines were transfected with control or TAK1 siRNA, and 24 hours later with κB-Luc and pRL-TK control Renilla reporter at a ratio of 3∶1. The following day, cells were serum-starved overnight and treated with ligand (FGF1) for 8 hours prior to lysis and dual-luciferase assay. ( D ) MGHU3 cells were transfected with TAK1 or non-targeting siRNA for 48 hours, serum starved overnight then treated with FGF1 ligand for the time indicated. Cells were then fractionated, and 10 µg of nuclear fraction was run on an SDS-page gel and western blotted. Blots were probed with anti-p65 and anti-p84 (nuclear marker) antibodies. Densitometry was performed and p65 measurements were normalized to p84 measurements. ( E ) FGFR3 signaling is not altered by TAK1 knockdown. KMS11 cells were transfected with control or TAK1 siRNA and, 24 hours later, treated with or without FGFR inhibitor, PD173074 for an additional 24 hours. Western blots were probed with p-ERK, total ERK and TAK1 antibodies. Statistical analysis was performed using a t-test; (*) p
    Figure Legend Snippet: TAK1 knockdown inhibits FGFR3-dependent NFκB activation. ( A ) 8226 (FGFR3 negative) MM cells were transfected with 5 µg FGFR3 constructs or empty vector, and NF-κB-Luc and pRL-TK control Renilla reporter at a ratio of 3∶1, respectively for 48 hours. Cells were then lysed and assayed for dual-luciferase activity. ( B, C ) FGFR3-expressing bladder and MM cell lines were transfected with control or TAK1 siRNA, and 24 hours later with κB-Luc and pRL-TK control Renilla reporter at a ratio of 3∶1. The following day, cells were serum-starved overnight and treated with ligand (FGF1) for 8 hours prior to lysis and dual-luciferase assay. ( D ) MGHU3 cells were transfected with TAK1 or non-targeting siRNA for 48 hours, serum starved overnight then treated with FGF1 ligand for the time indicated. Cells were then fractionated, and 10 µg of nuclear fraction was run on an SDS-page gel and western blotted. Blots were probed with anti-p65 and anti-p84 (nuclear marker) antibodies. Densitometry was performed and p65 measurements were normalized to p84 measurements. ( E ) FGFR3 signaling is not altered by TAK1 knockdown. KMS11 cells were transfected with control or TAK1 siRNA and, 24 hours later, treated with or without FGFR inhibitor, PD173074 for an additional 24 hours. Western blots were probed with p-ERK, total ERK and TAK1 antibodies. Statistical analysis was performed using a t-test; (*) p

    Techniques Used: Activation Assay, Transfection, Construct, Plasmid Preparation, Luciferase, Activity Assay, Expressing, Lysis, SDS Page, Western Blot, Marker

    7) Product Images from "Effect of SMURF2 Targeting on Susceptibility to MEK Inhibitors in Melanoma"

    Article Title: Effect of SMURF2 Targeting on Susceptibility to MEK Inhibitors in Melanoma

    Journal: JNCI Journal of the National Cancer Institute

    doi: 10.1093/jnci/djs471

    MITF and primary resistance to MEK inhibition. A ) DNA content fluorescence-activated cell sorting (FACS) analysis (assessing fractions of cells in G1, S, G2/M, or subG1 phase) of the indicated cell lines treated with 1µM PD184352 (PD) or dimethyl sulfoxide (DMSO) for 72 hours. Western blots of ERK phosphorylation (pERK) at concentrations of 0.2 and 1 µM PD184352. ERK2 serves as loading control. B ) Quantification of cells in the subG1 fraction of a FACS analysis of the indicated melanoma cell lines (R = resistant, S = sensitive) treated with 1µM PD184352 for 72 hours. Bars represent means from three independent experiments; error bars refer to 95% confidence intervals. NS = P > .05; *** P
    Figure Legend Snippet: MITF and primary resistance to MEK inhibition. A ) DNA content fluorescence-activated cell sorting (FACS) analysis (assessing fractions of cells in G1, S, G2/M, or subG1 phase) of the indicated cell lines treated with 1µM PD184352 (PD) or dimethyl sulfoxide (DMSO) for 72 hours. Western blots of ERK phosphorylation (pERK) at concentrations of 0.2 and 1 µM PD184352. ERK2 serves as loading control. B ) Quantification of cells in the subG1 fraction of a FACS analysis of the indicated melanoma cell lines (R = resistant, S = sensitive) treated with 1µM PD184352 for 72 hours. Bars represent means from three independent experiments; error bars refer to 95% confidence intervals. NS = P > .05; *** P

