Structured Review

GE Healthcare pgex 6p
Pgex 6p, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p/product/GE Healthcare
Average 99 stars, based on 22 article reviews
Price from $9.99 to $1999.99
pgex 6p - by Bioz Stars, 2019-10
99/100 stars

Images

Related Articles

Transduction:

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: Paragraph title: Expression vectors and transduction of cell lines ... Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ].

Clone Assay:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: All cells (events) were included in the analysis of DAPI intensity. .. Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables). .. The plasmids were transformed into BL21(DE3) (Novagen).

Article Title: dOCRL maintains immune cell quiescence by regulating endosomal traffic
Article Snippet: Circulating and sessile hemocyte populations were separated as described [ ] and imaged on an EVOS FL Cell Imaging System. .. A fragment of dOCRL encoding amino acids 1–179 was cloned into pGEX-6P (GE Healthcare). .. E . coli strain BL21(DE3) expressing this construct was grown to log phase at 37°C, then induced for 3 h at 37°C with 0.4 mM IPTG.

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: MEK1/2 phosphorylation was analyzed by Western blotting. .. A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. One liter of BL21(DE3) transformed with this pGEX-6P-PBD plasmid was grown in Luria-Bertani medium at 37°C for 16 h. Expression of GST-PBD was induced with 1 mM isopropyl-β- d -thiogalactopyranoside for 16 h at 16°C.

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: PCR products were sequence-verified. .. Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ]. .. Mutants E137K, R162*, E218*, Δ237_242, R262T, K288Q were created by site-directed mutagenesis using the QuikChange method (Stratagene, CA, USA) and cloned into pFB Hyg [ ] in-frame with an N-terminal HA tag using the InFusion method (Clontech, CA, USA).

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: RT-PCR was employed to amplify nucleotides 342 to 600 of the CD81 gene which encodes for the CD81 large extracellular loop (LEL). .. The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Bacteria were lysed and the protein purified using glutathione sepharose chromatography.

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: A synthetic gene encoding human RCC1 (Supplementary Table ) was synthesized by GenScript, while yeast RCC1 was PCR out from a Saccharomyces cerevisiae (strain S288C) genomic library. .. Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I. .. All deletion mutants of human and yeast RCC1 (Δ5-RCC1, Δ10-RCC1, Δ10-yRCC1, Δ23-yRCC1, Δ42-yRCC1) were generated by PCR using loop-out primers.

Article Title: Structural characterisation of TNRC6A nuclear localisation signal in complex with importin-alpha
Article Snippet: The structure reveals that TNRC6A binds to the major binding site of Impα in a manner similar to canonical cNLSs. .. GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides. .. GST-cNLS fusions were expressed in BL21(DE3) (NEB) cells overnight at 20°C following isopropyl β-D-1-thiogalactopyranoside (IPTG) induction.

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: Preparation of α4, B’γ1, PR70, LCMT-1, and PTPA were similar to our previous studies , , , . .. In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively. .. The above constructs were transformed into E. coli BL21 (DE3) strain and overexpressed overnight at 23 °C.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: The NMT ORF was amplified from L. donovani genomic DNA by PCR using primers based on the sequence of NMT from the closely related L. infantum strain JPCM5. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase. .. One clone with silent mutations in codons Ile360 (ATT→ATC) and Pro413 (CCC→CCT) was used to amplify a fragment using primers NMT-Xho and NMT-Nde (5′-GTTGTTGTTcatatgTCTCGCAATCCATCGAACTCTGAC-3′).

Article Title: Structural basis for cytosolic double-stranded RNA surveillance by human oligoadenylate synthetase 1
Article Snippet: Experimental errors are shown by error bars, when appropriate. .. The coding region for the p46 isoform of hOAS1 was cloned into pGEX-6P (GE Healthcare Life Sciences) and a stop codon was introduced at position 347. .. Human OAS1 was expressed as a GST fusion protein in Escherichia coli BL21 (DE3)-CodonPlus RIPL (Agilent Technologies).

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: 2.1 pcDNA3.1-RyR2 containing full length mouse cardiac RyR2 cDNA, GenBankTM accession no. NP_076357.2 was kindly provided by Wayne Chen (University of Calgary, Calgary; ), and a pCI-neo vector (Promega) with a full length rabbit skeletal RyR1 insert (GenBank accession no. X15209 ) was kindly provided by P. D. Allen (Brigham and Women's Hospital, Boston; ). .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: The cDNA of full-length IQGAP1 and the fragments 1–522 and 744–1657 were amplified by PCR and cloned into pET100/D-TOPO vector (Invitrogen). .. The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare). .. To generate the N-WASP-CRIB H211D point mutant, the cDNA of N-WASP-(142–276) was amplified from the N- WASP cDNA containing the point mutation H211D.

Article Title:
Article Snippet: Recombinant TCPTP-45 was purified from isopropyl β- d -thiogalactoside-induced bacterial lysates using a TALON metal affinity resin (Clontech, Mountain View, CA) and analyzed by SDS-PAGE and Western blot analysis. .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites. .. The plasmid encoding GST-Cav-1 was then transformed in BL21 (Novagen, Madison WI) competent E. coli to generate Cav-1.

Article Title: Kalirin12 interacts with dynamin
Article Snippet: Fragments of rat Kalirin were cloned into the pEAK10 vector (Edge Biosystems, Gaithersburg, MD) with a His6 -myc epitope tag at the NH2 -terminus [ ]. .. The IgFn region of Kalirin (L2456 LG ... GIS2625 ) was inserted into the pEGFP-N2 vector to make a GFP-IgFn fusion protein, and into pGEX-6P (Amersham Biosciences) to generate GST-IgFn. pEGFP-N1 vectors encoding GFP fused to the C-terminus of human dynamin2, dynamin2/K44 A, dynamin2/ΔPRD (lacking the Pro-rich domain, P747 to D870 ), and dynamin2 GED/PRD (containing both the GED and Pro-rich domains, S618 to D870 ) were the kind gifts of Dr. Pietro De Camilli (Yale University) [ , , ].

Centrifugation:

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. One liter of BL21(DE3) transformed with this pGEX-6P-PBD plasmid was grown in Luria-Bertani medium at 37°C for 16 h. Expression of GST-PBD was induced with 1 mM isopropyl-β- d -thiogalactopyranoside for 16 h at 16°C.

Article Title: Structural basis for cytosolic double-stranded RNA surveillance by human oligoadenylate synthetase 1
Article Snippet: The coding region for the p46 isoform of hOAS1 was cloned into pGEX-6P (GE Healthcare Life Sciences) and a stop codon was introduced at position 347. .. The coding region for the p46 isoform of hOAS1 was cloned into pGEX-6P (GE Healthcare Life Sciences) and a stop codon was introduced at position 347.

Amplification:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables). .. The plasmids were transformed into BL21(DE3) (Novagen).

