Structured Review

GE Healthcare pgex
Pgex, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex/product/GE Healthcare
Average 99 stars, based on 8 article reviews
Price from $9.99 to $1999.99
pgex - by Bioz Stars, 2019-10
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF). .. The recombinant proteins were purified by Ni-NTA beads or Glutathione-Sepharose affinity gel and further polished by size-exclusion chromatograph.

Article Title: Immunolocalization of TAR DNA-Binding Protein of 43 kDa (TDP-43) in mouse seminiferous epithelium
Article Snippet: Generation of recombinant proteins corresponding to TDP-43, PURα, and SP-10 were described previously ( ; ). .. GST-tagged TDP-43 proteins were generated by cloning the mouse Tdp43 cDNA, corresponding to amino acids 1-414 (GST-tagged full-length TDP-43) or to amino acids 3–271 (GST-tagged ΔGly TDP-43), into pGEX (GE Healthcare Life Sciences, PA, USA). .. GST fusion proteins were purified using the Pierce Glutathione agarose resin Kit (Thermo Scientific, MA, USA), as per manufacturer’s instructions.

Article Title: Coronavirus nucleocapsid proteins assemble constitutively in high molecular oligomers
Article Snippet: Wild type MHV-A59 was propagated in LR7 cells in DMEM. .. The sequences coding for either full-length MHV N protein or its truncations, i.e. N1 (amino acids 1 to 194), N2a (amino acids 195 to 257) and N2b-N3 (amino acids 258 to 454), were amplified by PCR from MHV gRNA and cloned into pET32c (EMD Millipore, Amsterdam, The Netherlands) and pGEX (GE Healthcare, Little Chalfont, United Kingdom) vectors using Bam HI and Xho I, creating the pET32c-N, pET32C-N1, pET32C-N2a, pET32C-N2b-N3, pGEX-N, pGEX-N1, pGEX-N2a and pGEX-N2b-N3 constructs. .. The SARS-CoV N protein coding sequence or its truncations N1-N2a (amino acids 1 to 260) and N2a (amino acids 189 to 260) were also amplified by PCR and cloned into pET32c and pGEX vectors using Xho I and Not I to create pET32c-SARS-CoV-N, pET32c-SARS-CoV-N1-N2a, pGEX-SARS-CoV-N, pGEX-SARS-CoV-N1-N2a and pGEX-SARS-CoV-N2a.

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors.

Article Title: BMK1 is involved in the regulation of p53 through disrupting the PML-MDM2 interaction
Article Snippet: FLAG-tagged PML isoforms ( ) were a kind gift from Dr. Leppard at the University of Warwick (Coventry, United Kingdom). .. Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ). .. PML null and control MEF lines were generous gifts from Dr. Myung Kim at the National Institutes of Health (NIH; Bethesda, MD) and Dr. Giovanni Blandino at the Regina Elena Cancer Institute (Rome, Italy).

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In the same way cloning vectors were successively derived from each other, many expression vectors were derived from pUC‐series as the lacUV5 mutant (Rodriquez and Denhardt, ), which contains just two base pair mutations in the −10 hexamer of the classical lac promoter and the tac hybrid promoter (Rodriquez and Denhardt, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: BAX was cloned in pTYB1 (New England Biolabs), fused at its C-terminus with an intein-chitin binding domain construct. .. Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ). .. Unlabeled proteins were expressed in LB media, isotopically labeled ones in MOPS minimal media supplemented with labeling reagents dissolved in H2 O or D2 O. Cultures were grown at 37 °C to an OD600nm of 0.6, then induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 5 hours at 37 °C and harvested.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In the same way cloning vectors were successively derived from each other, many expression vectors were derived from pUC‐series as the lacUV5 mutant (Rodriquez and Denhardt, ), which contains just two base pair mutations in the −10 hexamer of the classical lac promoter and the tac hybrid promoter (Rodriquez and Denhardt, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title:
Article Snippet: Proteins were assessed to at least 95% purity by Coomassie stain and/or mass spectrometry. .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. Human, ameba, zebrafish, frog, and “mosaic” LRRK2 kinase domains were synthesized by GenScript with codon optimization and cloned into the pet21a(+)-GST vector.

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: Recombinant proteins were expressed in Escherichia coli BL21. .. The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins. .. PROS and CHMP1A were amplified from the ABRC clones and , respectively.

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: His6 - or GST-tagged recombinant proteins were generated for use in binding assays. .. Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. Proteins were expressed in BL21 DE3 cells following standard techniques.

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: Bound proteins were eluted with SDS-PAGE loading buffer, separated by 10% SDS-PAGE, and visualized either by Coomassie blue staining or by Western blotting. .. The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. This results in a GST-PTB fusion protein biotinylated at the 10-residue acceptor sequence IFEAQ K WMEWRggs (biotin target residue underlined; spacer sequence in small case) that is part of the linker region between the GST and PTB domains.

Centrifugation:

Article Title:
Article Snippet: For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. After one freeze-thaw cycle, lysozyme was added to the cell pellet to a final concentration of 100 μg/ml, followed by incubation on ice for 15 min.

Amplification:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: Antibodies against Kif26b were generated using a previously described antigen ( ). .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Forward: gatcggccggcctaccatgcgaaacgtgcaagagcctgagtcc; Reverse: gatcggcgcgccttatcggcgcctggaggtgatgtc.

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: To accelerate construct screening we further inserted a ccdB promoter and gene cassette, amplified from pDONR211 (Invitrogen, Grand Island, NY), inside the multi-cloning site. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome. .. All amplifications were performed using high fidelity Phusion polymerase (New England Biolabs, Ipswich, MA), and vectors were constructed using seamless cloning methods (Gibson Assembly, New England Biolabs).

Article Title: Coronavirus nucleocapsid proteins assemble constitutively in high molecular oligomers
Article Snippet: Wild type MHV-A59 was propagated in LR7 cells in DMEM. .. The sequences coding for either full-length MHV N protein or its truncations, i.e. N1 (amino acids 1 to 194), N2a (amino acids 195 to 257) and N2b-N3 (amino acids 258 to 454), were amplified by PCR from MHV gRNA and cloned into pET32c (EMD Millipore, Amsterdam, The Netherlands) and pGEX (GE Healthcare, Little Chalfont, United Kingdom) vectors using Bam HI and Xho I, creating the pET32c-N, pET32C-N1, pET32C-N2a, pET32C-N2b-N3, pGEX-N, pGEX-N1, pGEX-N2a and pGEX-N2b-N3 constructs. .. The SARS-CoV N protein coding sequence or its truncations N1-N2a (amino acids 1 to 260) and N2a (amino acids 189 to 260) were also amplified by PCR and cloned into pET32c and pGEX vectors using Xho I and Not I to create pET32c-SARS-CoV-N, pET32c-SARS-CoV-N1-N2a, pGEX-SARS-CoV-N, pGEX-SARS-CoV-N1-N2a and pGEX-SARS-CoV-N2a.