    Techniques Used: Inhibition, Fluorescence, FACS, Western Blot

    8) Product Images from "Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells"

    Article Title: Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19030691

    Minoxidil promotes the proliferation of DP cells and hair growth through stimulation of growth factor release from adipose-derived stem cells. Minoxidil stimulates the release of growth factors including PD-ECGF, PDGF-C, and CXCL1 from ASCs via ERK and the other pathway, respectively, thereby promoting of DP cells proliferation and hair growth.
    Figure Legend Snippet: Minoxidil promotes the proliferation of DP cells and hair growth through stimulation of growth factor release from adipose-derived stem cells. Minoxidil stimulates the release of growth factors including PD-ECGF, PDGF-C, and CXCL1 from ASCs via ERK and the other pathway, respectively, thereby promoting of DP cells proliferation and hair growth.

    Techniques Used: Derivative Assay

    Minoxidil upregulates expression of PD-ECGF and PDGF-C through the ERK pathway in ASCs. ( A ) The MEK inhibitor PD98059 reversed minoxidil-induced ERK phosphorylation; ( B ) PD98059 also suppressed minoxidil-induced upregulation of PD-ECGF and PDGF-C expression by ASCs. Three independent experiments were carried out per data point. * p
    Figure Legend Snippet: Minoxidil upregulates expression of PD-ECGF and PDGF-C through the ERK pathway in ASCs. ( A ) The MEK inhibitor PD98059 reversed minoxidil-induced ERK phosphorylation; ( B ) PD98059 also suppressed minoxidil-induced upregulation of PD-ECGF and PDGF-C expression by ASCs. Three independent experiments were carried out per data point. * p

    Techniques Used: Expressing

    9) Product Images from "Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells"

    Article Title: Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19030691

    Minoxidil promotes the proliferation of DP cells and hair growth through stimulation of growth factor release from adipose-derived stem cells. Minoxidil stimulates the release of growth factors including PD-ECGF, PDGF-C, and CXCL1 from ASCs via ERK and the other pathway, respectively, thereby promoting of DP cells proliferation and hair growth.
    Figure Legend Snippet: Minoxidil promotes the proliferation of DP cells and hair growth through stimulation of growth factor release from adipose-derived stem cells. Minoxidil stimulates the release of growth factors including PD-ECGF, PDGF-C, and CXCL1 from ASCs via ERK and the other pathway, respectively, thereby promoting of DP cells proliferation and hair growth.

    Techniques Used: Derivative Assay

    Minoxidil upregulates expression of PD-ECGF and PDGF-C through the ERK pathway in ASCs. ( A ) The MEK inhibitor PD98059 reversed minoxidil-induced ERK phosphorylation; ( B ) PD98059 also suppressed minoxidil-induced upregulation of PD-ECGF and PDGF-C expression by ASCs. Three independent experiments were carried out per data point. * p
    Figure Legend Snippet: Minoxidil upregulates expression of PD-ECGF and PDGF-C through the ERK pathway in ASCs. ( A ) The MEK inhibitor PD98059 reversed minoxidil-induced ERK phosphorylation; ( B ) PD98059 also suppressed minoxidil-induced upregulation of PD-ECGF and PDGF-C expression by ASCs. Three independent experiments were carried out per data point. * p

    Techniques Used: Expressing

    Related Articles

    Immunohistochemistry:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat#:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Immunostaining:

