phosphatase inhibitor phosstop  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche phosphatase inhibitor phosstop
    Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor <t>PhosSTOP</t> and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P
    Phosphatase Inhibitor Phosstop, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphatase inhibitor phosstop/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phosphatase inhibitor phosstop - by Bioz Stars, 2021-07
    86/100 stars

    Images

    1) Product Images from "The AMP-Activated Protein Kinase KIN10 Is Involved in the Regulation of Autophagy in Arabidopsis"

    Article Title: The AMP-Activated Protein Kinase KIN10 Is Involved in the Regulation of Autophagy in Arabidopsis

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.01201

    Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P
    Figure Legend Snippet: Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P

    Techniques Used: Over Expression, SDS Page, Transgenic Assay, Mass Spectrometry, Protein Extraction, Staining, Western Blot

    2) Product Images from "The AMP-Activated Protein Kinase KIN10 Is Involved in the Regulation of Autophagy in Arabidopsis"

    Article Title: The AMP-Activated Protein Kinase KIN10 Is Involved in the Regulation of Autophagy in Arabidopsis

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.01201

    Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P
    Figure Legend Snippet: Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P

    Techniques Used: Over Expression, SDS Page, Transgenic Assay, Mass Spectrometry, Protein Extraction, Staining, Western Blot

    3) Product Images from "The ATG1/ATG13 Protein Kinase Complex Is Both a Regulator and a Target of Autophagic Recycling in Arabidopsis [C] [C] [W]"

    Article Title: The ATG1/ATG13 Protein Kinase Complex Is Both a Regulator and a Target of Autophagic Recycling in Arabidopsis [C] [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.111.090993

    Turnover and Phosphorylation States of ATG1a and ATG13a Proteins Are Regulated by Autophagy. (A) to (C) Effect of inhibitors and mutants on the turnover of ATG1a and ATG13a during starvation. Five-day-old seedlings of the various genetic backgrounds were either kept in +Suc+N medium (+) or switched to –Suc−N medium (−) at t = 0 and then incubated for the indicated times before extraction of total protein. ATG1a and ATG13a proteins levels were detected by immunoblot analysis with anti-ATG1a and ATG13a antibodies. Immunoblot analyses with anti-PBA1 antibodies were used to confirm near equal protein loading. Each lane contains an equivalent amount of tissue fresh weight. (A) Effect of various inhibitors. CA (0.5 μM), MG132 (50 μM), or an equivalent volume of DMSO were added at t = 0. (B) Effect of various mutations. WT, wild type. (C) Fixed-C/N limitation alters the SDS-PAGE mobility of ATG1a. Extracts from plants before and after 72 h of −Suc−N limitation were electrophoresed in adjacent lanes or mixed (Mix). The apparent molecular masses of the two ATG1a species are indicated. (D) Effect of λ protein phosphatase on the SDS-PAGE mobilities of ATG1a and ATG13a. For analysis of ATG1a, atg5-1 plants were incubated for 72 h in –Suc−N medium. For analysis of ATG13a, wild-type plants were grown in +Suc+N medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-ATG1a and anti-ATG13a antibodies. UN, untreated extracts.
    Figure Legend Snippet: Turnover and Phosphorylation States of ATG1a and ATG13a Proteins Are Regulated by Autophagy. (A) to (C) Effect of inhibitors and mutants on the turnover of ATG1a and ATG13a during starvation. Five-day-old seedlings of the various genetic backgrounds were either kept in +Suc+N medium (+) or switched to –Suc−N medium (−) at t = 0 and then incubated for the indicated times before extraction of total protein. ATG1a and ATG13a proteins levels were detected by immunoblot analysis with anti-ATG1a and ATG13a antibodies. Immunoblot analyses with anti-PBA1 antibodies were used to confirm near equal protein loading. Each lane contains an equivalent amount of tissue fresh weight. (A) Effect of various inhibitors. CA (0.5 μM), MG132 (50 μM), or an equivalent volume of DMSO were added at t = 0. (B) Effect of various mutations. WT, wild type. (C) Fixed-C/N limitation alters the SDS-PAGE mobility of ATG1a. Extracts from plants before and after 72 h of −Suc−N limitation were electrophoresed in adjacent lanes or mixed (Mix). The apparent molecular masses of the two ATG1a species are indicated. (D) Effect of λ protein phosphatase on the SDS-PAGE mobilities of ATG1a and ATG13a. For analysis of ATG1a, atg5-1 plants were incubated for 72 h in –Suc−N medium. For analysis of ATG13a, wild-type plants were grown in +Suc+N medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-ATG1a and anti-ATG13a antibodies. UN, untreated extracts.