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The N-terminal deletion mutant of LongV3 (HA–del-N, or Flag–del-N, 19–508 aa of LongV3; common region of Long-IRBIT) were amplified by PCR and subcloned into pcDNA3.1zeo(+) vector including the HA or Flag sequence. .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins. .. PROS and CHMP1A were amplified from the ABRC clones and , respectively.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: The recombinant plasmids were propagated in E. coli XL-1 Blue, DH5α or DH10B and sequenced in order to check the cDNA insert for errors introduced during the amplification process. .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Filtration:

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. The resulting pGEX-BiotinN-PTB construct was transformed into E. coli BL21(DE3) cells for expression.

Mass Spectrometry:

Article Title:
Article Snippet: Proteins were assessed to at least 95% purity by Coomassie stain and/or mass spectrometry. .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Construct:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: The constructs were transformed into DH10Bac competent cells to get bacmids. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: To accelerate construct screening we further inserted a ccdB promoter and gene cassette, amplified from pDONR211 (Invitrogen, Grand Island, NY), inside the multi-cloning site. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome.

Article Title: Coronavirus nucleocapsid proteins assemble constitutively in high molecular oligomers
Article Snippet: Wild type MHV-A59 was propagated in LR7 cells in DMEM. .. The sequences coding for either full-length MHV N protein or its truncations, i.e. N1 (amino acids 1 to 194), N2a (amino acids 195 to 257) and N2b-N3 (amino acids 258 to 454), were amplified by PCR from MHV gRNA and cloned into pET32c (EMD Millipore, Amsterdam, The Netherlands) and pGEX (GE Healthcare, Little Chalfont, United Kingdom) vectors using Bam HI and Xho I, creating the pET32c-N, pET32C-N1, pET32C-N2a, pET32C-N2b-N3, pGEX-N, pGEX-N1, pGEX-N2a and pGEX-N2b-N3 constructs. .. The SARS-CoV N protein coding sequence or its truncations N1-N2a (amino acids 1 to 260) and N2a (amino acids 189 to 260) were also amplified by PCR and cloned into pET32c and pGEX vectors using Xho I and Not I to create pET32c-SARS-CoV-N, pET32c-SARS-CoV-N1-N2a, pGEX-SARS-CoV-N, pGEX-SARS-CoV-N1-N2a and pGEX-SARS-CoV-N2a.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: BAX was cloned in pTYB1 (New England Biolabs), fused at its C-terminus with an intein-chitin binding domain construct. .. Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Paragraph title: Constructs and mutagenesis ... The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Paragraph title: DNA Constructs ... Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors.

Incubation:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Protein expression was induced in the E. coli strain BL21(DE3) using IPTG (0.3 mM).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. For protein extraction, bacterial pellets from a 100-ml culture were resuspended in 20 ml STE buffer (10 m m Tris-HCl, 150 m m NaCl, and 1 m m EDTA (pH 7.5)).

Activity Assay:

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Paragraph title: SAHH activity assays ... Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography.

Solubility:

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: To accelerate construct screening we further inserted a ccdB promoter and gene cassette, amplified from pDONR211 (Invitrogen, Grand Island, NY), inside the multi-cloning site. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome. .. All amplifications were performed using high fidelity Phusion polymerase (New England Biolabs, Ipswich, MA), and vectors were constructed using seamless cloning methods (Gibson Assembly, New England Biolabs).

Expressing:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli .

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: Paragraph title: Construction of protein expression plasmids ... Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome.

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: BMK1 is involved in the regulation of p53 through disrupting the PML-MDM2 interaction
Article Snippet: FLAG-tagged PML isoforms ( ) were a kind gift from Dr. Leppard at the University of Warwick (Coventry, United Kingdom). .. Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ). .. PML null and control MEF lines were generous gifts from Dr. Myung Kim at the National Institutes of Health (NIH; Bethesda, MD) and Dr. Giovanni Blandino at the Regina Elena Cancer Institute (Rome, Italy).

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: Expression vectors encoding HA-IRBIT, HA-LongV2, Flag-IRBIT, Flag-LongV2, GFP-IRBIT, GFP-LongV2, Fip1L-myc, NBCe1-B, GST-EL, Camuiα, and MBP–NBCe1-B/N1 were described previously ( , , , , ). .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title:
Article Snippet: Proteins were assessed to at least 95% purity by Coomassie stain and/or mass spectrometry. .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. Human, ameba, zebrafish, frog, and “mosaic” LRRK2 kinase domains were synthesized by GenScript with codon optimization and cloned into the pet21a(+)-GST vector.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: Paragraph title: Expression of recombinant proteins in Escherichia coli ... The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: His6 - or GST-tagged recombinant proteins were generated for use in binding assays. .. Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. Proteins were expressed in BL21 DE3 cells following standard techniques.

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. This results in a GST-PTB fusion protein biotinylated at the 10-residue acceptor sequence IFEAQ K WMEWRggs (biotin target residue underlined; spacer sequence in small case) that is part of the linker region between the GST and PTB domains.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector. .. Experiments involving animals were approved by the institutional Animal Care and Use Committee at Chiba University (Approval number; #A27-12), and the methods were carried out in accordance with the relevant guidelines and regulations.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Modification:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: Antibodies against Kif26b were generated using a previously described antigen ( ). .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Forward: gatcggccggcctaccatgcgaaacgtgcaagagcctgagtcc; Reverse: gatcggcgcgccttatcggcgcctggaggtgatgtc.

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: Bound proteins were eluted with SDS-PAGE loading buffer, separated by 10% SDS-PAGE, and visualized either by Coomassie blue staining or by Western blotting. .. The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. This results in a GST-PTB fusion protein biotinylated at the 10-residue acceptor sequence IFEAQ K WMEWRggs (biotin target residue underlined; spacer sequence in small case) that is part of the linker region between the GST and PTB domains.

Planar Chromatography:

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Transformation Assay:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. This results in a GST-PTB fusion protein biotinylated at the 10-residue acceptor sequence IFEAQ K WMEWRggs (biotin target residue underlined; spacer sequence in small case) that is part of the linker region between the GST and PTB domains.

Derivative Assay:

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: We have constructed a line of entero-bacterial expression vectors, called pFloat, derived from pET30a (Novagen, Madison, WI) and engineered to include N-terminal His6 - and solubility tags, and a human rhinovirus 3C protease cleavage sequence. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title:
Article Snippet: For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. Cells were harvested by centrifugation and lysed by sonication or French press in buffer containing 50 m m Tris (pH7.5), 150 m m NaCl, 10 m m MgCl2 and 10% Glycerol.

Transfection:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: The bacmids were then transfected into Tn5 cells using cellfectin (Invitrogen). .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Chromatography:

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Infection:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: The supernatants containing baculovirus were collected and used for the following infection to amplify virus. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: DNA was purified from Wolbachia -infected insects according to Beckmann and Fallon. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors.