    Article Title: H2A.Z.1 crosstalk with H3K56-acetylation controls gliogenesis through the transcription of folate receptor
    Article Snippet: .. Immunostaining was performed with the following primary antibodies: H2A.Z.1 (Active-Motif, # 39943, Rabbit, 1:2000), GFAP (Sigma, G6171, Mouse, 1:10 000; Dako, Z033429, Rabbit, 1:3000), Acsbg1 (Abcam, ab 118154, Mouse, 1:1000), Aldh1l1 (Abcam, ab56777, Rabbit, 1:500), GLAST (Proteintech, 20785-1-AP, Rabbit, 1:1000), BLBP (Proteintech, 14836-1-AP, Rabbit, 1:000), S100β (Proteintech, 15146-1-AP, Rabbit, 1:500), Pax6 (Abcam, ab5790, Rabbit, 1:000), Sox2 (R & D,MAB2018, Mouse, 1:1000), BrdU (Abcam, ab6326, Rat, 1:1000), TUJ1 (Millipore, MAB1637, Rabbit, 1:2000), STAT3 (Cell Signaling Technology, 4904P, Mouse, 1:2000), phospho-STAT3 (Tyr705) (Cell Signaling Technology, 9145S, Rabbit, 1:500), β-Actin (Proteintech, 20536-1-AP, Rabbit, 1:5000), Flag (Sigma, F7425, Mouse, 1:2000), H2A (Proteintech, 10445-1-AP, Rabbit, 1:000), H3 (Cell Signaling Technology, 4499, Rabbit, 1:2000), H3K56ac (Abcam, ab76307, Rabbit, 1:2000), H3K9ac (Millipore, 07-352, Rabbit, 1:2000), H3K27ac (Millipore, 07-360, Rabbit, 1:2000), H3K4me3 (Millipore, 07-473, Rabbit, 1:2000), Tri-Methyl-Histone H3 (Lys36) (Cell Signaling Technology, # 9763, Rabbit, 1:2000), FOLR1 (Bioworld Technology, BS3861, Rabbit, 1:500). .. E16.5 NPCs were isolated from pregnant ICR mice cortex.

    Incubation:

    Article Title: Altered expression pattern of integrin alphavbeta3 correlates with actin cytoskeleton in primary cultures of human breast cancer
    Article Snippet: .. The parts of the membranes containing proteins from 75 to 175 kDa were incubated overnight at 4°C with primary antibody rabbit anti-human integrin beta3 (1:2,000) (AB1932, Chemicon) and the parts of the membranes containing proteins from 20 to 75 kDa were incubated overnight at 4°C with the mouse anti-human actin antibody (1:2,000) (MAB1501, Chemicon). ..

    Article Title: Layer 4 Pyramidal Neurons Exhibit Robust Dendritic Spine Plasticity In Vivo after Input Deprivation
    Article Snippet: .. Briefly, sections (30–40 μm) were blocked in PBS containing 5% Goat serum (Thermo Fisher Scientific PCN5000) and 0.1% Triton X-100 (Sigma-Aldrich), and then incubated with primary antibodies overnight at RT at the following dilutions: chicken anti-GFP (1:500, Millipore Bioscience Research Reagents AB16901), guinea pig anti-VGlut2 (1:2000, Millipore Bioscience Research Reagents, AB2251), rabbit anti-Cux1 (1:500, Santa-Cruz Biotechnology, sc-13024), rat anti-Ctip2 (1:750, Abcam AB18465), and rabbit anti-GABA (1:500, Sigma-Aldrich A2052). .. For secondary antibodies, we used donkey anti-chicken-FITC (Jackson Laboratories), AlexaFluor 568 donkey anti-rabbit, AlexaFluor 568 goat anti-guinea pig, and Cy5-goat anti-rat (all from Life Technologies).

    other:

    Article Title: An Anti-Parkinson’s Disease Drug via Targeting Adenosine A2A Receptor Enhances Amyloid-β Generation and γ-Secretase Activity
    Article Snippet: Antibodies Anti-PS1-N-terminus (1–65) (PRB-354P, 1:1,000, Covance, Davis, CA, USA); Anti-PS1-N-terminus (MAB1563, 1:100, EMD Millipore, Darmstadt, Germany); anti-PS1 loop (263–407) (529592, 1:2,000, Calbiochem); anti-APH1aL/C terminal (245–265) (PRB-550P, 1:1,000, Covance); anti-NCT (N1660, 1:1,000, Sigma), Anti-Pen2 (P5622, 1:1,000, Sigma); anti-BACE1 (AP7774b, 1:1,000, Abgent, Suzhou, China); anti-HA (H6908, 1:5,000, Sigma); anti-Flag (F3156, 1:2,000, Sigma); anti-A2A R (05–717, 1:1,1000, Millipore); anti-EEA1 (610457, dilution 1:200, BD transduction laboratories).