    Techniques Used: Incubation, SDS Page

    Related Articles

    SDS Page:

    Article Title: Lysosome-Dependent Activation of Human Dendritic Cells by the Vaccine Adjuvant QS-21
    Article Snippet: Primers and probes were synthesized by Eurogentec (Actb: F: ggatgcagaaggagatcactg, R: cgatccacacggagtacttg, probe: ccctggcacccagcacaatg; Ctsb: F: tcccaccatcaaagagatca, R: atgcagatccggtcagagat, probe: tgtggctcctgctgggcctt; Syk: F: cagggaatatgtgaagcagaca, R: tccagctgaggcttctgact, probe tcaggctctggagcaggcca; IL1b: F: acagatgaagtgctccttcca, R: gtcggagattcgtagctggat, probe: ctctgccctctggatggcgg; IL6: F: gacagccactcacctcttca, R: agtgcctctttgctgctttc, probe: cctcgacggcatctcagccc; CXCL8/IL8: F: gccttcctgatttctgcagc, R: actgacatctaagttctttagcactcc, probe: tggcaaaactgcaccttcacacag, TNF: F: cccagggacctctctctaatc, R: atgggctacaggcttgtcact, probe: tggcccaggcagtcagatcatc). mRNA levels were normalized to β-actin mRNA expression. .. SDS-PAGE and Western Blotting A total of 106 moDCs were rinsed with PBS and lysed in 50 µl RIPA buffer (PBS with 1% Igepal CA-630, 0.5% Na deoxycholate and 0.1% SDS) containing protease (cOmplete Mini Protease Inhibitor Cocktail Tablet, Roche) and phosphatase inhibitors (PhosSTOP, Roche). .. Protein concentration was measured with the Micro BCA Protein Assay kit (Pierce) and 20 µg of protein was loaded onto a 12% Bis-Tris polyacrylamide gel.

    Western Blot:

    Article Title: Lysosome-Dependent Activation of Human Dendritic Cells by the Vaccine Adjuvant QS-21
    Article Snippet: Primers and probes were synthesized by Eurogentec (Actb: F: ggatgcagaaggagatcactg, R: cgatccacacggagtacttg, probe: ccctggcacccagcacaatg; Ctsb: F: tcccaccatcaaagagatca, R: atgcagatccggtcagagat, probe: tgtggctcctgctgggcctt; Syk: F: cagggaatatgtgaagcagaca, R: tccagctgaggcttctgact, probe tcaggctctggagcaggcca; IL1b: F: acagatgaagtgctccttcca, R: gtcggagattcgtagctggat, probe: ctctgccctctggatggcgg; IL6: F: gacagccactcacctcttca, R: agtgcctctttgctgctttc, probe: cctcgacggcatctcagccc; CXCL8/IL8: F: gccttcctgatttctgcagc, R: actgacatctaagttctttagcactcc, probe: tggcaaaactgcaccttcacacag, TNF: F: cccagggacctctctctaatc, R: atgggctacaggcttgtcact, probe: tggcccaggcagtcagatcatc). mRNA levels were normalized to β-actin mRNA expression. .. SDS-PAGE and Western Blotting A total of 106 moDCs were rinsed with PBS and lysed in 50 µl RIPA buffer (PBS with 1% Igepal CA-630, 0.5% Na deoxycholate and 0.1% SDS) containing protease (cOmplete Mini Protease Inhibitor Cocktail Tablet, Roche) and phosphatase inhibitors (PhosSTOP, Roche). .. Protein concentration was measured with the Micro BCA Protein Assay kit (Pierce) and 20 µg of protein was loaded onto a 12% Bis-Tris polyacrylamide gel.