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: The sense primer used for amplification of 70R HCV core was 5’-ATGAGCACAAATCCTAAACCTC-3’ and anti-sense primer was 5’-AGCGGAAGCTGGGATGGTCAAAC-3’. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: RT-PCR was employed to amplify nucleotides 342 to 600 of the CD81 gene which encodes for the CD81 large extracellular loop (LEL). .. The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Bacteria were lysed and the protein purified using glutathione sepharose chromatography.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: The NMT ORF was amplified from L. donovani genomic DNA by PCR using primers based on the sequence of NMT from the closely related L. infantum strain JPCM5. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase. .. One clone with silent mutations in codons Ile360 (ATT→ATC) and Pro413 (CCC→CCT) was used to amplify a fragment using primers NMT-Xho and NMT-Nde (5′-GTTGTTGTTcatatgTCTCGCAATCCATCGAACTCTGAC-3′).

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: 2.1 pcDNA3.1-RyR2 containing full length mouse cardiac RyR2 cDNA, GenBankTM accession no. NP_076357.2 was kindly provided by Wayne Chen (University of Calgary, Calgary; ), and a pCI-neo vector (Promega) with a full length rabbit skeletal RyR1 insert (GenBank accession no. X15209 ) was kindly provided by P. D. Allen (Brigham and Women's Hospital, Boston; ). .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Article Title: Testing the faux-UTR model for NMD: analysis of Upf1p and Pab1p competition for binding to eRF3/Sup35p
Article Snippet: Plasmid pGEX-GST- SUP35, used to express and purify the fusion protein GST-Sup35p from E. coli, was constructed by PCR amplification of the SUP35 ORF using yeast genomic DNA extracted from the MBS strain and oligonucleotides EcoRI-SUP35-5′: 5′-CGGAATTCTCGGATTCAAACCAAGGC-3′ and XhoI-SUP35-3′ : 5′-GGCTCGAGTTACTCGGCAATTTTAACAAT-3′. .. The resulting PCR fragment was digested by EcoRI-XhoI and introduced in EcoRI-XhoI sites of pGEX-6P (GE Healthcare Life Sciences).

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: The cDNA of full-length IQGAP1 and the fragments 1–522 and 744–1657 were amplified by PCR and cloned into pET100/D-TOPO vector (Invitrogen). .. The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare). .. To generate the N-WASP-CRIB H211D point mutant, the cDNA of N-WASP-(142–276) was amplified from the N- WASP cDNA containing the point mutation H211D.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: For protein expression in bacteria, the full-length Nrd1 cDNA was amplified by RT-PCR from the wild-type fission yeast total RNA. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Filtration:

Article Title: dOCRL maintains immune cell quiescence by regulating endosomal traffic
Article Snippet: A fragment of dOCRL encoding amino acids 1–179 was cloned into pGEX-6P (GE Healthcare). .. Lysates were purified on glutathione agarose (GE Healthcare), washed 4 times with 50 ml of PBS with 0.5 mM DTT, and GST was cleaved from dOCRL1-178 at 4° overnight with a ~1:50 molar ratio of Precision Protease (GE Healthcare).

Mass Spectrometry:

Article Title: Channel Properties of Nax Expressed in Neurons
Article Snippet: Paragraph title: GST pull-down experiment and mass spectrometry ... GST-Nax is a GST fusion protein at the C-terminus (amino acid residues 1489–1681) of mouse Nax (GenBank accession no. NM_009135). pGEX-Nax was prepared by subcloning Nax cDNA from pTRE-mNax [ ] into pGEX-6P (GE Healthcare) to express GST-Nax .

Synthesized:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: After a PCR product covering the whole 70R-type HCV core protein was inserted into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA), another HCV core construct which had a susbtitutin at 70th amino acid position (70Q) was synthesized by gene SOEing as previously described [ ] and inserted to the TA cloning vector. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: A synthetic gene encoding human RCC1 (Supplementary Table ) was synthesized by GenScript, while yeast RCC1 was PCR out from a Saccharomyces cerevisiae (strain S288C) genomic library. .. Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I.

TA Cloning:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: After a PCR product covering the whole 70R-type HCV core protein was inserted into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA), another HCV core construct which had a susbtitutin at 70th amino acid position (70Q) was synthesized by gene SOEing as previously described [ ] and inserted to the TA cloning vector. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Construct:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: The sense primer for gene SOEing to make the 70Q construct was 5’-CAAGGCTCGCCAGCCCGAGGGTAG-3’ and anti-sense primer was 5’-AGGTCCTACCCTCGGGCTGGCGAG-3’. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector. .. HCV core proteins (70R and 70Q) were synthesized using Takara Competent Cells BL21 (Takara Bio Inc.) according to the manufacturer’s instructions, and endotoxin was removed with a ProteoSpin Endotoxin Removal Micro Kit (Norgen, Thorold, Canada).

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ]. .. All plasmids were sequence-verified.

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I. .. Site-directed mutagenesis was used to introduce point mutations in human RCC1 (S11E, R9A, K21A, R9A/K21A) and yeast RCC1 (R4A, K20A, R4A/K20A, E34A/D35A).

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: Paragraph title: Plasmid constructs ... GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia).

Article Title: Testing the faux-UTR model for NMD: analysis of Upf1p and Pab1p competition for binding to eRF3/Sup35p
Article Snippet: Plasmid pGEX-GST- SUP35, used to express and purify the fusion protein GST-Sup35p from E. coli, was constructed by PCR amplification of the SUP35 ORF using yeast genomic DNA extracted from the MBS strain and oligonucleotides EcoRI-SUP35-5′: 5′-CGGAATTCTCGGATTCAAACCAAGGC-3′ and XhoI-SUP35-3′ : 5′-GGCTCGAGTTACTCGGCAATTTTAACAAT-3′. .. The resulting PCR fragment was digested by EcoRI-XhoI and introduced in EcoRI-XhoI sites of pGEX-6P (GE Healthcare Life Sciences).

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: For the above three constructs, cDNAs encoding human Orc3 and Orc5 were supplied by Dr. Yasuyuki Watanabe (our laboratory). .. Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare).

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: Paragraph title: Recombinant cDNA Constructs and Mutations ... The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare).

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: For protein expression in bacteria, the full-length Nrd1 cDNA was amplified by RT-PCR from the wild-type fission yeast total RNA. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. The site-directed mutagenesis was performed using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

Article Title: Kalirin12 interacts with dynamin
Article Snippet: The IgFn region of Kalirin (L2456 LG ... GIS2625 ) was inserted into the pEGFP-N2 vector to make a GFP-IgFn fusion protein, and into pGEX-6P (Amersham Biosciences) to generate GST-IgFn. pEGFP-N1 vectors encoding GFP fused to the C-terminus of human dynamin2, dynamin2/K44 A, dynamin2/ΔPRD (lacking the Pro-rich domain, P747 to D870 ), and dynamin2 GED/PRD (containing both the GED and Pro-rich domains, S618 to D870 ) were the kind gifts of Dr. Pietro De Camilli (Yale University) [ , , ]. .. A vector encoding GFP fused to the C-terminus of the GTPase domain of human dynamin2 (M1 GN...RPD320 ) was generated by subcloning a PCR amplified fragment flanked by HindIII and EcoR 1 sites into pEGFP-N2.