    Marker:

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Western Blot:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat#:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Binding Assay:

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Chromatin Immunoprecipitation:

    Article Title: MYC dephosphorylation by the PP1/PNUTS phosphatase complex regulates chromatin binding and protein stability
    Article Snippet: .. Antibodies, primers, and siRNAs Antibodies for MYC pT58 (04-217, Millipore, used at 1:2000), MYC p62 (ab78318, abcam, used at 1:1000), MAX for ChIP (sc-765, Santa Cruz, 10 µg used for ChIP), PP1α isoform (438100, Invitrogen, used at 1:2000), PP1β isoform (ab53315, abcam, used at 1:1000), PP1γ isoform (A300-906A, Bethyl laboratories, used at 1:5000), biotin anti-mouse SV40 large T and small T antigen (554151, BD Biosciences, used at 1:1000), PNUTS for immunoblotting (A300-439A, Bethyl Laboratories, used at 1:15,000 to 1:20,000), MYC for ChIP (homemade N262, 2 µg used for ChIP, 4 µg used for re-ChIP), PNUTS for ChIP (A300-440A, Bethyl Laboratories, 4 µg for ChIP, 10 µg for re-ChIP), Actin (A2066, Sigma, used at 1:10000), Anti-mouse HRP (NA931V, GE healthcare, used at 1:10,000), Anti-tubulin (DM1A, Calbiochem, used at 1:2000), Anti-laminB1 (ab16048, Abcam, used at 1:1000) and Anti-rabbit HRP (NA934V, Sigma, used at 1:10,000). .. The qPCR primers for PP1α isoform (fwd GTTCCTCCACAAGCACGACT, rev GTTCCTCCACAAGCACGACT), PP1β isoform (fwd GAAGATCTTCTGTTGTCATG, rev GCACATCCTTATCTGGATCAGAC), PP1γ isoform (fwd ACTAGAACTTGAAGCACCACT, rev CGCAGCAAATCATAGTATTGTCC), and RPLPO (fwd CAGATTGGCTACCCAACTGTT, rev GGGAAGGTGTAATCCGTCTCC).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Millipore anti phospho erk
    Schematic representation of possible mechanisms for the antinociceptive effects of intrathecal (i.t.) transforming growth factor-β1 (TGF-β1) during neuropathic pain. I.t. TGF-β1 may attenuate peripheral nerve injury-induced thermal hyperalgesia ( Pathway 1 ). Upregulation of phosphorylated <t>(phospho)-p38</t> and phosphorylated extracellular signal-regulated kinase <t>(phospho-ERK)</t> is a mechanism for nerve injury-induced pain ( Pathway 2 ). The antinociceptive effects of i.t. TGF-β1 may occur via suppression of nerve injury-induced upregulation of phospho-p38 and phospho-ERK ( Pathway 3 )
    Anti Phospho Erk, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti phospho erk/product/Millipore
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    anti phospho erk - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    Millipore phospho erk
    <t>ERK</t> and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the <t>MEK</t> inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P
    Phospho Erk, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phospho erk/product/Millipore
    Average 93 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    phospho erk - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    91
    Millipore phosphor erk
    <t>ERK</t> and <t>p38</t> signaling pathway involvement in fucoidan-treated monocyte migration: ( A ) Representative Western blot illustrating phosphorylation of ERK1/2 and P38 when PBMC were treated with or without fucoidan (in the presence or absence of PD98059 or SB203580) for 30 min; ( B ) Quantitative analysis of ERK phosphorylation; ( C ) Quantitative analysis of p38 phosphorylation. Results are represented relative to the corresponding control, with with independent donors; ( D ) Representative fields showing migratory cells treated as in A; ( E ) Migratory cell numbers in five independent fields. * p
    Phosphor Erk, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphor erk/product/Millipore
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phosphor erk - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Schematic representation of possible mechanisms for the antinociceptive effects of intrathecal (i.t.) transforming growth factor-β1 (TGF-β1) during neuropathic pain. I.t. TGF-β1 may attenuate peripheral nerve injury-induced thermal hyperalgesia ( Pathway 1 ). Upregulation of phosphorylated (phospho)-p38 and phosphorylated extracellular signal-regulated kinase (phospho-ERK) is a mechanism for nerve injury-induced pain ( Pathway 2 ). The antinociceptive effects of i.t. TGF-β1 may occur via suppression of nerve injury-induced upregulation of phospho-p38 and phospho-ERK ( Pathway 3 )