    Article Title: Novel Immunomodulatory Flagellin-Like Protein FlaC in Campylobacter jejuni and Other Campylobacterales
    Article Snippet: Visualization of immuno-reactive bands was obtained using the Super Signal West Pico chemiluminescent substrate (Pierce, Thermo Scientific, Bonn, Germany) and enhanced-chemiluminescence (ECL) hyperfilm (GE Healthcare, Piscataway, NJ). .. Analysis of phosphoproteins (P-p38, anti-P-p38 antibody, rabbit 92115; Cell Signalling Technology; used at a 1:1,000 dilution) of coincubated cells was performed on Western blots from cleared cell lysates prepared in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, protease inhibitor cocktail Complete [Roche], phosphatase inhibitor cocktail PhosStop [Roche]). .. Anti-p38 MAPK antibody (rabbit 92125; Cell Signalling Technology) was used on the same blots as a control for total p38.

    Protease Inhibitor:

    Article Title: Lysosome-Dependent Activation of Human Dendritic Cells by the Vaccine Adjuvant QS-21
    Article Snippet: Primers and probes were synthesized by Eurogentec (Actb: F: ggatgcagaaggagatcactg, R: cgatccacacggagtacttg, probe: ccctggcacccagcacaatg; Ctsb: F: tcccaccatcaaagagatca, R: atgcagatccggtcagagat, probe: tgtggctcctgctgggcctt; Syk: F: cagggaatatgtgaagcagaca, R: tccagctgaggcttctgact, probe tcaggctctggagcaggcca; IL1b: F: acagatgaagtgctccttcca, R: gtcggagattcgtagctggat, probe: ctctgccctctggatggcgg; IL6: F: gacagccactcacctcttca, R: agtgcctctttgctgctttc, probe: cctcgacggcatctcagccc; CXCL8/IL8: F: gccttcctgatttctgcagc, R: actgacatctaagttctttagcactcc, probe: tggcaaaactgcaccttcacacag, TNF: F: cccagggacctctctctaatc, R: atgggctacaggcttgtcact, probe: tggcccaggcagtcagatcatc). mRNA levels were normalized to β-actin mRNA expression. .. SDS-PAGE and Western Blotting A total of 106 moDCs were rinsed with PBS and lysed in 50 µl RIPA buffer (PBS with 1% Igepal CA-630, 0.5% Na deoxycholate and 0.1% SDS) containing protease (cOmplete Mini Protease Inhibitor Cocktail Tablet, Roche) and phosphatase inhibitors (PhosSTOP, Roche). .. Protein concentration was measured with the Micro BCA Protein Assay kit (Pierce) and 20 µg of protein was loaded onto a 12% Bis-Tris polyacrylamide gel.

    Article Title: ATM/Wip1 activities at chromatin control Plk1 re‐activation to determine G2 checkpoint duration
    Article Snippet: Images were acquired using either DeltaVision Spectris imaging system using a 20×, NA 0.7 objective, a Leica DMI6000 Imaging System using a 20×, NA 0.4 objective, or on an ImageXpress system using a 20×, NA 0.45 objective, and quantified as described (Akopyan et al , ). .. U2OS or AT cells expressing ATKAR, H2B‐ATKAR, or H2B‐PLK1 FRET probe were collected 1 h after exposure to IR (5 Gy) or UVC (10–40 J/m2 ) or NCS (5–10 nM) and sonicated in cold IP buffer (50 mM HEPES pH 7.5, 250 mM NaCl, 0.25 NP‐40, 1% glycerol) supplemented with phosphatase inhibitor (PhosSTOP, Roche) and protease inhibitor (complete EDTA‐free, Roche). .. FRET probes were immunoprecipitated from cell extracts using GFP‐Trap (ChromoTek) for 2 h. Beads were washed three times with IP buffer and mixed with SDS sample buffer.

    Article Title: Novel Immunomodulatory Flagellin-Like Protein FlaC in Campylobacter jejuni and Other Campylobacterales
    Article Snippet: Visualization of immuno-reactive bands was obtained using the Super Signal West Pico chemiluminescent substrate (Pierce, Thermo Scientific, Bonn, Germany) and enhanced-chemiluminescence (ECL) hyperfilm (GE Healthcare, Piscataway, NJ). .. Analysis of phosphoproteins (P-p38, anti-P-p38 antibody, rabbit 92115; Cell Signalling Technology; used at a 1:1,000 dilution) of coincubated cells was performed on Western blots from cleared cell lysates prepared in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, protease inhibitor cocktail Complete [Roche], phosphatase inhibitor cocktail PhosStop [Roche]). .. Anti-p38 MAPK antibody (rabbit 92125; Cell Signalling Technology) was used on the same blots as a control for total p38.