Enzyme-linked Immunosorbent Assay:

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Purified CD81 LEL-GST was cleaved with PreScission protease to remove the GST tag and CD81 LEL was isolated by size-exclusion chromatohgraphy.

Incubation:

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. Cell pellets were then collected by centrifugation, resuspended in 20 ml of 50 mM Tris (pH 7.5)–150 mM NaCl–0.5% NP-40–1 mM EDTA–1 mM dithiothreitol (DTT) containing protease inhibitor cocktail, and homogenized by sonication.

Article Title: Channel Properties of Nax Expressed in Neurons
Article Snippet: GST-Nax is a GST fusion protein at the C-terminus (amino acid residues 1489–1681) of mouse Nax (GenBank accession no. NM_009135). pGEX-Nax was prepared by subcloning Nax cDNA from pTRE-mNax [ ] into pGEX-6P (GE Healthcare) to express GST-Nax . .. The GST-Nax protein was expressed in the E . coli strain BL21, and purified by glutathione affinity chromatography as described previously [ ].

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Purified CD81 LEL (1 µg/ml) was coated on ELISA plates overnight at 4°C and subsequently washed.

Infection:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: HCV RNAs were isolated from patients' sera infected with genotype 1b HCV using a Viral RNA Mini kit (Qiagen, Tokyo, Japan), and cDNA was synthesized by extension of random hexamers with PrimeScript reverse transcriptase (Takara Bio Inc., Otsu, Japan). .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: Hi-5 suspension cells (Thermo Fisher Scientific) at a density of 1.5 × 106 cells ml−1 were infected with recombinant PP2ACα baculovirus and shaken at 100 rpm for 48 h at 27 °C. .. In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively.

Expressing:

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: Paragraph title: GST-PBD expression and purification. ... A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD).

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: Paragraph title: Expression vectors and transduction of cell lines ... Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ].

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: Paragraph title: Cloning, expression and purification of L. donovani NMT ... Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: Human Orc6 cDNA was provided by Dr. Ryo Kitamura (our laboratory) and used for bacterial expression of His6 -Orc6 in pQE60-based plasmid (Qiagen). .. Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare). .. Human TRF2 cDNA was purchased from Invitrogen, and used for bacterial expression of HCBD-TRF2 (HCBD represents His6 tag plus chitin-binding domain (CBD) derived from pCYB1 (New England BioLabs)) in pQE60-based plasmid.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: Paragraph title: Protein Expression, Site-directed Mutagenesis, and Phosphorylation Assay ... GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Article Title: Kalirin12 interacts with dynamin
Article Snippet: Paragraph title: Expression vectors ... The IgFn region of Kalirin (L2456 LG ... GIS2625 ) was inserted into the pEGFP-N2 vector to make a GFP-IgFn fusion protein, and into pGEX-6P (Amersham Biosciences) to generate GST-IgFn. pEGFP-N1 vectors encoding GFP fused to the C-terminus of human dynamin2, dynamin2/K44 A, dynamin2/ΔPRD (lacking the Pro-rich domain, P747 to D870 ), and dynamin2 GED/PRD (containing both the GED and Pro-rich domains, S618 to D870 ) were the kind gifts of Dr. Pietro De Camilli (Yale University) [ , , ].

Modification:

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Western Blot:

Article Title:
Article Snippet: Recombinant TCPTP-45 was purified from isopropyl β- d -thiogalactoside-induced bacterial lysates using a TALON metal affinity resin (Clontech, Mountain View, CA) and analyzed by SDS-PAGE and Western blot analysis. .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Transformation Assay:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables). .. The plasmids were transformed into BL21(DE3) (Novagen).

Article Title:
Article Snippet: To generate full-length recombinant TCPTP (TCPTP-45) carrying an N-terminal His6 tag, TCPTP-45 was amplified using full-length human TCPTP-45 cDNA clone (Invitrogen) as a template, and BamHI and SalI restriction sites were added with the amplification primers and then cloned into pBG100 and transformed in Rosetta (DE3) competent Escherichia coli (Novagen, Madison, WI). .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Derivative Assay:

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: An oriP plasmid, pKS-EX, and its deletion derivatives, pKS-EXΔDS and pKS-DS, as well as EBNA1-encoding DNA (derived from the EBV strain B95-8) were kindly provided by Dr. Shirakata ( ). pKS-ARV, a DS-containing plasmid, was created by inserting an EcoRV-AluI fragment (8995–9195 nt of EBV B95-8) into a blunted SalI site of pBluescript II KS(−) vector (Stratagene). pKS-AHF, another DS-containing plasmid, was created by inserting a blunted HinfI-AluI fragment (8945–9195 nt of EBV B95-8) between SmaI and blunted SalI sites of pBluescript II KS(−). pSOP-T48 was made by replacing the bla-Lac Z′ (2126–2657 nt) portion of pBluescript II SK(−) with the SV-neo (G418R ) unit from pMAMneo (Stratagene), followed by inserting 48x tet O ( ) between SalI and XhoI sites and full-length oriP (from pKS-EX) between EcoRI and XbaI sites of its multicloning site. .. Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare).

Transfection:

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ]. .. All plasmids were sequence-verified.

Sequencing:

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ]. .. Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ].

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: The NMT ORF was amplified from L. donovani genomic DNA by PCR using primers based on the sequence of NMT from the closely related L. infantum strain JPCM5. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia).

Protease Inhibitor:

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. One liter of BL21(DE3) transformed with this pGEX-6P-PBD plasmid was grown in Luria-Bertani medium at 37°C for 16 h. Expression of GST-PBD was induced with 1 mM isopropyl-β- d -thiogalactopyranoside for 16 h at 16°C.

Introduce:

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I. .. All deletion mutants of human and yeast RCC1 (Δ5-RCC1, Δ10-RCC1, Δ10-yRCC1, Δ23-yRCC1, Δ42-yRCC1) were generated by PCR using loop-out primers.

Hemagglutination Assay:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: All cells (events) were included in the analysis of DAPI intensity. .. Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables). .. The plasmids were transformed into BL21(DE3) (Novagen).

Article Title: Identification of the Rab5 Binding Site in p110β - Assays for PI3Kβ binding to Rab5
Article Snippet: GST-Rab5A in pGEX-2T or pGEX-6P (GE Healthcare). .. GST-Rab5A in pGEX-2T or pGEX-6P (GE Healthcare).

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: Baculovirus for MBP-Orc5 was constructed using pVL1392 (Invitrogen), and those for HA-Orc3 and GST-Orc3 were made using pVL1393. .. Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare).