    Journal: The Journal of Headache and Pain

    Article Title: Contributions of p38 and ERK to the antinociceptive effects of TGF-β1 in chronic constriction injury-induced neuropathic rats

    doi: 10.1186/s10194-016-0665-2

    Figure Lengend Snippet: Schematic representation of possible mechanisms for the antinociceptive effects of intrathecal (i.t.) transforming growth factor-β1 (TGF-β1) during neuropathic pain. I.t. TGF-β1 may attenuate peripheral nerve injury-induced thermal hyperalgesia ( Pathway 1 ). Upregulation of phosphorylated (phospho)-p38 and phosphorylated extracellular signal-regulated kinase (phospho-ERK) is a mechanism for nerve injury-induced pain ( Pathway 2 ). The antinociceptive effects of i.t. TGF-β1 may occur via suppression of nerve injury-induced upregulation of phospho-p38 and phospho-ERK ( Pathway 3 )

    Article Snippet: Finally, for double immunofluorescence staining for neurons and phospho-p38 or anti-phospho-ERK, spinal sections were incubated with a mixture of anti-neuronal nuclei (NeuN; neuron-specific nuclear protein, 1:500, Alexa Fluor 488 conjugated antibody, cat. MAB377X, EMD Millipore, Temecula, CA, USA; monoclonal mouse antibody) and anti-phospho-p38 (1:100) or anti-phospho-ERK (1:100) antibodies overnight at 4 °C.

    Techniques:

    ERK and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the MEK inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P

    Journal: The Journal of Cell Biology

    Article Title: Regulation of Rac1 activation by the low density lipoprotein receptor-related protein

    doi: 10.1083/jcb.200207070

    Figure Lengend Snippet: ERK and Rac1 in migration of LRP-1-deficient MEFs. (A) MEF-1 and MEF-2 cells were treated with 10 μM of the MEK inhibitor, PD098059 or with vehicle (DMSO) for 15 min at RT, and were then allowed to migrate through serum-coated Transwell membranes. The number of migrating cells was determined by crystal violet staining. (B) MEF-1 and MEF-2 cells were cotransfected to express dominant-negative MEK1 (DN-M) or dominant-negative Rac1 (DN-R) and GFP. Control cells were transfected with empty vector (pBK-CMV) and pEGFP-N1. Cell migration experiments were performed 24 h after transfection. Migration was determined by fluorescence microscopy. Results are expressed relative to the migration rate in MEF-1 cells transfected with pBK-CMV and pEGFP-N1 ( n = 4). The asterisk indicates statistical significance at the P

    Article Snippet: Phospho-ERK–specific antibody and the MEK inhibitor PD098058 were purchased from Calbiochem.