Hemagglutination Assay:

Article Title: BMK1 is involved in the regulation of p53 through disrupting the PML-MDM2 interaction
Article Snippet: Ad-EV, Ad-PML, pCDNA3 FLAG-tagged BMK1, HA-tagged MEK5D and MEK5A-expressing vectors were described previously ( , , ). .. Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ).

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The N-terminal deletion mutant of LongV3 (HA–del-N, or Flag–del-N, 19–508 aa of LongV3; common region of Long-IRBIT) were amplified by PCR and subcloned into pcDNA3.1zeo(+) vector including the HA or Flag sequence. .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector. .. Experiments involving animals were approved by the institutional Animal Care and Use Committee at Chiba University (Approval number; #A27-12), and the methods were carried out in accordance with the relevant guidelines and regulations.

Generated:

Article Title: Immunolocalization of TAR DNA-Binding Protein of 43 kDa (TDP-43) in mouse seminiferous epithelium
Article Snippet: Generation of recombinant proteins corresponding to TDP-43, PURα, and SP-10 were described previously ( ; ). .. GST-tagged TDP-43 proteins were generated by cloning the mouse Tdp43 cDNA, corresponding to amino acids 1-414 (GST-tagged full-length TDP-43) or to amino acids 3–271 (GST-tagged ΔGly TDP-43), into pGEX (GE Healthcare Life Sciences, PA, USA). .. GST fusion proteins were purified using the Pierce Glutathione agarose resin Kit (Thermo Scientific, MA, USA), as per manufacturer’s instructions.

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: Antibodies against Kif26b were generated using a previously described antigen ( ). .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli .

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. Although the diversity of bacterial vectors has enormously increased during the decades following the discovery of the recombinant DNA technology, the design and architecture of those tools occurred rather unsystematically.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. Although the diversity of bacterial vectors has enormously increased during the decades following the discovery of the recombinant DNA technology, the design and architecture of those tools occurred rather unsystematically.

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: His6 - or GST-tagged recombinant proteins were generated for use in binding assays. .. Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector.

Sequencing:

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: We have constructed a line of entero-bacterial expression vectors, called pFloat, derived from pET30a (Novagen, Madison, WI) and engineered to include N-terminal His6 - and solubility tags, and a human rhinovirus 3C protease cleavage sequence. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome.

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The N-terminal deletion mutant of LongV3 (HA–del-N, or Flag–del-N, 19–508 aa of LongV3; common region of Long-IRBIT) were amplified by PCR and subcloned into pcDNA3.1zeo(+) vector including the HA or Flag sequence. .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: Sequence analyses were performed with the Gene Inspector™ and the Gene Construction Kit 2™ programs (Textco, Inc, West Lebanon, New Hampshire). .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Sonication:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF). .. The recombinant proteins were purified by Ni-NTA beads or Glutathione-Sepharose affinity gel and further polished by size-exclusion chromatograph.

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Protein expression was induced in the E. coli strain BL21(DE3) using IPTG (0.3 mM).

Article Title:
Article Snippet: For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. After one freeze-thaw cycle, lysozyme was added to the cell pellet to a final concentration of 100 μg/ml, followed by incubation on ice for 15 min.

Binding Assay:

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: BAX was cloned in pTYB1 (New England Biolabs), fused at its C-terminus with an intein-chitin binding domain construct. .. Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: His6 - or GST-tagged recombinant proteins were generated for use in binding assays. .. Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: PRIP, whose Arg at position 134 was replaced with Gln to produce the mutants of R134Q and R134Q/ΔC2 for diminishing PtdIns(4,5)P2 binding, was prepared from the templates, EGFP-PRIP-WT and EGFP-PRIPΔC2, respectively, using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) as described previously ( ). .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors.

Nucleic Acid Electrophoresis:

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: The PCR fragment was purified by gel electrophoresis cut with enzymes and ligated into the protein expression plasmid pGEX-4T3 so that the coding region of the protein was made as a fusion protein with glutathion-S transferase, GST according to the manufacturer (GE Healthcare). .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Mutagenesis:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The N-terminal deletion mutant of LongV3 (HA–del-N, or Flag–del-N, 19–508 aa of LongV3; common region of Long-IRBIT) were amplified by PCR and subcloned into pcDNA3.1zeo(+) vector including the HA or Flag sequence. .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In the same way cloning vectors were successively derived from each other, many expression vectors were derived from pUC‐series as the lacUV5 mutant (Rodriquez and Denhardt, ), which contains just two base pair mutations in the −10 hexamer of the classical lac promoter and the tac hybrid promoter (Rodriquez and Denhardt, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In the same way cloning vectors were successively derived from each other, many expression vectors were derived from pUC‐series as the lacUV5 mutant (Rodriquez and Denhardt, ), which contains just two base pair mutations in the −10 hexamer of the classical lac promoter and the tac hybrid promoter (Rodriquez and Denhardt, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Paragraph title: Constructs and mutagenesis ... The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: PRIP, whose Arg at position 134 was replaced with Gln to produce the mutants of R134Q and R134Q/ΔC2 for diminishing PtdIns(4,5)P2 binding, was prepared from the templates, EGFP-PRIP-WT and EGFP-PRIPΔC2, respectively, using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) as described previously ( ). .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors.

Isolation:

Article Title:
Article Snippet: For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen). .. Cells were harvested by centrifugation and lysed by sonication or French press in buffer containing 50 m m Tris (pH7.5), 150 m m NaCl, 10 m m MgCl2 and 10% Glycerol.

Subcloning:

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: After subcloning, the plasmid was sequenced to insure that no PCR errors were introduced. .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Purification:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Recombinant proteins were purified by Ni-NTA beads. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: DNA was purified from Wolbachia -infected insects according to Beckmann and Fallon. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors.

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells through KIF2A phosphorylation
Article Snippet: Recombinant GST-fused proteins were produced in Escherichia coli (XL-1 blue, BL21DE3, or RosettaDE3) using isopropyl-β-d -thiogalactopyranoside and were purified as described previously ( ; ). .. To produce GST, GST-EB1, and GST-EB3, we used pGEX (GE Healthcare).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title:
Article Snippet: Human recombinant WT and G2019S-LRRK2 protein purified from SF9 insect cells was purchased from Invitrogen (Δ970, N-terminal GST tag). .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins. .. For the GST alone control, the pGEX vector was used.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: The recombinant plasmids were propagated in E. coli XL-1 Blue, DH5α or DH10B and sequenced in order to check the cDNA insert for errors introduced during the amplification process. .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare). .. As a control, pure GST protein was purified from cells transformed with the pGEX-4T3 vector containing no insert.

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. The resulting pGEX-BiotinN-PTB construct was transformed into E. coli BL21(DE3) cells for expression.