Generated:

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: 2.1 pcDNA3.1-RyR2 containing full length mouse cardiac RyR2 cDNA, GenBankTM accession no. NP_076357.2 was kindly provided by Wayne Chen (University of Calgary, Calgary; ), and a pCI-neo vector (Promega) with a full length rabbit skeletal RyR1 insert (GenBank accession no. X15209 ) was kindly provided by P. D. Allen (Brigham and Women's Hospital, Boston; ). .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

DNA Sequencing:

Article Title: Kalirin12 interacts with dynamin
Article Snippet: The IgFn region of Kalirin (L2456 LG ... GIS2625 ) was inserted into the pEGFP-N2 vector to make a GFP-IgFn fusion protein, and into pGEX-6P (Amersham Biosciences) to generate GST-IgFn. pEGFP-N1 vectors encoding GFP fused to the C-terminus of human dynamin2, dynamin2/K44 A, dynamin2/ΔPRD (lacking the Pro-rich domain, P747 to D870 ), and dynamin2 GED/PRD (containing both the GED and Pro-rich domains, S618 to D870 ) were the kind gifts of Dr. Pietro De Camilli (Yale University) [ , , ]. .. A vector encoding GFP fused to the C-terminus of the GTPase domain of human dynamin2 (M1 GN...RPD320 ) was generated by subcloning a PCR amplified fragment flanked by HindIII and EcoR 1 sites into pEGFP-N2.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: RT-PCR was employed to amplify nucleotides 342 to 600 of the CD81 gene which encodes for the CD81 large extracellular loop (LEL). .. The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli .

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: For protein expression in bacteria, the full-length Nrd1 cDNA was amplified by RT-PCR from the wild-type fission yeast total RNA. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Sonication:

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. One liter of BL21(DE3) transformed with this pGEX-6P-PBD plasmid was grown in Luria-Bertani medium at 37°C for 16 h. Expression of GST-PBD was induced with 1 mM isopropyl-β- d -thiogalactopyranoside for 16 h at 16°C.

Affinity Purification:

Article Title: Structural basis for cytosolic double-stranded RNA surveillance by human oligoadenylate synthetase 1
Article Snippet: The coding region for the p46 isoform of hOAS1 was cloned into pGEX-6P (GE Healthcare Life Sciences) and a stop codon was introduced at position 347. .. The coding region for the p46 isoform of hOAS1 was cloned into pGEX-6P (GE Healthcare Life Sciences) and a stop codon was introduced at position 347.

Recombinant:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: The sense primer for gene SOEing to make the 70Q construct was 5’-CAAGGCTCGCCAGCCCGAGGGTAG-3’ and anti-sense primer was 5’-AGGTCCTACCCTCGGGCTGGCGAG-3’. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector. .. HCV core proteins (70R and 70Q) were synthesized using Takara Competent Cells BL21 (Takara Bio Inc.) according to the manufacturer’s instructions, and endotoxin was removed with a ProteoSpin Endotoxin Removal Micro Kit (Norgen, Thorold, Canada).

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD). .. Cell pellets were then collected by centrifugation, resuspended in 20 ml of 50 mM Tris (pH 7.5)–150 mM NaCl–0.5% NP-40–1 mM EDTA–1 mM dithiothreitol (DTT) containing protease inhibitor cocktail, and homogenized by sonication.

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: Hi-5 suspension cells (Thermo Fisher Scientific) at a density of 1.5 × 106 cells ml−1 were infected with recombinant PP2ACα baculovirus and shaken at 100 rpm for 48 h at 27 °C. .. In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: Paragraph title: Recombinant Plasmids and Viruses ... Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare).

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: Paragraph title: Recombinant cDNA Constructs and Mutations ... The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare).

Article Title:
Article Snippet: Paragraph title: Recombinant Protein ... To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Molecular Cloning:

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: Paragraph title: Molecular cloning and protein preparation ... In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively.

Ion Exchange Chromatography:

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: The AC dimer was released by on-column thrombin cleavage and further purified by ion-exchange chromatography to remove free scaffold subunit. .. In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively.

Mutagenesis:

Article Title: Identification of Mutations in Distinct Regions of p85 Alpha in Urothelial Cancer
Article Snippet: PCR products were sequence-verified. .. Cloning of inserts encoding the full-length wild-type (WT) human p85α and bovine p85α R274A mutant into pGEX-6P (GE Healthcare Life Sciences) has been described [ ]. .. Mutants E137K, R162*, E218*, Δ237_242, R262T, K288Q were created by site-directed mutagenesis using the QuikChange method (Stratagene, CA, USA) and cloned into pFB Hyg [ ] in-frame with an N-terminal HA tag using the InFusion method (Clontech, CA, USA).

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I. .. All deletion mutants of human and yeast RCC1 (Δ5-RCC1, Δ10-RCC1, Δ10-yRCC1, Δ23-yRCC1, Δ42-yRCC1) were generated by PCR using loop-out primers.

Article Title: Structural characterisation of TNRC6A nuclear localisation signal in complex with importin-alpha
Article Snippet: GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides. .. GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: Paragraph title: Protein Expression, Site-directed Mutagenesis, and Phosphorylation Assay ... GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Isolation:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: HCV RNAs were isolated from patients' sera infected with genotype 1b HCV using a Viral RNA Mini kit (Qiagen, Tokyo, Japan), and cDNA was synthesized by extension of random hexamers with PrimeScript reverse transcriptase (Takara Bio Inc., Otsu, Japan). .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Bacteria were lysed and the protein purified using glutathione sepharose chromatography.

Article Title: Structural characterisation of TNRC6A nuclear localisation signal in complex with importin-alpha
Article Snippet: GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides. .. Human Impα1ΔIBB (hImpα1ΔIBB) was expressed in BL21(DE3) (NEB) cells in LB media at 25°C for 5 hours after induction with IPTG, and purified using similar techniques.

Subcloning:

Article Title: Channel Properties of Nax Expressed in Neurons
Article Snippet: Western blot analyses of the pull-down sample using an anti-PSD95 antibody (7E3-1B8, Calbiochem) was performed as described previously [ ]. .. GST-Nax is a GST fusion protein at the C-terminus (amino acid residues 1489–1681) of mouse Nax (GenBank accession no. NM_009135). pGEX-Nax was prepared by subcloning Nax cDNA from pTRE-mNax [ ] into pGEX-6P (GE Healthcare) to express GST-Nax . .. The GST-Nax protein was expressed in the E . coli strain BL21, and purified by glutathione affinity chromatography as described previously [ ].

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-NiR was described previously . mCherry-RTN1523 (5′-ACG AAGCTT CGCCACCATGGTGATGGCCGCACCGCCGGATCTG CAAG-3′ forward and 5′-TGC GGATCC GCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) was generated via PCR amplification using rat RTN1A-eGFP as template and cloned into mCherryN (Clontech).

Purification:

Article Title: dOCRL maintains immune cell quiescence by regulating endosomal traffic
Article Snippet: A fragment of dOCRL encoding amino acids 1–179 was cloned into pGEX-6P (GE Healthcare). .. A fragment of dOCRL encoding amino acids 1–179 was cloned into pGEX-6P (GE Healthcare).

