Structured Review

GE Healthcare gst tagged gli1 deletion proteins
<t>GLI1</t> interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e <t>GST</t> pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6
Gst Tagged Gli1 Deletion Proteins, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 53 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gst tagged gli1 deletion proteins/product/GE Healthcare
Average 93 stars, based on 53 article reviews
Price from $9.99 to $1999.99
gst tagged gli1 deletion proteins - by Bioz Stars, 2020-05
93/100 stars

Images

1) Product Images from "MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex"

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex

Journal: Communications Biology

doi: 10.1038/s42003-018-0275-4

GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6
Figure Legend Snippet: GLI1 interacts with the MEP50/PRMT5 complex. a FLAG-GLI1 interacted with endogenous MEP50 and interaction of FLAG-GLI1 and MEP50 was increased by HH signalling pathway activation. C3H10T1/2 cells were transfected with FLAG-GLI1 or the empty vector for 24 h and then treated with 300 nM SAG for an additional 24 h. Interaction of FLAG-GLI1 and MEP50 was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-MEP50 antibodies. b Schematic structures of MEP50 deletion mutants. c Mapping of the GLI1-binding region in MEP50 by immunoprecipitation analysis. HEK293T cells were transfected with Myc-MEP50 deletion mutants and FLAG-GLI1 plasmids for 24 h. Interaction of FLAG-GLI1 and Myc-MEP50 deletion mutants was detected by immunoprecipitation with anti-FLAG antibody followed by immunoblot analysis using anti-FLAG and anti-Myc antibodies. d Schematic of GLI1 deletion mutants. e GST pull-down assays to map the MEP50-binding region in GLI1. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated Myc-MEP50 from HEK293T cells. Immunoblotting was performed with an anti-Myc antibody. In a and e , data represent one of three independent experiments with similar results. In c , data represent one of two independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Immunoprecipitation, Binding Assay, Incubation

MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. 4 . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6
Figure Legend Snippet: MEP50/PRMT5 complex induces GLI1 methylation. a , b Methylation of GLI1 in MEP50- ( a ) or PRMT5- ( b ) knockdown C3H10T1/2 cells. siMEP50-m2 and siPRMT5-m2 siRNAs were stably expressed by recombinant retroviruses. Cells transfected with FLAG-GLI1 were cultured for 24 h, followed by treatment with 300 nM SAG for 24 h. Methylated GLI1 was detected by immunoprecipitation with an anti-FLAG antibody followed by immunoblot with anti-SYM11 antibody. c In vitro methylation assays to determine the region including methylated arginine residues in GLI1 deletion mutants. HA-PRMT5 expression plasmid was transfected into HEK293T cells. At 48 h after transfection, the cells were lysed, and HA-PRMT5 was immunoprecipitated using an anti-HA (3F10) antibody. GST-GLI1 deletion mutants coupled to glutathione sepharose were incubated with immunoprecipitated HA-PRMT5 from HEK293T cells. Upper panel represents the methylated GST-GLI1 deletion mutant. Lower panel represents 20% input of GST-GLI1 deletion mutants detected by CBB R-250 staining. HA-PRMT5 expressed in 10% of total lysate used for immunoprecipitation is shown in the right panel. d In vitro methylation assays to determine methylation sites in GLI1 using amino acid substitutions (arginine to lysine) of candidate methylation sites. In vitro methylation assays were performed as described in ( c ). Upper panel represents methylated GST-GLI1 mutants. Lower panel represents 20% input of GST-GLI1 mutants detected by CBB R-250 staining. Underlined text denotes highly conserved residues among mammals, as shown in Supplementary Fig. 4 . In c , data represent one of three independent experiments with similar results. In a and d , data represent one of twice independent experiments with similar results. Unprocessed original scans of blots are shown in Supplementary Fig. 6

Techniques Used: Methylation, Stable Transfection, Recombinant, Transfection, Cell Culture, Immunoprecipitation, In Vitro, Expressing, Plasmid Preparation, Incubation, Mutagenesis, Staining

2) Product Images from "The Apc5 Subunit of the Anaphase-Promoting Complex/Cyclosome Interacts with Poly(A) Binding Protein and Represses Internal Ribosome Entry Site-Mediated Translation"

Article Title: The Apc5 Subunit of the Anaphase-Promoting Complex/Cyclosome Interacts with Poly(A) Binding Protein and Represses Internal Ribosome Entry Site-Mediated Translation