    Expressing:

    Article Title: ATM/Wip1 activities at chromatin control Plk1 re‐activation to determine G2 checkpoint duration
    Article Snippet: Images were acquired using either DeltaVision Spectris imaging system using a 20×, NA 0.7 objective, a Leica DMI6000 Imaging System using a 20×, NA 0.4 objective, or on an ImageXpress system using a 20×, NA 0.45 objective, and quantified as described (Akopyan et al , ). .. U2OS or AT cells expressing ATKAR, H2B‐ATKAR, or H2B‐PLK1 FRET probe were collected 1 h after exposure to IR (5 Gy) or UVC (10–40 J/m2 ) or NCS (5–10 nM) and sonicated in cold IP buffer (50 mM HEPES pH 7.5, 250 mM NaCl, 0.25 NP‐40, 1% glycerol) supplemented with phosphatase inhibitor (PhosSTOP, Roche) and protease inhibitor (complete EDTA‐free, Roche). .. FRET probes were immunoprecipitated from cell extracts using GFP‐Trap (ChromoTek) for 2 h. Beads were washed three times with IP buffer and mixed with SDS sample buffer.

    Article Title: Excess of miRNA-378a-5p perturbs mitotic fidelity and correlates with breast cancer tumourigenesis in vivo
    Article Snippet: Immunoblotting Harvested cells were lysed in 20 mM Tris-HCl (pH 7.7), 100 mM KCl, 50 mM sucrose, 1 mM MgCl2 , 0.1 mM CaCl2 and 0.5% TX-100 (APC-buffer) containing protease inhibitor cocktail (04693132001; Roche, Basel, Switzerland) and phosphatase inhibitor PhosSTOP (4906837001; Roche). .. For measuring the expression of PDGFR-β and p-PDGFR-β , cells were lysed with NP-40 lysis buffer containing 1% NP-40, 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 2 nM EDTA, 1 mM sodium orthovanadate and protease inhibitors (04693132001; Roche). ..

    Sonication:

    Article Title: ATM/Wip1 activities at chromatin control Plk1 re‐activation to determine G2 checkpoint duration
    Article Snippet: Images were acquired using either DeltaVision Spectris imaging system using a 20×, NA 0.7 objective, a Leica DMI6000 Imaging System using a 20×, NA 0.4 objective, or on an ImageXpress system using a 20×, NA 0.45 objective, and quantified as described (Akopyan et al , ). .. U2OS or AT cells expressing ATKAR, H2B‐ATKAR, or H2B‐PLK1 FRET probe were collected 1 h after exposure to IR (5 Gy) or UVC (10–40 J/m2 ) or NCS (5–10 nM) and sonicated in cold IP buffer (50 mM HEPES pH 7.5, 250 mM NaCl, 0.25 NP‐40, 1% glycerol) supplemented with phosphatase inhibitor (PhosSTOP, Roche) and protease inhibitor (complete EDTA‐free, Roche). .. FRET probes were immunoprecipitated from cell extracts using GFP‐Trap (ChromoTek) for 2 h. Beads were washed three times with IP buffer and mixed with SDS sample buffer.

    Article Title: Extracellular vesicles with altered tetraspanin CD9 and CD151 levels confer increased prostate cell motility and invasion
    Article Snippet: Cell and EV lysates were prepared in a reducing or non-reducing (without 2-mercaptoethanol) sample buffer (50 mM Tris-HCl pH 6.8, 5% glycerol, 2% SDS, 1.5% 2-mercaptoethanol with bromophenol blue) and heated at 70 °C, 5 min. Lysates (10 µg) were electrophoresed and transferred to nitrocellulose, followed by incubation in Ponceau-S. ). .. Isolated RWPE1, CD9 low, CD151 high and WPE1-NB26 EVs pooled from three separate replicate EV preparations, equivalent to 150 µg, were suspended in ice-cold 0.1 M Na2 CO3 , pH 11, with cOmplete Protease and PhosSTOP phosphatase inhibitors (Roche), sonicated and incubated at −20 °C overnight. .. Samples were concentrated using a 10 kDa centrifugal filter unit (Merck Millipore) and washed with 50 mM triethylammonium bicarbonate (TEAB).