Article Title: Steady-State Levels of Phosphorylated Mitogen-Activated Protein Kinase Kinase 1/2 Determined by Mortalin/HSPA9 and Protein Phosphatase 1 Alpha in KRAS and BRAF Tumor Cells
Article Snippet: Paragraph title: GST-PBD expression and purification. ... A cDNA encoding the PBD of mortalin was cloned into pGEX-6P (GE Healthcare Life Sciences) to generate an N-terminally GST-tagged PBD (GST-PBD).

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli . .. Bacteria were lysed and the protein purified using glutathione sepharose chromatography.

Article Title: Structural characterisation of TNRC6A nuclear localisation signal in complex with importin-alpha
Article Snippet: GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides. .. GST-TNRC6A cNLS (residues 1164–1172 of mouse TNRC6A corresponding to residues 1179–1187 of the human protein; numbering according to hTNRC6A isoform 1) and mutants were cloned into pGEX-6P (GE Healthcare) using overlapping oligonucleotides.

Article Title: Methylation-regulated decommissioning of multimeric PP2A complexes
Article Snippet: The AC dimer was released by on-column thrombin cleavage and further purified by ion-exchange chromatography to remove free scaffold subunit. .. In brief, the WT, truncated and mutated α4, B’γ1, PR70, PTPA, and LCMT-1 (20–338) were cloned into pQlinkG (Addgene), pGEX-6P (GE Healthcare), pQlinkG, pET21b, and pET15b (Invitrogen) vectors, respectively.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: Paragraph title: Cloning, expression and purification of L. donovani NMT ... Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title:
Article Snippet: Recombinant TCPTP-45 was purified from isopropyl β- d -thiogalactoside-induced bacterial lysates using a TALON metal affinity resin (Clontech, Mountain View, CA) and analyzed by SDS-PAGE and Western blot analysis. .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: For protein expression in bacteria, the full-length Nrd1 cDNA was amplified by RT-PCR from the wild-type fission yeast total RNA. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. The site-directed mutagenesis was performed using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

Protein Purification:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: Paragraph title: Protein purification ... Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables).

Polymerase Chain Reaction:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: After a PCR product covering the whole 70R-type HCV core protein was inserted into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA), another HCV core construct which had a susbtitutin at 70th amino acid position (70Q) was synthesized by gene SOEing as previously described [ ] and inserted to the TA cloning vector. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector.

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: A synthetic gene encoding human RCC1 (Supplementary Table ) was synthesized by GenScript, while yeast RCC1 was PCR out from a Saccharomyces cerevisiae (strain S288C) genomic library. .. Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: The NMT ORF was amplified from L. donovani genomic DNA by PCR using primers based on the sequence of NMT from the closely related L. infantum strain JPCM5. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: 2.1 pcDNA3.1-RyR2 containing full length mouse cardiac RyR2 cDNA, GenBankTM accession no. NP_076357.2 was kindly provided by Wayne Chen (University of Calgary, Calgary; ), and a pCI-neo vector (Promega) with a full length rabbit skeletal RyR1 insert (GenBank accession no. X15209 ) was kindly provided by P. D. Allen (Brigham and Women's Hospital, Boston; ). .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Article Title: Testing the faux-UTR model for NMD: analysis of Upf1p and Pab1p competition for binding to eRF3/Sup35p
Article Snippet: Plasmid pGEX-GST- SUP35, used to express and purify the fusion protein GST-Sup35p from E. coli, was constructed by PCR amplification of the SUP35 ORF using yeast genomic DNA extracted from the MBS strain and oligonucleotides EcoRI-SUP35-5′: 5′-CGGAATTCTCGGATTCAAACCAAGGC-3′ and XhoI-SUP35-3′ : 5′-GGCTCGAGTTACTCGGCAATTTTAACAAT-3′. .. The resulting PCR fragment was digested by EcoRI-XhoI and introduced in EcoRI-XhoI sites of pGEX-6P (GE Healthcare Life Sciences). .. RNA isolation and northern blotting procedures were performed as described previously [ ].

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: The cDNA of full-length IQGAP1 and the fragments 1–522 and 744–1657 were amplified by PCR and cloned into pET100/D-TOPO vector (Invitrogen). .. The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare). .. To generate the N-WASP-CRIB H211D point mutant, the cDNA of N-WASP-(142–276) was amplified from the N- WASP cDNA containing the point mutation H211D.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. The linear fragment was transformed into haploid strains so as to target integration at the cdc4 + locus.

Blocking Assay:

Article Title: Human Monoclonal Antibody HCV1 Effectively Prevents and Treats HCV Infection in Chimpanzees
Article Snippet: Paragraph title: CD81 blocking assay ... The amplicon was cloned into pGEX-6P (GE Healthcare) in frame with the N-terminal glutathione S-transferase (GST) and C-terminal myc epitope tag and expressed in BL-21 E. coli .

SDS Page:

Article Title: Channel Properties of Nax Expressed in Neurons
Article Snippet: GST-Nax is a GST fusion protein at the C-terminus (amino acid residues 1489–1681) of mouse Nax (GenBank accession no. NM_009135). pGEX-Nax was prepared by subcloning Nax cDNA from pTRE-mNax [ ] into pGEX-6P (GE Healthcare) to express GST-Nax . .. In pull-down experiments, glutathione Sepharose beads (20 μl) were coated with GST fusion proteins (2 μg), and then incubated overnight at 4°C with synaptosomal lysate (200 μg protein) prepared from the adult rat cerebrum, as described previously [ ].

Article Title:
Article Snippet: Recombinant TCPTP-45 was purified from isopropyl β- d -thiogalactoside-induced bacterial lysates using a TALON metal affinity resin (Clontech, Mountain View, CA) and analyzed by SDS-PAGE and Western blot analysis. .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Plasmid Preparation:

Article Title: Substitution in Amino Acid 70 of Hepatitis C Virus Core Protein Changes the Adipokine Profile via Toll-Like Receptor 2/4 Signaling
Article Snippet: The sense primer for gene SOEing to make the 70Q construct was 5’-CAAGGCTCGCCAGCCCGAGGGTAG-3’ and anti-sense primer was 5’-AGGTCCTACCCTCGGGCTGGCGAG-3’. .. These constructs were inserted into a pGEX-6P (GE healthcare, Tokyo, Japan) and glutathione S-transferase (GST)-fusion recombinant vector. .. HCV core proteins (70R and 70Q) were synthesized using Takara Competent Cells BL21 (Takara Bio Inc.) according to the manufacturer’s instructions, and endotoxin was removed with a ProteoSpin Endotoxin Removal Micro Kit (Norgen, Thorold, Canada).

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1
Article Snippet: Both human and yeast RCC1 genes were cloned in vectors pET28a (Novagen) and pGEX-6P (GE Healthcare) between restriction sites Bam HI and Xho I. .. GST-RCC1-long, constructed by insertion PCR, contains a 12-residue linker (GSAGSAAGSGEF) between S26 and H27 of wild type (WT) GST-RCC1.