Protein Purification:

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ). .. For constructs cont aining p53-DBD, the media was cooled to 20 °C, supplemented with 0.2 mM ZnSO4 or CoSO4 30′ prior to IPTG induction for 16 hours.

Article Title: TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells through KIF2A phosphorylation
Article Snippet: Paragraph title: Protein purification and biochemistry ... To produce GST, GST-EB1, and GST-EB3, we used pGEX (GE Healthcare).

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: Paragraph title: Protein Purification and Interaction Assays ... The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins.

Polymerase Chain Reaction:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: Antibodies against Kif26b were generated using a previously described antigen ( ). .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Forward: gatcggccggcctaccatgcgaaacgtgcaagagcctgagtcc; Reverse: gatcggcgcgccttatcggcgcctggaggtgatgtc.

Article Title: Coronavirus nucleocapsid proteins assemble constitutively in high molecular oligomers
Article Snippet: Wild type MHV-A59 was propagated in LR7 cells in DMEM. .. The sequences coding for either full-length MHV N protein or its truncations, i.e. N1 (amino acids 1 to 194), N2a (amino acids 195 to 257) and N2b-N3 (amino acids 258 to 454), were amplified by PCR from MHV gRNA and cloned into pET32c (EMD Millipore, Amsterdam, The Netherlands) and pGEX (GE Healthcare, Little Chalfont, United Kingdom) vectors using Bam HI and Xho I, creating the pET32c-N, pET32C-N1, pET32C-N2a, pET32C-N2b-N3, pGEX-N, pGEX-N1, pGEX-N2a and pGEX-N2b-N3 constructs. .. The SARS-CoV N protein coding sequence or its truncations N1-N2a (amino acids 1 to 260) and N2a (amino acids 189 to 260) were also amplified by PCR and cloned into pET32c and pGEX vectors using Xho I and Not I to create pET32c-SARS-CoV-N, pET32c-SARS-CoV-N1-N2a, pGEX-SARS-CoV-N, pGEX-SARS-CoV-N1-N2a and pGEX-SARS-CoV-N2a.

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The N-terminal deletion mutant of LongV3 (HA–del-N, or Flag–del-N, 19–508 aa of LongV3; common region of Long-IRBIT) were amplified by PCR and subcloned into pcDNA3.1zeo(+) vector including the HA or Flag sequence. .. The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography. .. Primers used for amplification of βC1 and SAHH prior to insertion in expression vectors are given ( ).

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: After subcloning, the plasmid was sequenced to insure that no PCR errors were introduced. .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector. .. Experiments involving animals were approved by the institutional Animal Care and Use Committee at Chiba University (Approval number; #A27-12), and the methods were carried out in accordance with the relevant guidelines and regulations.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Protein Extraction:

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively.

Selection:

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: The pUC‐series vectors are mainly composed of a lac promoter–operator and require compatible hosts for α‐complementation (blue/white screening system that allows recovering of functional β‐galactosidase LacZ), providing a positive selection for recombinants. .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: The pUC‐series vectors are mainly composed of a lac promoter–operator and require compatible hosts for α‐complementation (blue/white screening system that allows recovering of functional β‐galactosidase LacZ), providing a positive selection for recombinants. .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Plasmid Preparation:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: Antibodies against Kif26b were generated using a previously described antigen ( ). .. A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Forward: gatcggccggcctaccatgcgaaacgtgcaagagcctgagtcc; Reverse: gatcggcgcgccttatcggcgcctggaggtgatgtc.

Article Title: The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation
Article Snippet: To accelerate construct screening we further inserted a ccdB promoter and gene cassette, amplified from pDONR211 (Invitrogen, Grand Island, NY), inside the multi-cloning site. .. Various solubility tags included thioredoxin (TRX), glutathione S-transferase (GST), S-tag, colicin E9 immunity protein (Im9), maltose-binding protein (MBP), small ubiquiting-like modifier (SUMO), haloalkane dehalogenase (HALO), trigger factor (TF), N utilization substance protein A (NusA), acidic protein MsyB, yellow fluorescent protein (YFP) and enhanced green fluorescent protein (eGFP); the solubility tag sequences were amplified from the pOPIN ( ) and pGEX (GE Healthcare, Little Chalfont, UK) vector systems, or directly from the Escherichia coli strain BL21 genome. .. All amplifications were performed using high fidelity Phusion polymerase (New England Biolabs, Ipswich, MA), and vectors were constructed using seamless cloning methods (Gibson Assembly, New England Biolabs).

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: BMK1 is involved in the regulation of p53 through disrupting the PML-MDM2 interaction
Article Snippet: Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ). .. Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ).

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: Paragraph title: Plasmid Construction. ... The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site.

Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
Article Snippet: Arabidopsis SAHH and ADK2 proteins were expressed in N. benthamiana cells using a TRBO vector , and purified from leaf extracts by nickel-NTA chromatography. .. Cloning of SAHH and ADK2 cDNAs has been described, as has expression of ADK2 in TRBO , . βC1 was PCR amplified, inserted into pGEX (GE Healthcare Life Sciences), expressed as a glutathione S-transferase fusion protein (GST-βC1) in E. coli BL21 cells, and purified by glutathione-agarose chromatography.

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: Coding sequences for p53 domains, BCL-xL were cloned into pET28 plasmid (EMD Biosciences) containing a hexa-histidine tag separated from the N-terminus of the protein construct by a Thrombin digestion site. .. Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ).

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins. .. VPS60.1 and IST1 were amplified from Col-0 WT cDNA; SKD1 was amplified using the clone described in ( ) as a template.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: The recombinant plasmids were propagated in E. coli XL-1 Blue, DH5α or DH10B and sequenced in order to check the cDNA insert for errors introduced during the amplification process. .. The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare). .. As a control, pure GST protein was purified from cells transformed with the pGEX-4T3 vector containing no insert.

Article Title: PTB Domain-Directed Substrate Targeting in a Tyrosine Kinase from the Unicellular Choanoflagellate Monosiga brevicollis
Article Snippet: Bound proteins were eluted with SDS-PAGE loading buffer, separated by 10% SDS-PAGE, and visualized either by Coomassie blue staining or by Western blotting. .. The PTB domain of HMTK1 was cloned as an EcoR1 fragment into a modified pGEX (GE Healthcare Life Sciences) bicistronic vector pGEX-4T-BiotinN to express the gene of interest and the biotin ligase (BirA) in the same cell ( ; Chan et al., in press). .. This results in a GST-PTB fusion protein biotinylated at the 10-residue acceptor sequence IFEAQ K WMEWRggs (biotin target residue underlined; spacer sequence in small case) that is part of the linker region between the GST and PTB domains.