    Techniques: Migration, Staining, Dominant Negative Mutation, Transfection, Plasmid Preparation, Fluorescence, Microscopy

    VEGF stimulation of adult hippocampal neural stem/progenitor cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Journal: Neuropharmacology

    Article Title: Vascular endothelial growth factor regulates adult hippocampal cell proliferation through MEK/ERK- and PI3K/Akt-dependent signaling

    doi: 10.1016/j.neuropharm.2012.04.033

    Figure Lengend Snippet: VEGF stimulation of adult hippocampal neural stem/progenitor cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Article Snippet: For phospho-ERK, -Akt, -CREB, and Ki-67 immunohistochemistry, sections were treated with anti-mouse phospho-ERK (1:2000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-Akt (1:1000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-CREB (1:1000, Millipore, 48 hrs, 4°C), or anti-rabbit Ki-67 (1:250, Novacastra) antibodies.

    Techniques:

    VEGF stimulation of hippocampal cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Journal: Neuropharmacology

    Article Title: Vascular endothelial growth factor regulates adult hippocampal cell proliferation through MEK/ERK- and PI3K/Akt-dependent signaling

    doi: 10.1016/j.neuropharm.2012.04.033

    Figure Lengend Snippet: VEGF stimulation of hippocampal cell proliferation requires MAPK/ERK and PI3K/Akt signaling

    Article Snippet: For phospho-ERK, -Akt, -CREB, and Ki-67 immunohistochemistry, sections were treated with anti-mouse phospho-ERK (1:2000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-Akt (1:1000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-CREB (1:1000, Millipore, 48 hrs, 4°C), or anti-rabbit Ki-67 (1:250, Novacastra) antibodies.

    Techniques:

    Phospho-activated forms of Flk-1, ERK, and Akt among proliferating cells

    Journal: Neuropharmacology

    Article Title: Vascular endothelial growth factor regulates adult hippocampal cell proliferation through MEK/ERK- and PI3K/Akt-dependent signaling

    doi: 10.1016/j.neuropharm.2012.04.033

    Figure Lengend Snippet: Phospho-activated forms of Flk-1, ERK, and Akt among proliferating cells

    Article Snippet: For phospho-ERK, -Akt, -CREB, and Ki-67 immunohistochemistry, sections were treated with anti-mouse phospho-ERK (1:2000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-Akt (1:1000, Millipore, 24 hrs, 4°C), anti-rabbit phospho-CREB (1:1000, Millipore, 48 hrs, 4°C), or anti-rabbit Ki-67 (1:250, Novacastra) antibodies.

    Techniques:

    ERK and p38 signaling pathway involvement in fucoidan-treated monocyte migration: ( A ) Representative Western blot illustrating phosphorylation of ERK1/2 and P38 when PBMC were treated with or without fucoidan (in the presence or absence of PD98059 or SB203580) for 30 min; ( B ) Quantitative analysis of ERK phosphorylation; ( C ) Quantitative analysis of p38 phosphorylation. Results are represented relative to the corresponding control, with with independent donors; ( D ) Representative fields showing migratory cells treated as in A; ( E ) Migratory cell numbers in five independent fields. * p

    Journal: Marine Drugs

    Article Title: Fucoidan Stimulates Monocyte Migration via ERK/p38 Signaling Pathways and MMP9 Secretion

    doi: 10.3390/md13074156

    Figure Lengend Snippet: ERK and p38 signaling pathway involvement in fucoidan-treated monocyte migration: ( A ) Representative Western blot illustrating phosphorylation of ERK1/2 and P38 when PBMC were treated with or without fucoidan (in the presence or absence of PD98059 or SB203580) for 30 min; ( B ) Quantitative analysis of ERK phosphorylation; ( C ) Quantitative analysis of p38 phosphorylation. Results are represented relative to the corresponding control, with with independent donors; ( D ) Representative fields showing migratory cells treated as in A; ( E ) Migratory cell numbers in five independent fields. * p

    Article Snippet: Supernatants were fractionated by SDS-PAGE 4%–12% (NuPAGE® Bis-Tris Pre-Cast gels, Life Technologies, Saint-Aubin, France), transferred to nitrocellulose membranes, and incubated with the following primary antibodies: phosphor ERK, phosphor p38 and GAPDH (all at 1/300 in 0.1% milk/TTBS 1×) and then incubated for 10 min with SNAP i.d.® (Millipore, Merck KGaA, Darmstadt, Germany).

    Techniques: Migration, Western Blot