    Radio Immunoprecipitation:

    Article Title: Novel Immunomodulatory Flagellin-Like Protein FlaC in Campylobacter jejuni and Other Campylobacterales
    Article Snippet: Visualization of immuno-reactive bands was obtained using the Super Signal West Pico chemiluminescent substrate (Pierce, Thermo Scientific, Bonn, Germany) and enhanced-chemiluminescence (ECL) hyperfilm (GE Healthcare, Piscataway, NJ). .. Analysis of phosphoproteins (P-p38, anti-P-p38 antibody, rabbit 92115; Cell Signalling Technology; used at a 1:1,000 dilution) of coincubated cells was performed on Western blots from cleared cell lysates prepared in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, protease inhibitor cocktail Complete [Roche], phosphatase inhibitor cocktail PhosStop [Roche]). .. Anti-p38 MAPK antibody (rabbit 92125; Cell Signalling Technology) was used on the same blots as a control for total p38.

    Isolation:

    Article Title: Extracellular vesicles with altered tetraspanin CD9 and CD151 levels confer increased prostate cell motility and invasion
    Article Snippet: Cell and EV lysates were prepared in a reducing or non-reducing (without 2-mercaptoethanol) sample buffer (50 mM Tris-HCl pH 6.8, 5% glycerol, 2% SDS, 1.5% 2-mercaptoethanol with bromophenol blue) and heated at 70 °C, 5 min. Lysates (10 µg) were electrophoresed and transferred to nitrocellulose, followed by incubation in Ponceau-S. ). .. Isolated RWPE1, CD9 low, CD151 high and WPE1-NB26 EVs pooled from three separate replicate EV preparations, equivalent to 150 µg, were suspended in ice-cold 0.1 M Na2 CO3 , pH 11, with cOmplete Protease and PhosSTOP phosphatase inhibitors (Roche), sonicated and incubated at −20 °C overnight. .. Samples were concentrated using a 10 kDa centrifugal filter unit (Merck Millipore) and washed with 50 mM triethylammonium bicarbonate (TEAB).

    Incubation:

    Article Title: Extracellular vesicles with altered tetraspanin CD9 and CD151 levels confer increased prostate cell motility and invasion
    Article Snippet: Cell and EV lysates were prepared in a reducing or non-reducing (without 2-mercaptoethanol) sample buffer (50 mM Tris-HCl pH 6.8, 5% glycerol, 2% SDS, 1.5% 2-mercaptoethanol with bromophenol blue) and heated at 70 °C, 5 min. Lysates (10 µg) were electrophoresed and transferred to nitrocellulose, followed by incubation in Ponceau-S. ). .. Isolated RWPE1, CD9 low, CD151 high and WPE1-NB26 EVs pooled from three separate replicate EV preparations, equivalent to 150 µg, were suspended in ice-cold 0.1 M Na2 CO3 , pH 11, with cOmplete Protease and PhosSTOP phosphatase inhibitors (Roche), sonicated and incubated at −20 °C overnight. .. Samples were concentrated using a 10 kDa centrifugal filter unit (Merck Millipore) and washed with 50 mM triethylammonium bicarbonate (TEAB).

    Lysis:

    Article Title: Excess of miRNA-378a-5p perturbs mitotic fidelity and correlates with breast cancer tumourigenesis in vivo
    Article Snippet: Immunoblotting Harvested cells were lysed in 20 mM Tris-HCl (pH 7.7), 100 mM KCl, 50 mM sucrose, 1 mM MgCl2 , 0.1 mM CaCl2 and 0.5% TX-100 (APC-buffer) containing protease inhibitor cocktail (04693132001; Roche, Basel, Switzerland) and phosphatase inhibitor PhosSTOP (4906837001; Roche). .. For measuring the expression of PDGFR-β and p-PDGFR-β , cells were lysed with NP-40 lysis buffer containing 1% NP-40, 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 2 nM EDTA, 1 mM sodium orthovanadate and protease inhibitors (04693132001; Roche). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Roche anti flag conjugated beads sigma aldrich
    MFF regulation of mitochondrial outer membrane permeability. (a – c) PC3 cells were transfected with vector, Flag-MFF1 (a), Flag-MFF2 (b) or Flag-MFF5 (c), <t>immunoprecipitated</t> (IP) with an antibody to Flag and analysed by Western blotting. Sup, supernatant; Unb, unbound. (d) PC3 cells transfected with siCtrl or siMFF (top) or treated with H 2 O 2 (bottom) were labelled with calcein in the presence of CoCl 2 and analysed by flow cytometry. Numbers indicate fluorescence units per each condition. None, untreated. (e and f) PC3 cells transfected with siCtrl or siMFF were incubated with Fluoro3-AM and FLUO-5 N or, alternatively Rhod2-AM, and changes in mitochondrial (Mito)-, endoplasmic reticulum (ER)- or cytosolic (Cytosol)-associated Ca 2+ levels were determined by flow cytometry (e, representative experiment) and quantified (f). Numbers correspond to fluorescence units. Mean ± SD. (g) DU145 (top) or PC3 (bottom) cells were transfected with siCtrl or MFF-directed siRNA (siMFF) and analysed for mitochondrial inner membrane potential by TMRE staining and flow cytometry with or without suboptimal concentrations of the uncoupler, FCCP. Representative experiment ( n = 3). (h) The conditions are as in (g) and TMRE staining was quantified in siRNA-transfected DU145 and PC3 cells. Mean ± SD.
    Anti Flag Conjugated Beads Sigma Aldrich, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti flag conjugated beads sigma aldrich/product/Roche
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti flag conjugated beads sigma aldrich - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    86
    Roche phosphatase inhibitor phosstop
    Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor <t>PhosSTOP</t> and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P
    Phosphatase Inhibitor Phosstop, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphatase inhibitor phosstop/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phosphatase inhibitor phosstop - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Roche phosstop phosphatase inhibitor cocktail
    Detection of two variants of caldendrin but not CaBP1 in WT but not C-KO mouse brain ( A ) Western blot with CaBP1/CD antibodies (top panel) and ponceau staining of the same blot (lower panel) to indicate amount of protein loaded. Lanes 1-4 contain lysates from HEK293T cells transfected with cDNAs for CaBP1-S, CaBP1-L or caldendrin starting from Met53 (CD-S) or from Met1 (CD-L) according to the sequence numbering in ( C ). Lanes 5-8 contain lysates from the forebrain (FBR) or cerebellum (CBL) of WT or C-KO mice. ( B ) Effect of phosphatase inhibitor on bands detected by CaBP1/CD antibodies. Brain lysates were incubated with (+) or without (-) <t>PhosStop</t> phosphatase inhibitor prior to SDS-PAGE and western blotting with CaBP1/CD antibodies. Detection with β-actin antibodies was used to confirm equal loading in the lanes. ( C ) Alignment of the amino acid sequence of CaBP1 variants (CaBP1-S, CaBP1-L) and caldendrin. Potential alternative translation start sites for caldendrin are indicated by arrows. Arrowheads mark region corresponding to antigen used to raise CaBP1/CD antibodies. EF-hand domains are underlined, with bold line indicating non-functional EF-hand 2. Numbers correspond to amino acids of the corresponding mouse sequences. ( D ) Alignment of caldendrin N-terminal mRNA sequences from different species with canonical Kozak sequence (GccRccAUGG), indicated. Potential translation start sites are indicated in bold type. Highly conserved purine (R) at the -3 position and guanine residues at -6 and +4 are indicated in red. ( E ) Alignment of caldendrin N-terminal amino acid sequences from different species. In C-E , numbers in correspond to nucleotide or amino acid sequences available in GenBank. Alignments were generated using the MultAlin multiple sequence alignment application.
    Phosstop Phosphatase Inhibitor Cocktail, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosstop phosphatase inhibitor cocktail/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phosstop phosphatase inhibitor cocktail - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    MFF regulation of mitochondrial outer membrane permeability. (a – c) PC3 cells were transfected with vector, Flag-MFF1 (a), Flag-MFF2 (b) or Flag-MFF5 (c), immunoprecipitated (IP) with an antibody to Flag and analysed by Western blotting. Sup, supernatant; Unb, unbound. (d) PC3 cells transfected with siCtrl or siMFF (top) or treated with H 2 O 2 (bottom) were labelled with calcein in the presence of CoCl 2 and analysed by flow cytometry. Numbers indicate fluorescence units per each condition. None, untreated. (e and f) PC3 cells transfected with siCtrl or siMFF were incubated with Fluoro3-AM and FLUO-5 N or, alternatively Rhod2-AM, and changes in mitochondrial (Mito)-, endoplasmic reticulum (ER)- or cytosolic (Cytosol)-associated Ca 2+ levels were determined by flow cytometry (e, representative experiment) and quantified (f). Numbers correspond to fluorescence units. Mean ± SD. (g) DU145 (top) or PC3 (bottom) cells were transfected with siCtrl or MFF-directed siRNA (siMFF) and analysed for mitochondrial inner membrane potential by TMRE staining and flow cytometry with or without suboptimal concentrations of the uncoupler, FCCP. Representative experiment ( n = 3). (h) The conditions are as in (g) and TMRE staining was quantified in siRNA-transfected DU145 and PC3 cells. Mean ± SD.