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector. .. Experiments involving animals were approved by the institutional Animal Care and Use Committee at Chiba University (Approval number; #A27-12), and the methods were carried out in accordance with the relevant guidelines and regulations.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Both the 5′- and 3′-end regions corresponding to outside the C2 domain of PRIP-1 were amplified by PCR, and the HindIII/SalI fragment of the 5′-end region was first subcloned into HindIII/SalI-digested vector, pEGFP-C3 (Clontech), followed by subcloning the XhoI/SalI fragment of 3′-end region into SalI site of the plasmid prepared as above. .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors.

Dominant Negative Mutation:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Wild type or mutant forms of Ube2D1, Ube2D2, Ube2D3, Ube2D4, Ube2E1, Ube2N, Ube2M, Ube2L3 and ubiquitin were cloned into pET14b with an N-terminal 6XHis tag and expressed in BL21 strain (PJY2), which were induced by 0.2 mM isopropyl-b-D-thiogalactoside (IPTG) for 4 h at 37 °C. pET28a-His-sumo-Riplet WT and its dominant negative form were transformed into BL21 (Transgen Biotech) and their expression were induced by 0.2 mM IPTG for 9 h at 18 °C. .. IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription
Article Snippet: Human cDNAs for FUS was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT Japan (Clone ID #IRAL001I24). cDNAs encoding truncated SAFB1 dN (amino acid 70-915), FUS NT (amino acid 1-270), FUS CT (amino acid 270-526) were generated by PCR. .. The resulting PCR products were subcloned into pAcGFP1 C1 (Clontech), pGEX (GE Healthcare) or FPC1-Myc or HA expression vector.

Functional Assay:

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: The pUC‐series vectors are mainly composed of a lac promoter–operator and require compatible hosts for α‐complementation (blue/white screening system that allows recovering of functional β‐galactosidase LacZ), providing a positive selection for recombinants. .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: The pUC‐series vectors are mainly composed of a lac promoter–operator and require compatible hosts for α‐complementation (blue/white screening system that allows recovering of functional β‐galactosidase LacZ), providing a positive selection for recombinants. .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein.

Recombinant:

Article Title: Ube2D3 and Ube2N are essential for RIG-I-mediated MAVS aggregation in antiviral innate immunity
Article Snippet: Paragraph title: Recombinant protein preparation ... IsoT and vOTU were cloned into pGEX (GE healthcare) with a N-terminal GST tag and expressed in BL21 at 18 °C for 6 h. Bacterial cultures were collected and sonicated in Buffer K (10 mM Tris-Cl pH 7.5, 0.3 M NaCl, 0.5 mM DTT and 1 mM PMSF).

Article Title: Immunolocalization of TAR DNA-Binding Protein of 43 kDa (TDP-43) in mouse seminiferous epithelium
Article Snippet: Paragraph title: 4.1 Recombinant protein production ... GST-tagged TDP-43 proteins were generated by cloning the mouse Tdp43 cDNA, corresponding to amino acids 1-414 (GST-tagged full-length TDP-43) or to amino acids 3–271 (GST-tagged ΔGly TDP-43), into pGEX (GE Healthcare Life Sciences, PA, USA).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: Pin1-induced proline isomerization in cytosolic p53 mediates BAX activation and apoptosis
Article Snippet: Paragraph title: Recombinant proteins production ... Pin1 was cloned as a GST fusion in pGEX (GE Healthcare) ( ).

Article Title: TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells through KIF2A phosphorylation
Article Snippet: Recombinant GST-fused proteins were produced in Escherichia coli (XL-1 blue, BL21DE3, or RosettaDE3) using isopropyl-β-d -thiogalactopyranoside and were purified as described previously ( ; ). .. To produce GST, GST-EB1, and GST-EB3, we used pGEX (GE Healthcare).

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title:
Article Snippet: Paragraph title: Recombinant Proteins and Peptide Substrate, Protein Expression, and Purifications ... For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: Recombinant proteins were expressed in Escherichia coli BL21. .. The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins.

Article Title: Identification and characterization of endonuclein binding proteins: evidence of modulatory effects on signal transduction and chaperone activity
Article Snippet: Paragraph title: Expression of recombinant proteins in Escherichia coli ... The proteins were expressed and purified from E. coli cells essentially as previously described in detail with the pT7-PL vector [ ] and according to the manufacturer with pGEX (GE Healthcare).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Paragraph title: Production of Recombinant Hax-1 Proteins ... Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Produced:

Article Title: BMK1 is involved in the regulation of p53 through disrupting the PML-MDM2 interaction
Article Snippet: FLAG-tagged PML isoforms ( ) were a kind gift from Dr. Leppard at the University of Warwick (Coventry, United Kingdom). .. Expression vectors for GST-BMK1 and PML isoforms were produced by cloning the relative sequences into pGEX (GE Healthcare, Piscataway, NJ). .. PML null and control MEF lines were generous gifts from Dr. Myung Kim at the National Institutes of Health (NIH; Bethesda, MD) and Dr. Giovanni Blandino at the Regina Elena Cancer Institute (Rome, Italy).

Article Title: TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells through KIF2A phosphorylation
Article Snippet: Recombinant GST-fused proteins were produced in Escherichia coli (XL-1 blue, BL21DE3, or RosettaDE3) using isopropyl-β-d -thiogalactopyranoside and were purified as described previously ( ; ). .. To produce GST, GST-EB1, and GST-EB3, we used pGEX (GE Healthcare).

Concentration Assay:

Article Title: Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates
Article Snippet: A C-terminal fragment of Kif26b was PCR amplified using the following primers and subcloned into a modified pGEX (28-9546-63, GE Healthcare, Pittsburgh, PA) vector to generate a GST fusion protein in E. coli . .. Protein expression was induced in the E. coli strain BL21(DE3) using IPTG (0.3 mM).

Article Title: Competition through Dimerization between Antiapoptotic and Proapoptotic HS-1-associated Protein X-1 (Hax-1)
Article Snippet: Full-length rat Hax-1 v1 and v2 were cloned into the pet30a (Novagen, Darmstadt, Germany) and pGEX (GE Life Sciences, Pittsburgh, PA) vectors for expression of His6 - and GST-tagged fusion proteins, respectively. .. For protein extraction, bacterial pellets from a 100-ml culture were resuspended in 20 ml STE buffer (10 m m Tris-HCl, 150 m m NaCl, and 1 m m EDTA (pH 7.5)).

Cell Function Assay:

Article Title: Splicing variation of Long-IRBIT determines the target selectivity of IRBIT family proteins
Article Snippet: The full-length LongV4 was subcloned into pGEX–KG (GE Healthcare) containing a prescission protease cleavage site immediately after thrombin cleavage site. .. The full length of the IRBIT family were subcloned into the pcDNA3.1zeo(+) vector (for nontag), pcDNA3.1–seBFP–P2A vector, or pcDNA3.1–mRFP–P2A vector.