Article Title: N-Myristoyltransferase from Leishmania donovani: Structural and Functional Characterisation of a Potential Drug Target for Visceral Leishmaniasis
Article Snippet: Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase. .. Primers NMT-Xho (5′-GTGTggatccCGCAATCCATCGAACTCTGACGCT-3′) and NRev (see above) contain BamHI and XhoI recognition sites, respectively, for cloning of the amplified fragment into pGEX-6P (GE Healthcare) in order to express the enzyme as a C-terminal fusion protein with glutathione S -transferase.

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: Paragraph title: Plasmid constructs ... GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia).

Article Title: Testing the faux-UTR model for NMD: analysis of Upf1p and Pab1p competition for binding to eRF3/Sup35p
Article Snippet: Plasmid pGEX-GST- SUP35, used to express and purify the fusion protein GST-Sup35p from E. coli, was constructed by PCR amplification of the SUP35 ORF using yeast genomic DNA extracted from the MBS strain and oligonucleotides EcoRI-SUP35-5′: 5′-CGGAATTCTCGGATTCAAACCAAGGC-3′ and XhoI-SUP35-3′ : 5′-GGCTCGAGTTACTCGGCAATTTTAACAAT-3′. .. The resulting PCR fragment was digested by EcoRI-XhoI and introduced in EcoRI-XhoI sites of pGEX-6P (GE Healthcare Life Sciences).

Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins
Article Snippet: Human Orc6 cDNA was provided by Dr. Ryo Kitamura (our laboratory) and used for bacterial expression of His6 -Orc6 in pQE60-based plasmid (Qiagen). .. Human Cdc6 cDNA was obtained from Dr. Hiroko Fujii-Yamamoto (our laboratory) and used for bacterial expression of GST-Cdc6 in pGEX-6P (GE Healthcare).

Article Title: The IQGAP1 Protein Is a Calmodulin-regulated Barbed End Capper of Actin Filaments: POSSIBLE IMPLICATIONS IN ITS FUNCTION IN CELL MIGRATION*
Article Snippet: The cDNA of full-length IQGAP1 and the fragments 1–522 and 744–1657 were amplified by PCR and cloned into pET100/D-TOPO vector (Invitrogen). .. The cDNA of the other IQGAP1 fragments were amplified with PCR and cloned into pGEX-6P (GE Healthcare).

Article Title:
Article Snippet: To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites. .. To generate glutathione S -transferase (GST)-Cav-1, full-length human Cav-1 was cloned into pGEX-6p (GE Healthcare) between the BamHI and SalI sites.

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. The site-directed mutagenesis was performed using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

Article Title: Kalirin12 interacts with dynamin
Article Snippet: Enhanced green fluorescent protein (from pEGFP-N2; Clontech, Mountain View, CA) replaced residues L1127 STHTS1132 of Kalirin12 in the pEAK GFP-Kalirin12 vector [ ]. .. The IgFn region of Kalirin (L2456 LG ... GIS2625 ) was inserted into the pEGFP-N2 vector to make a GFP-IgFn fusion protein, and into pGEX-6P (Amersham Biosciences) to generate GST-IgFn. pEGFP-N1 vectors encoding GFP fused to the C-terminus of human dynamin2, dynamin2/K44 A, dynamin2/ΔPRD (lacking the Pro-rich domain, P747 to D870 ), and dynamin2 GED/PRD (containing both the GED and Pro-rich domains, S618 to D870 ) were the kind gifts of Dr. Pietro De Camilli (Yale University) [ , , ]. .. A vector encoding GFP fused to the C-terminus of the GTPase domain of human dynamin2 (M1 GN...RPD320 ) was generated by subcloning a PCR amplified fragment flanked by HindIII and EcoR 1 sites into pEGFP-N2.

Positron Emission Tomography:

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery
Article Snippet: Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables). .. Mtb dciA Mtb , HA-dciA Mtb , dciA Mtb W113A , HA-dciA Mtb W113A , truncations of HA-dciA Mtb and HA-dciA Mtb W113A , dnaA , and HA-dnaA were cloned into pGEX-6P (GE Healthcare Life Sciences, and Tables).

In Vitro:

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: For protein expression in bacteria, the full-length Nrd1 cDNA was amplified by RT-PCR from the wild-type fission yeast total RNA. .. GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions. .. The site-directed mutagenesis was performed using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

Phosphorylation Assay:

Article Title: Role of the RNA-binding Protein Nrd1 and Pmk1 Mitogen-activated Protein Kinase in the Regulation of Myosin mRNA Stability in Fission Yeast
Article Snippet: Paragraph title: Protein Expression, Site-directed Mutagenesis, and Phosphorylation Assay ... GST-fusion proteins encoding Nrd1 was constructed using pGEX-6P (GE Healthcare, Waukesha, WI), expressed in Escherichia coli XL1-blue, and purified using glutathione-Sepharose beads as previously described , and the purified GST-fusion proteins were used for in vitro kinase reactions.

Staining:

Article Title: Channel Properties of Nax Expressed in Neurons
Article Snippet: GST-Nax is a GST fusion protein at the C-terminus (amino acid residues 1489–1681) of mouse Nax (GenBank accession no. NM_009135). pGEX-Nax was prepared by subcloning Nax cDNA from pTRE-mNax [ ] into pGEX-6P (GE Healthcare) to express GST-Nax . .. In pull-down experiments, glutathione Sepharose beads (20 μl) were coated with GST fusion proteins (2 μg), and then incubated overnight at 4°C with synaptosomal lysate (200 μg protein) prepared from the adult rat cerebrum, as described previously [ ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    GE Healthcare pgex 6p 3 vector
    Establishment of monkey podoplanin-neutralizing antibodies (A) Purification of a monkey podoplanin (mkyPDPN) immunogen to establish a hybridoma secreting anti-PDPN monoclonal antibodies (mAbs). A mkyPDPN cDNA region encoding amino acids 76–89 (226–267 bp) was tandemly connected 21 times. The cDNA fragment was inserted into a <t>pGEX-6P-3</t> vector, and a glutathione S-transferase (GST)-tagged mkyPDPN peptide (76–89 aa) produced by BL21 (DE3) E. coli was purified using glutathione sepharose. BALB/c mice were injected with the GST-tagged peptide, after which their splenocytes were fused with mouse myeloma P3U1 cells using polyethylene glycol. Hybridoma screening and antibody purification from ascites were performed. (B) CHO cells transfected with an empty vector (mock), wild-type monkey podoplanin (mkyPDPN-WT), wild-type human podoplanin (hPDPN-WT) were treated with PBS (closed areas) or antibodies (open areas), including anti-PDPN mAb D2-40, 1F6, 2F7, or 3F4 to measure PDPN expression levels. (C) GST-tagged recombinant mkyPDPN protein (WT) and its point mutants were expressed in E. coli . Cell lysates were electrophoresed and immunoblotted with antibodies to PDPN (1F6, 2F7, 3F4) or GST. The PLAG4 domain is indicated by red letters. (D) CHO/mock, CHO/mkyPDPN-WT, or CHO/hPDPN-WT cells were incubated with 100 μg/mL of control IgG1 or anti-PDPN antibodies 1F6, 2F7, or 3F4, followed by incubation with 1 μg/mL of hCLEC-2-(His) 10 (open areas: control IgG-treated samples; green areas: anti-PDPN mAb-treated samples). After washing, cells were further incubated with Alexa Flour 488-conjugated anti-penta-His second antibody. CLEC-2 binding was measured by flow cytometry. Gray areas indicate the fluorescence intensity of samples not treated with CLEC-2. (E) CHO/mkyPDPN-WT cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs followed by incubation with mouse platelet-rich plasma (PRP). The aggregation rate was estimated using an aggregometer. (F) PLAG3 domain-deleted mkyPDPN mutant cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs, followed by incubation with mouse PRP. The aggregation rate was estimated using an aggregometer.
    Pgex 6p 3 Vector, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 3 vector/product/GE Healthcare
    Average 99 stars, based on 57 article reviews
    Price from $9.99 to $1999.99
    pgex 6p 3 vector - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    GE Healthcare pgex 6p 1
    Construction of <t>pGEX-6P-1-</t> Bm K CT and production of recombinant GST- Bm K CT. (A) The Bm K CT gene was cloned into pGEX-6p-1 to construct the expression vector pGEX-6P-1- Bm K CT. (B) SDS-PAGE analysis of the expression and purification of GST and GST- Bm K CT. Lane 1–2: The total expressed proteins of BL21(DE3)/pGEX-6P-1 or BL21(DE3)/pGEX-6P-1- Bm K CT induced by 0.4 mM IPTG for 4 h; lane 3–4: The proteins after binding to glutathione sepharose beads; lane 5–6: Purified GST or GST- Bm K CT extracted by GSH affinity chromatography; lane 7: molecular mass markers. (C) Western blotting was used to identify GST- Bm K CT or GST among the total expressed proteins (lane 1), the proteins after binding to glutathione sepharose beads (lane 2), and the purified proteins (lane 3). GST- Bm K CT, Glutathione S-transferase fused with Buthus martensii Kirsch chlorotoxin-like toxin.
    Pgex 6p 1, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1/product/GE Healthcare
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pgex 6p 1 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    83
    GE Healthcare rabbit s100a10
    Models of the <t>S100A10-annexin</t> A2 (A10A2) and Ca 2+ and (B) Ca 2+ are shown in similar orientations to demonstrate
    Rabbit S100a10, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 83/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit s100a10/product/GE Healthcare
    Average 83 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rabbit s100a10 - by Bioz Stars, 2019-10
    83/100 stars
      Buy from Supplier

    Image Search Results


    Establishment of monkey podoplanin-neutralizing antibodies (A) Purification of a monkey podoplanin (mkyPDPN) immunogen to establish a hybridoma secreting anti-PDPN monoclonal antibodies (mAbs). A mkyPDPN cDNA region encoding amino acids 76–89 (226–267 bp) was tandemly connected 21 times. The cDNA fragment was inserted into a pGEX-6P-3 vector, and a glutathione S-transferase (GST)-tagged mkyPDPN peptide (76–89 aa) produced by BL21 (DE3) E. coli was purified using glutathione sepharose. BALB/c mice were injected with the GST-tagged peptide, after which their splenocytes were fused with mouse myeloma P3U1 cells using polyethylene glycol. Hybridoma screening and antibody purification from ascites were performed. (B) CHO cells transfected with an empty vector (mock), wild-type monkey podoplanin (mkyPDPN-WT), wild-type human podoplanin (hPDPN-WT) were treated with PBS (closed areas) or antibodies (open areas), including anti-PDPN mAb D2-40, 1F6, 2F7, or 3F4 to measure PDPN expression levels. (C) GST-tagged recombinant mkyPDPN protein (WT) and its point mutants were expressed in E. coli . Cell lysates were electrophoresed and immunoblotted with antibodies to PDPN (1F6, 2F7, 3F4) or GST. The PLAG4 domain is indicated by red letters. (D) CHO/mock, CHO/mkyPDPN-WT, or CHO/hPDPN-WT cells were incubated with 100 μg/mL of control IgG1 or anti-PDPN antibodies 1F6, 2F7, or 3F4, followed by incubation with 1 μg/mL of hCLEC-2-(His) 10 (open areas: control IgG-treated samples; green areas: anti-PDPN mAb-treated samples). After washing, cells were further incubated with Alexa Flour 488-conjugated anti-penta-His second antibody. CLEC-2 binding was measured by flow cytometry. Gray areas indicate the fluorescence intensity of samples not treated with CLEC-2. (E) CHO/mkyPDPN-WT cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs followed by incubation with mouse platelet-rich plasma (PRP). The aggregation rate was estimated using an aggregometer. (F) PLAG3 domain-deleted mkyPDPN mutant cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs, followed by incubation with mouse PRP. The aggregation rate was estimated using an aggregometer.

    Journal: Oncotarget

    Article Title: A safety study of newly generated anti-podoplanin-neutralizing antibody in cynomolgus monkey (Macaca fascicularis)

    doi: 10.18632/oncotarget.26055

    Figure Lengend Snippet: Establishment of monkey podoplanin-neutralizing antibodies (A) Purification of a monkey podoplanin (mkyPDPN) immunogen to establish a hybridoma secreting anti-PDPN monoclonal antibodies (mAbs). A mkyPDPN cDNA region encoding amino acids 76–89 (226–267 bp) was tandemly connected 21 times. The cDNA fragment was inserted into a pGEX-6P-3 vector, and a glutathione S-transferase (GST)-tagged mkyPDPN peptide (76–89 aa) produced by BL21 (DE3) E. coli was purified using glutathione sepharose. BALB/c mice were injected with the GST-tagged peptide, after which their splenocytes were fused with mouse myeloma P3U1 cells using polyethylene glycol. Hybridoma screening and antibody purification from ascites were performed. (B) CHO cells transfected with an empty vector (mock), wild-type monkey podoplanin (mkyPDPN-WT), wild-type human podoplanin (hPDPN-WT) were treated with PBS (closed areas) or antibodies (open areas), including anti-PDPN mAb D2-40, 1F6, 2F7, or 3F4 to measure PDPN expression levels. (C) GST-tagged recombinant mkyPDPN protein (WT) and its point mutants were expressed in E. coli . Cell lysates were electrophoresed and immunoblotted with antibodies to PDPN (1F6, 2F7, 3F4) or GST. The PLAG4 domain is indicated by red letters. (D) CHO/mock, CHO/mkyPDPN-WT, or CHO/hPDPN-WT cells were incubated with 100 μg/mL of control IgG1 or anti-PDPN antibodies 1F6, 2F7, or 3F4, followed by incubation with 1 μg/mL of hCLEC-2-(His) 10 (open areas: control IgG-treated samples; green areas: anti-PDPN mAb-treated samples). After washing, cells were further incubated with Alexa Flour 488-conjugated anti-penta-His second antibody. CLEC-2 binding was measured by flow cytometry. Gray areas indicate the fluorescence intensity of samples not treated with CLEC-2. (E) CHO/mkyPDPN-WT cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs followed by incubation with mouse platelet-rich plasma (PRP). The aggregation rate was estimated using an aggregometer. (F) PLAG3 domain-deleted mkyPDPN mutant cells were incubated with 10 μg/mL of control IgG1, 1F6, 2F7, or 3F4 mAbs, followed by incubation with mouse PRP. The aggregation rate was estimated using an aggregometer.