    Journal: EBioMedicine

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer

    doi: 10.1016/j.ebiom.2019.09.017

    Figure Lengend Snippet: MFF regulation of mitochondrial outer membrane permeability. (a – c) PC3 cells were transfected with vector, Flag-MFF1 (a), Flag-MFF2 (b) or Flag-MFF5 (c), immunoprecipitated (IP) with an antibody to Flag and analysed by Western blotting. Sup, supernatant; Unb, unbound. (d) PC3 cells transfected with siCtrl or siMFF (top) or treated with H 2 O 2 (bottom) were labelled with calcein in the presence of CoCl 2 and analysed by flow cytometry. Numbers indicate fluorescence units per each condition. None, untreated. (e and f) PC3 cells transfected with siCtrl or siMFF were incubated with Fluoro3-AM and FLUO-5 N or, alternatively Rhod2-AM, and changes in mitochondrial (Mito)-, endoplasmic reticulum (ER)- or cytosolic (Cytosol)-associated Ca 2+ levels were determined by flow cytometry (e, representative experiment) and quantified (f). Numbers correspond to fluorescence units. Mean ± SD. (g) DU145 (top) or PC3 (bottom) cells were transfected with siCtrl or MFF-directed siRNA (siMFF) and analysed for mitochondrial inner membrane potential by TMRE staining and flow cytometry with or without suboptimal concentrations of the uncoupler, FCCP. Representative experiment ( n = 3). (h) The conditions are as in (g) and TMRE staining was quantified in siRNA-transfected DU145 and PC3 cells. Mean ± SD.

    Article Snippet: 2.6 Immunoprecipitation (IP) Cell extracts prepared in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA containing 1% CHAPS, EDTA-free Protease Inhibitor Cocktail (Sigma-Aldrich) and Phosphatase Inhibitor Cocktail PhosSTOP (Roche) were immunoprecipitated with anti-Flag-conjugated beads (Sigma-Aldrich) and processed as described [ ].

    Techniques: Permeability, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot, Flow Cytometry, Cytometry, Fluorescence, Incubation, Staining

    Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P

    Journal: Frontiers in Plant Science

    Article Title: The AMP-Activated Protein Kinase KIN10 Is Involved in the Regulation of Autophagy in Arabidopsis

    doi: 10.3389/fpls.2017.01201

    Figure Lengend Snippet: Overexpression of KIN10 increased the level of ATG1 phosphorylation. (A) Effect of λ protein phosphatase on the SDS-PAGE mobility of YFP-ATG1a. Proteins were extracted form 7-day-old YFP-ATG1a transgenic plants grown on MS medium. Extracts were treated for 1 h with λ phosphatase (Ppase) with or without the phosphatase inhibitor PhosSTOP and then subjected to immunoblot analysis with anti-GFP antibodies. UN, untreated extracts. (B) Immunoblot analysis of ATG1 phosphorylation in the YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants. Seven-day-old YFP-ATG1a and YFP-ATG1a/KIN10-OE transgenic plants were grown on MS-C medium for the indicated times prior to protein extraction. Crude extracts were subjected to SDS-PAGE and immunoblot analysis with anti-GFP antibodies. The p-YFP-ATG1a and YFP-ATG1a bands are indicated on the right. Coomassie blue-stained total proteins (Rubisco) are shown below the blots to indicate the amount of protein loaded per lane. (C) Quantification of the p-YFP-ATG1a/YFP-ATG1a ratio during carbon starvation by densitometric scans of the immunoblots shown in (B) . The data are means ± SD ( n = 3) calculated from three biological replicates. ∗∗ P

    Article Snippet: The supernatant was incubated with λ protein phosphatase (New England Biolabs) with or without addition of phosphatase inhibitor PhosSTOP (Roche) for 30 min at 30°C.