Staining:

Article Title:
Article Snippet: Proteins were assessed to at least 95% purity by Coomassie stain and/or mass spectrometry. .. For bacterial expression vectors, GST tags were cloned from pGEX (GE Healthcare Life Science) into pET21a(+) plasmids (Novagen).

Positron Emission Tomography:

Article Title: A Wolbachia Deubiquitylating Enzyme Induces Cytoplasmic Incompatibility
Article Snippet: Genes from cid and cin operons were cloned from DNA of w Pip-infected C. pipiens Buckeye mosquitoes and from YW w Mel-infected D. melanogaster flies. .. PCR products were amplified with primers listed in using PhusionHF DNA polymerase (New England Biolabs), gel-purified, and ligated into various plasmid vectors, including the pBAD (ThermoFisher; arabinose induction), pET (ThermoFisher; IPTG induction), pCold-GST (gift from Chittaranjan Das; IPTG induction) and pGEX (GE Healthcare; IPTG induction) E. coli expression vectors. .. All plasmid inserts were fully sequenced at the Yale Keck Foundation DNA sequencing facility.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: The art of vector engineering: towards the construction of next‐generation genetic tools
Article Snippet: In addition to pUC‐based vectors, a number of other expression vectors were constructed from the trp ‐promoter, carrying different segments of the trp operon (Enger‐Valk et al ., ; Hallewell and Emtage, ). .. Nowadays, besides pUC18 and pUC19, the pET‐series (Novagen, Madison, WI, USA) vectors, which were also derived from pBR322 (Ramos et al ., ) and pGEX (GE Healthcare Life Sciences), are widely used because they are high copy number expression vectors that contain protein tags that facilitate the subsequent purification of the desired protein. .. These two vectors are best suited for quick and easy heterologous protein expression.

Article Title: A Novel Endosomal Sorting Complex Required for Transport (ESCRT) Component in Arabidopsis thaliana Controls Cell Expansion and Development
Article Snippet: Recombinant proteins were expressed in Escherichia coli BL21. .. The cDNA fragments were cloned either in pGEX (GE Healthcare Life Sciences), pET or both using the restriction sites BamHI and EcoR I for all of them except for IST1 that was cloned between the SalI and NotI sites, to generate N terminus GST- or His6 - fusion proteins. .. PROS and CHMP1A were amplified from the ABRC clones and , respectively.

Article Title: PRIP (Phospholipase C-related but Catalytically Inactive Protein) Inhibits Exocytosis by Direct Interactions with Syntaxin 1 and SNAP-25 through Its C2 Domain
Article Snippet: Domain organization of PRIP-1 and the related proteins used in this study are depicted in . .. Plasmids to express recombinant C2 domain proteins in the bacterial expression system were prepared by subcloning cDNA amplified by PCR from reverse transcripts of rat brain total RNAs into BamHI/SalI site of pGEX (GE Healthcare) or pET-His30 ( ) vectors. .. The primers to amplify each cDNA were as follows: the C2 domains of PRIP-1 (PRIP-C2, amino acid residues 709–849), 5′-TAGGATCCATGGCAAACACAAAGG-3′ and 5′-GGGTCGACGGTTATTGCTATG-3′, PLC-δ1 (PLCδ-C2, amino acid residues 630–755), 5′-GTGGATCCAGGCTCCGTGTCC-3′ and 5′-CGGTCGACGTCCTGGATGGAGATC-3′, rabphilin-3A (Rph-C2B, amino acid residues 529–685), 5′-TAGAATTCCATGGAGCAGGTGGAGCGGATC-3′ and 5′-GCGTCGACCTAGTCGCTCGACACC-3′, synaptotagmin I (Syt-C2A, amino acid residues 142–263), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGGAGATCACGCCAC-3′ (Syt-C2B, amino acid residues 272–408), 5′-GCGGATCCCTGGGTGACATCTGCTTCTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′, (Syt-C2AB, amino acid residues 142–408), 5′-GCGGATCCCTGGGAAAGCTCCAATATTC-3′ and 5′-GCGTCGACCTGCAGAGTGTGCCACTG-3′.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    GE Healthcare pgex 4t2 vector
    The monoclonal antibody V9 epitope in human vimentin corresponds to amino acid residues 411 to 423. Western blot analysis of GST-tagged bacterially expressed human vimentin truncated fragments and an N417T substitution truncated fragment (411–423, 411–423_N417T, 412–422 and 413–421) with the indicated antibodies. Proteins were extracted from E. coli transformed with the <t>pGEX-4T2</t> constructs after one-hour induction with (+) or without (−) IPTG. Equal amounts of total protein (10 µg) were loaded in each lane.
    Pgex 4t2 Vector, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 98/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 4t2 vector/product/GE Healthcare
    Average 98 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    pgex 4t2 vector - by Bioz Stars, 2019-10
    98/100 stars
      Buy from Supplier

    97
    GE Healthcare plasmid pgex 4t 1
    VP1 protein expression in E. coli using various expression vectors . The VP1 protein expression in E. coli BL21(DE3) using the expression vectors, pET28a (A) and <t>pGEX-4T-1</t> (B) was analyzed by SDS-PAGE and Western-blotting. Anti-His tag and anti-GST tag monoclonal antibody were respectively used for the recognition of differently tagged VP1 proteins expressed by the different expression vectors used. Lane M, pre-stained protein marker; lane 1 and lane 3, before IPTG induction; lane 2 and 4, after IPTG induction for 4 h cultivation. The solid triangle pinpoints the expressed VP1 protein.
    Plasmid Pgex 4t 1, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 97/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pgex 4t 1/product/GE Healthcare
    Average 97 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    plasmid pgex 4t 1 - by Bioz Stars, 2019-10
    97/100 stars
      Buy from Supplier

    Image Search Results


    The monoclonal antibody V9 epitope in human vimentin corresponds to amino acid residues 411 to 423. Western blot analysis of GST-tagged bacterially expressed human vimentin truncated fragments and an N417T substitution truncated fragment (411–423, 411–423_N417T, 412–422 and 413–421) with the indicated antibodies. Proteins were extracted from E. coli transformed with the pGEX-4T2 constructs after one-hour induction with (+) or without (−) IPTG. Equal amounts of total protein (10 µg) were loaded in each lane.

    Journal: Molecular Medicine Reports

    Article Title: Precise epitope determination of the anti-vimentin monoclonal antibody V9

    doi: 10.3892/mmr.2017.7102

    Figure Lengend Snippet: The monoclonal antibody V9 epitope in human vimentin corresponds to amino acid residues 411 to 423. Western blot analysis of GST-tagged bacterially expressed human vimentin truncated fragments and an N417T substitution truncated fragment (411–423, 411–423_N417T, 412–422 and 413–421) with the indicated antibodies. Proteins were extracted from E. coli transformed with the pGEX-4T2 constructs after one-hour induction with (+) or without (−) IPTG. Equal amounts of total protein (10 µg) were loaded in each lane.