    Article Snippet: A monkey podoplanin cDNA region encoding amino acids 76 to 89 (226–267 bp) was tandemly connected 21 times in a pGEX-6P-3 vector (GE Healthcare), replicated in BL21 (DE3) E. coli as the GST-tagged monkey podoplanin peptide (76–89 aa), and purified using glutathione sepharose (GE Healthcare).

    Techniques: Purification, Plasmid Preparation, Produced, Mouse Assay, Injection, Antibody Purification, Transfection, Expressing, Recombinant, Incubation, Binding Assay, Flow Cytometry, Cytometry, Fluorescence, Mutagenesis

    Construction of pGEX-6P-1- Bm K CT and production of recombinant GST- Bm K CT. (A) The Bm K CT gene was cloned into pGEX-6p-1 to construct the expression vector pGEX-6P-1- Bm K CT. (B) SDS-PAGE analysis of the expression and purification of GST and GST- Bm K CT. Lane 1–2: The total expressed proteins of BL21(DE3)/pGEX-6P-1 or BL21(DE3)/pGEX-6P-1- Bm K CT induced by 0.4 mM IPTG for 4 h; lane 3–4: The proteins after binding to glutathione sepharose beads; lane 5–6: Purified GST or GST- Bm K CT extracted by GSH affinity chromatography; lane 7: molecular mass markers. (C) Western blotting was used to identify GST- Bm K CT or GST among the total expressed proteins (lane 1), the proteins after binding to glutathione sepharose beads (lane 2), and the purified proteins (lane 3). GST- Bm K CT, Glutathione S-transferase fused with Buthus martensii Kirsch chlorotoxin-like toxin.

    Journal: Oncology Letters

    Article Title: BmK CT enhances the sensitivity of temozolomide-induced apoptosis of malignant glioma U251 cells in vitro through blocking the AKT signaling pathway

    doi: 10.3892/ol.2017.7483

    Figure Lengend Snippet: Construction of pGEX-6P-1- Bm K CT and production of recombinant GST- Bm K CT. (A) The Bm K CT gene was cloned into pGEX-6p-1 to construct the expression vector pGEX-6P-1- Bm K CT. (B) SDS-PAGE analysis of the expression and purification of GST and GST- Bm K CT. Lane 1–2: The total expressed proteins of BL21(DE3)/pGEX-6P-1 or BL21(DE3)/pGEX-6P-1- Bm K CT induced by 0.4 mM IPTG for 4 h; lane 3–4: The proteins after binding to glutathione sepharose beads; lane 5–6: Purified GST or GST- Bm K CT extracted by GSH affinity chromatography; lane 7: molecular mass markers. (C) Western blotting was used to identify GST- Bm K CT or GST among the total expressed proteins (lane 1), the proteins after binding to glutathione sepharose beads (lane 2), and the purified proteins (lane 3). GST- Bm K CT, Glutathione S-transferase fused with Buthus martensii Kirsch chlorotoxin-like toxin.

    Article Snippet: The gene sequence of Bm K CT was amplified by polymerase chain reaction (PCR) from the vector pRSETc-Bm K CT (constructed in Molecular Biology Laboratory, Institute of Biotechnology, Shanxi University, Taiyuan, China) and cloned into pGEX-6p-1 (GE Healthcare Life Sciences, Shanghai, China) to construct the expression vector.

    Techniques: Recombinant, Clone Assay, Construct, Expressing, Plasmid Preparation, SDS Page, Purification, Binding Assay, Affinity Chromatography, Western Blot

    Models of the S100A10-annexin A2 (A10A2) and Ca 2+ and (B) Ca 2+ are shown in similar orientations to demonstrate

    Journal:

    Article Title: Design of high-affinity S100-target hybrid proteins

    doi: 10.1002/pro.267

    Figure Lengend Snippet: Models of the S100A10-annexin A2 (A10A2) and Ca 2+ and (B) Ca 2+ are shown in similar orientations to demonstrate

    Article Snippet: The expression vector for rabbit S100A10 (pGEX-6P-1-derived vector; GE Healthcare, Buckinghamshire, UK) was generously provided by Dr. Michael Walsh (University of Calgary).

    Techniques:

    1 H- 15 N HSQC spectra of 0.5 m M (monomer) uniformly (A) 15 N, 13 C-labeled A10A2 hybrid protein, (B) 15 N, 13 C-labeled S100A10 in complex with unlabeled annexin A2 peptide, and (C) the 15 N, 13 C-labeled A10A2 hybrid protein following TEV cleavage. All spectra

    Journal:

    Article Title: Design of high-affinity S100-target hybrid proteins

    doi: 10.1002/pro.267

    Figure Lengend Snippet: 1 H- 15 N HSQC spectra of 0.5 m M (monomer) uniformly (A) 15 N, 13 C-labeled A10A2 hybrid protein, (B) 15 N, 13 C-labeled S100A10 in complex with unlabeled annexin A2 peptide, and (C) the 15 N, 13 C-labeled A10A2 hybrid protein following TEV cleavage. All spectra

    Article Snippet: The expression vector for rabbit S100A10 (pGEX-6P-1-derived vector; GE Healthcare, Buckinghamshire, UK) was generously provided by Dr. Michael Walsh (University of Calgary).

    Techniques: Labeling

    Coomassie-stained SDS–PAGE gel (16.5%) depicting the purification of S100A10-annexin A2 and S100B-TRTK12 constructs. Lane 1 contains the protein molecular weight markers, with molecular weights labeled on the left of the gel. Lanes 2 and 5 contain

    Journal:

    Article Title: Design of high-affinity S100-target hybrid proteins

    doi: 10.1002/pro.267

    Figure Lengend Snippet: Coomassie-stained SDS–PAGE gel (16.5%) depicting the purification of S100A10-annexin A2 and S100B-TRTK12 constructs. Lane 1 contains the protein molecular weight markers, with molecular weights labeled on the left of the gel. Lanes 2 and 5 contain

    Article Snippet: The expression vector for rabbit S100A10 (pGEX-6P-1-derived vector; GE Healthcare, Buckinghamshire, UK) was generously provided by Dr. Michael Walsh (University of Calgary).

    Techniques: Staining, SDS Page, Purification, Construct, Molecular Weight, Labeling