    Techniques: Over Expression, SDS Page, Transgenic Assay, Mass Spectrometry, Protein Extraction, Staining, Western Blot

    Detection of two variants of caldendrin but not CaBP1 in WT but not C-KO mouse brain ( A ) Western blot with CaBP1/CD antibodies (top panel) and ponceau staining of the same blot (lower panel) to indicate amount of protein loaded. Lanes 1-4 contain lysates from HEK293T cells transfected with cDNAs for CaBP1-S, CaBP1-L or caldendrin starting from Met53 (CD-S) or from Met1 (CD-L) according to the sequence numbering in ( C ). Lanes 5-8 contain lysates from the forebrain (FBR) or cerebellum (CBL) of WT or C-KO mice. ( B ) Effect of phosphatase inhibitor on bands detected by CaBP1/CD antibodies. Brain lysates were incubated with (+) or without (-) PhosStop phosphatase inhibitor prior to SDS-PAGE and western blotting with CaBP1/CD antibodies. Detection with β-actin antibodies was used to confirm equal loading in the lanes. ( C ) Alignment of the amino acid sequence of CaBP1 variants (CaBP1-S, CaBP1-L) and caldendrin. Potential alternative translation start sites for caldendrin are indicated by arrows. Arrowheads mark region corresponding to antigen used to raise CaBP1/CD antibodies. EF-hand domains are underlined, with bold line indicating non-functional EF-hand 2. Numbers correspond to amino acids of the corresponding mouse sequences. ( D ) Alignment of caldendrin N-terminal mRNA sequences from different species with canonical Kozak sequence (GccRccAUGG), indicated. Potential translation start sites are indicated in bold type. Highly conserved purine (R) at the -3 position and guanine residues at -6 and +4 are indicated in red. ( E ) Alignment of caldendrin N-terminal amino acid sequences from different species. In C-E , numbers in correspond to nucleotide or amino acid sequences available in GenBank. Alignments were generated using the MultAlin multiple sequence alignment application.

    Journal: Neuroscience

    Article Title: Localization and expression of CaBP1/caldendrin in the mouse brain

    doi: 10.1016/j.neuroscience.2014.02.052

    Figure Lengend Snippet: Detection of two variants of caldendrin but not CaBP1 in WT but not C-KO mouse brain ( A ) Western blot with CaBP1/CD antibodies (top panel) and ponceau staining of the same blot (lower panel) to indicate amount of protein loaded. Lanes 1-4 contain lysates from HEK293T cells transfected with cDNAs for CaBP1-S, CaBP1-L or caldendrin starting from Met53 (CD-S) or from Met1 (CD-L) according to the sequence numbering in ( C ). Lanes 5-8 contain lysates from the forebrain (FBR) or cerebellum (CBL) of WT or C-KO mice. ( B ) Effect of phosphatase inhibitor on bands detected by CaBP1/CD antibodies. Brain lysates were incubated with (+) or without (-) PhosStop phosphatase inhibitor prior to SDS-PAGE and western blotting with CaBP1/CD antibodies. Detection with β-actin antibodies was used to confirm equal loading in the lanes. ( C ) Alignment of the amino acid sequence of CaBP1 variants (CaBP1-S, CaBP1-L) and caldendrin. Potential alternative translation start sites for caldendrin are indicated by arrows. Arrowheads mark region corresponding to antigen used to raise CaBP1/CD antibodies. EF-hand domains are underlined, with bold line indicating non-functional EF-hand 2. Numbers correspond to amino acids of the corresponding mouse sequences. ( D ) Alignment of caldendrin N-terminal mRNA sequences from different species with canonical Kozak sequence (GccRccAUGG), indicated. Potential translation start sites are indicated in bold type. Highly conserved purine (R) at the -3 position and guanine residues at -6 and +4 are indicated in red. ( E ) Alignment of caldendrin N-terminal amino acid sequences from different species. In C-E , numbers in correspond to nucleotide or amino acid sequences available in GenBank. Alignments were generated using the MultAlin multiple sequence alignment application.

    Article Snippet: For phosphatase inhibitor assays , lysates were incubated overnight at 4°C with PhosStop phosphatase inhibitor cocktail (Roche) prior to western blotting.

    Techniques: Western Blot, Staining, Transfection, Sequencing, Mouse Assay, Incubation, SDS Page, Functional Assay, Generated