    Article Snippet: The amplified fragments were digested with Bam HI and Eco RI and cloned into the pGEX-4T2 vector (GE Healthcare, Buckinghamshire, England) digested with the same two enzymes.

    Techniques: Western Blot, Transformation Assay, Construct

    Analysis of the reactivity of the mouse anti-human vimentin monoclonal antibody V9 with vimentin truncation mutants. (A) Schematic representation of full-length and truncated mutants of human vimentin. Vim-FL, full-length (2–466); vim-NT, N-terminal (2–268); vim-CT, C-terminal (167–466) vimentin. All constructs were GST-tagged at the N-terminus. (B) Western blot analysis (WB) using anti-vimentin (V9) or anti-GST antibodies. The proteins were expressed in E. coli using the pGEX-4T2 vector. (C) Schematic representation of full-length (vim-FL) and truncated mutants, vim-CT1 (201–310), vim-CT2 (301–404) and vim-CT3 (392–466), of human vimentin. (D) Western blot analysis of bacterially expressed GST-tagged full-length or truncated mutants of vimentin with the indicated antibodies.

    Journal: Molecular Medicine Reports

    Article Title: Precise epitope determination of the anti-vimentin monoclonal antibody V9

    doi: 10.3892/mmr.2017.7102

    Figure Lengend Snippet: Analysis of the reactivity of the mouse anti-human vimentin monoclonal antibody V9 with vimentin truncation mutants. (A) Schematic representation of full-length and truncated mutants of human vimentin. Vim-FL, full-length (2–466); vim-NT, N-terminal (2–268); vim-CT, C-terminal (167–466) vimentin. All constructs were GST-tagged at the N-terminus. (B) Western blot analysis (WB) using anti-vimentin (V9) or anti-GST antibodies. The proteins were expressed in E. coli using the pGEX-4T2 vector. (C) Schematic representation of full-length (vim-FL) and truncated mutants, vim-CT1 (201–310), vim-CT2 (301–404) and vim-CT3 (392–466), of human vimentin. (D) Western blot analysis of bacterially expressed GST-tagged full-length or truncated mutants of vimentin with the indicated antibodies.

    Article Snippet: The amplified fragments were digested with Bam HI and Eco RI and cloned into the pGEX-4T2 vector (GE Healthcare, Buckinghamshire, England) digested with the same two enzymes.

    Techniques: Construct, Western Blot, Plasmid Preparation

    VP1 protein expression in E. coli using various expression vectors . The VP1 protein expression in E. coli BL21(DE3) using the expression vectors, pET28a (A) and pGEX-4T-1 (B) was analyzed by SDS-PAGE and Western-blotting. Anti-His tag and anti-GST tag monoclonal antibody were respectively used for the recognition of differently tagged VP1 proteins expressed by the different expression vectors used. Lane M, pre-stained protein marker; lane 1 and lane 3, before IPTG induction; lane 2 and 4, after IPTG induction for 4 h cultivation. The solid triangle pinpoints the expressed VP1 protein.

    Journal: Microbial Cell Factories

    Article Title: High yield expression in a recombinant E. coli of a codon optimized chicken anemia virus capsid protein VP1 useful for vaccine development

    doi: 10.1186/1475-2859-10-56

    Figure Lengend Snippet: VP1 protein expression in E. coli using various expression vectors . The VP1 protein expression in E. coli BL21(DE3) using the expression vectors, pET28a (A) and pGEX-4T-1 (B) was analyzed by SDS-PAGE and Western-blotting. Anti-His tag and anti-GST tag monoclonal antibody were respectively used for the recognition of differently tagged VP1 proteins expressed by the different expression vectors used. Lane M, pre-stained protein marker; lane 1 and lane 3, before IPTG induction; lane 2 and 4, after IPTG induction for 4 h cultivation. The solid triangle pinpoints the expressed VP1 protein.

    Article Snippet: Using a specifically designed primer set, forward primer CAV VP1 F: 5'-GCGGAATTCATGGCAAGACGAGCTCGCAGA-3' and reverse primer CAV VP1-R: 5'-GGGCTCGAGTCAGGGCTGCGTCCCCCAGTA-3', respectively containing the EcoR I and Xho I sites, the full-length VP1 gene was amplified using the plasmid pET28a-VP1 as template DNA, and then cloned into the plasmid pGEX-4T-1 (GE healthcare, Piscataway, NJ), which was then designated to be pGEX-4T-1-VP1 (Figure , panel b).

    Techniques: Expressing, SDS Page, Western Blot, Staining, Marker

    Expression of recombinant GST-VP1 protein in three different E. coli strains . The GST-VP1 protein expression in three E. coli strains, BL21(DE3), BL21-CodonPlus(DE3)-RP and BL21(DE3)-pLysS all containing pGEX-4T-1-VP1 was examined. The GST-VP1 protein was examined and detected using SDS-PAGE (A) and Western-blotting (B). Anti-GST tag monoclonal antibody was used to recognize the VP1 protein. Lane M, pre-stained protein marker; lane 1, 4 and 7, before IPTG induction; lane 2, 5 and 8, after IPTG induction for 1 hrs cultivation; lane 3, 6 and 9, after IPTG induction for 4 h cultivation. The solid triangle pinpoints the expressed VP1 protein.

    Journal: Microbial Cell Factories

    Article Title: High yield expression in a recombinant E. coli of a codon optimized chicken anemia virus capsid protein VP1 useful for vaccine development

    doi: 10.1186/1475-2859-10-56

    Figure Lengend Snippet: Expression of recombinant GST-VP1 protein in three different E. coli strains . The GST-VP1 protein expression in three E. coli strains, BL21(DE3), BL21-CodonPlus(DE3)-RP and BL21(DE3)-pLysS all containing pGEX-4T-1-VP1 was examined. The GST-VP1 protein was examined and detected using SDS-PAGE (A) and Western-blotting (B). Anti-GST tag monoclonal antibody was used to recognize the VP1 protein. Lane M, pre-stained protein marker; lane 1, 4 and 7, before IPTG induction; lane 2, 5 and 8, after IPTG induction for 1 hrs cultivation; lane 3, 6 and 9, after IPTG induction for 4 h cultivation. The solid triangle pinpoints the expressed VP1 protein.

    Article Snippet: Using a specifically designed primer set, forward primer CAV VP1 F: 5'-GCGGAATTCATGGCAAGACGAGCTCGCAGA-3' and reverse primer CAV VP1-R: 5'-GGGCTCGAGTCAGGGCTGCGTCCCCCAGTA-3', respectively containing the EcoR I and Xho I sites, the full-length VP1 gene was amplified using the plasmid pET28a-VP1 as template DNA, and then cloned into the plasmid pGEX-4T-1 (GE healthcare, Piscataway, NJ), which was then designated to be pGEX-4T-1-VP1 (Figure , panel b).

    Techniques: Expressing, Recombinant, SDS Page, Western Blot, Staining, Marker

    Growth kinetics and production profiles of GST-VP1 protein in three E. coli strains . (A) Growth profile of BL21(DE3), BL21-CodonPlus(DE3)-RP and BL21(DE3)-pLysS in LB medium post-induction. The production profiles of the three E. coli strains, (B)BL21(DE3)-pLysS, (C)BL21(DE3) and (D)BL21-CodonPlus(DE3)-RP containing pGEX-4T-1-VP1 are shown over time course after IPTG induction.

    Journal: Microbial Cell Factories

    Article Title: High yield expression in a recombinant E. coli of a codon optimized chicken anemia virus capsid protein VP1 useful for vaccine development

    doi: 10.1186/1475-2859-10-56

    Figure Lengend Snippet: Growth kinetics and production profiles of GST-VP1 protein in three E. coli strains . (A) Growth profile of BL21(DE3), BL21-CodonPlus(DE3)-RP and BL21(DE3)-pLysS in LB medium post-induction. The production profiles of the three E. coli strains, (B)BL21(DE3)-pLysS, (C)BL21(DE3) and (D)BL21-CodonPlus(DE3)-RP containing pGEX-4T-1-VP1 are shown over time course after IPTG induction.

    Article Snippet: Using a specifically designed primer set, forward primer CAV VP1 F: 5'-GCGGAATTCATGGCAAGACGAGCTCGCAGA-3' and reverse primer CAV VP1-R: 5'-GGGCTCGAGTCAGGGCTGCGTCCCCCAGTA-3', respectively containing the EcoR I and Xho I sites, the full-length VP1 gene was amplified using the plasmid pET28a-VP1 as template DNA, and then cloned into the plasmid pGEX-4T-1 (GE healthcare, Piscataway, NJ), which was then designated to be pGEX-4T-1-VP1 (Figure , panel b).

    Techniques:

    Growth kinetics and production profiles of GST-opt-VP1 protein in E. coli BL21(DE3)-pLysS and BL21(DE3) . (A) Growth profile of BL21(DE3) and BL21(DE3)-pLysS in LB medium during post-induction. (B) The production profiles of the E. coli strains, (B)BL21(DE3)-pLysS, and BL21(DE3) containing pGEX-4T-1-Opt-VP1 are shown after induction.

    Journal: Microbial Cell Factories

    Article Title: High yield expression in a recombinant E. coli of a codon optimized chicken anemia virus capsid protein VP1 useful for vaccine development

    doi: 10.1186/1475-2859-10-56

    Figure Lengend Snippet: Growth kinetics and production profiles of GST-opt-VP1 protein in E. coli BL21(DE3)-pLysS and BL21(DE3) . (A) Growth profile of BL21(DE3) and BL21(DE3)-pLysS in LB medium during post-induction. (B) The production profiles of the E. coli strains, (B)BL21(DE3)-pLysS, and BL21(DE3) containing pGEX-4T-1-Opt-VP1 are shown after induction.

    Article Snippet: Using a specifically designed primer set, forward primer CAV VP1 F: 5'-GCGGAATTCATGGCAAGACGAGCTCGCAGA-3' and reverse primer CAV VP1-R: 5'-GGGCTCGAGTCAGGGCTGCGTCCCCCAGTA-3', respectively containing the EcoR I and Xho I sites, the full-length VP1 gene was amplified using the plasmid pET28a-VP1 as template DNA, and then cloned into the plasmid pGEX-4T-1 (GE healthcare, Piscataway, NJ), which was then designated to be pGEX-4T-1-VP1 (Figure , panel b).

    Techniques:

    Schematic diagram of the constructs used for CVA VP1 protein expression . (A) Schematic representation of the VP1 protein variants and expression vectors used in this study. The designations of the VP1 protein and its expression vectors are indicated, a, b and c. The first two constructs, a and b, contained the full-length VP1 gene cloned into vectors pET28a and pGEX-4T-1, for expression of VP1 protein with a six-histidine (6 × His) tag and glutathione-s-transferase (GST) tag at its N-terminus, respectively. Construct c contained VP1 gene with codon-optimized at its N-terminus; this was derived from construct b by replacing the rare codons in the area 1-321 bp without altering amino acid sequence. The N-terminal codon-optimized VP1 gene, opt-N, was fused with C-terminal domain of VP1 gene (VP1 C-term) by overlapping PCR, and then cloned into pGEX-4T-1. (B) Sequence comparison between the WT VP1 and Opt VP1 gene. The nucleotide sequences were compared between the original VP1 gene (WT VP1) and the sequence of codon-optimized VP1 gene (Opt VP1) over the N-terminal region. An asterisk ( * ) represents the fact that the aligned nucleotides are identical.

    Journal: Microbial Cell Factories

    Article Title: High yield expression in a recombinant E. coli of a codon optimized chicken anemia virus capsid protein VP1 useful for vaccine development

    doi: 10.1186/1475-2859-10-56

    Figure Lengend Snippet: Schematic diagram of the constructs used for CVA VP1 protein expression . (A) Schematic representation of the VP1 protein variants and expression vectors used in this study. The designations of the VP1 protein and its expression vectors are indicated, a, b and c. The first two constructs, a and b, contained the full-length VP1 gene cloned into vectors pET28a and pGEX-4T-1, for expression of VP1 protein with a six-histidine (6 × His) tag and glutathione-s-transferase (GST) tag at its N-terminus, respectively. Construct c contained VP1 gene with codon-optimized at its N-terminus; this was derived from construct b by replacing the rare codons in the area 1-321 bp without altering amino acid sequence. The N-terminal codon-optimized VP1 gene, opt-N, was fused with C-terminal domain of VP1 gene (VP1 C-term) by overlapping PCR, and then cloned into pGEX-4T-1. (B) Sequence comparison between the WT VP1 and Opt VP1 gene. The nucleotide sequences were compared between the original VP1 gene (WT VP1) and the sequence of codon-optimized VP1 gene (Opt VP1) over the N-terminal region. An asterisk ( * ) represents the fact that the aligned nucleotides are identical.

    Article Snippet: Using a specifically designed primer set, forward primer CAV VP1 F: 5'-GCGGAATTCATGGCAAGACGAGCTCGCAGA-3' and reverse primer CAV VP1-R: 5'-GGGCTCGAGTCAGGGCTGCGTCCCCCAGTA-3', respectively containing the EcoR I and Xho I sites, the full-length VP1 gene was amplified using the plasmid pET28a-VP1 as template DNA, and then cloned into the plasmid pGEX-4T-1 (GE healthcare, Piscataway, NJ), which was then designated to be pGEX-4T-1-VP1 (Figure , panel b).

    Techniques: Construct, Expressing, Clone Assay, Derivative Assay, Sequencing, Polymerase Chain Reaction