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.9.3577-3587.2004

Effect of PABP and Apc5 on translation in vitro. (A) Krebs-2 cell-free translation reaction mixtures that had been pretreated with GST-Paip2 for PABP depletion or with GST as a control were programmed with 100 ng of the indicated transcripts at 37°C for 90 min followed by measurements of firefly luciferase activity. Immunoblot analysis of the translation extracts using antibodies specific for PABP is shown at the top: lane 1, untreated; lane 2, treated with GST-Paip2; lane 3, treated with GST. For each transcript, the value obtained in the GST-treated extract was divided by the value obtained in the PABP-depleted extract. The stimulation values represent the average ± standard error of three independent duplicate experiments. (B) Krebs-2 cell-free translation reaction mixtures preincubated for 30 min at room temperature with the indicated amounts of purified HIS-Apc5 were programmed with 50 ng of the indicated transcripts for a further 50-min incubation at 37°C. Firefly luciferase activity in the absence of Apc5 was set as 100%. The values represent the average ± standard error of three independent experiments. (C) Krebs-2 cell-free translation reaction mixtures preincubated for 30 min at room tem-perature with 1 μg of HIS-Apc5 and the indicated amounts of purified GST-RRM3 were programmed with 50 ng of the indicated transcripts for a further 50-min incubation at 37°C. Firefly luciferase activity in the absence of HIS-Apc5 and GST-RRM3 was set as 100%. The values represent the average ± standard error of three independent experiments.
Figure Legend Snippet: Effect of PABP and Apc5 on translation in vitro. (A) Krebs-2 cell-free translation reaction mixtures that had been pretreated with GST-Paip2 for PABP depletion or with GST as a control were programmed with 100 ng of the indicated transcripts at 37°C for 90 min followed by measurements of firefly luciferase activity. Immunoblot analysis of the translation extracts using antibodies specific for PABP is shown at the top: lane 1, untreated; lane 2, treated with GST-Paip2; lane 3, treated with GST. For each transcript, the value obtained in the GST-treated extract was divided by the value obtained in the PABP-depleted extract. The stimulation values represent the average ± standard error of three independent duplicate experiments. (B) Krebs-2 cell-free translation reaction mixtures preincubated for 30 min at room temperature with the indicated amounts of purified HIS-Apc5 were programmed with 50 ng of the indicated transcripts for a further 50-min incubation at 37°C. Firefly luciferase activity in the absence of Apc5 was set as 100%. The values represent the average ± standard error of three independent experiments. (C) Krebs-2 cell-free translation reaction mixtures preincubated for 30 min at room tem-perature with 1 μg of HIS-Apc5 and the indicated amounts of purified GST-RRM3 were programmed with 50 ng of the indicated transcripts for a further 50-min incubation at 37°C. Firefly luciferase activity in the absence of HIS-Apc5 and GST-RRM3 was set as 100%. The values represent the average ± standard error of three independent experiments.

Techniques Used: In Vitro, Luciferase, Activity Assay, Purification, Incubation, Transmission Electron Microscopy

3) Product Images from "Structural basis for recruitment of RILP by small GTPase Rab7"

Article Title: Structural basis for recruitment of RILP by small GTPase Rab7

Journal: The EMBO Journal

doi: 10.1038/sj.emboj.7600643

Effects of mutations of Rab7 and RILP on their cellular localization and membrane recruitment. ( A ) Representative site-directed mutants (panels e, g, i and k) or a truncated form (Rab7ΔN; panel c) of Rab7Q67L defective in interaction with RILP are mistargeted to the cytosol (and nucleus for F45A) (as revealed by GFP attached to the N-terminus of these proteins) and are not detected in the clustered lysosomes marked by coexpressed RILP (panels d, f, h, j and l as revealed by Myc tag). EGFP-Rab7Q67L (panel a) and Myc-RILP (panel b) serve as the positive control. Bar, 20 μm. ( B ) Representative mutants of RILP (panels c, e, g, i and k, revealed by Myc tag) defective in interaction with Rab7 are mistargeted to the cytosol and did not associate with punctuate late endosomes/lysosomes marked by coexpressed EGFP-Rab7Q67L (panels b, d, f, h, j and l, viewed by GFP). The fragment encompassing residues 241–310 of RILPe is peripheral distributed, but still can be efficiently recruited to the punctuate structures marked by EGFP-Rab7Q67L (panels a and b). Bar, 20 μm.
Figure Legend Snippet: Effects of mutations of Rab7 and RILP on their cellular localization and membrane recruitment. ( A ) Representative site-directed mutants (panels e, g, i and k) or a truncated form (Rab7ΔN; panel c) of Rab7Q67L defective in interaction with RILP are mistargeted to the cytosol (and nucleus for F45A) (as revealed by GFP attached to the N-terminus of these proteins) and are not detected in the clustered lysosomes marked by coexpressed RILP (panels d, f, h, j and l as revealed by Myc tag). EGFP-Rab7Q67L (panel a) and Myc-RILP (panel b) serve as the positive control. Bar, 20 μm. ( B ) Representative mutants of RILP (panels c, e, g, i and k, revealed by Myc tag) defective in interaction with Rab7 are mistargeted to the cytosol and did not associate with punctuate late endosomes/lysosomes marked by coexpressed EGFP-Rab7Q67L (panels b, d, f, h, j and l, viewed by GFP). The fragment encompassing residues 241–310 of RILPe is peripheral distributed, but still can be efficiently recruited to the punctuate structures marked by EGFP-Rab7Q67L (panels a and b). Bar, 20 μm.

Techniques Used: Positive Control

Effects of mutations on RILP dimerization and Rab7–RILP interaction. ( A ) RILP forms homodimer via self-interaction in a manner that is dependent on residues (241–260) in its coiled-coil region. Wild type (WT) refers to full-length RILP. ( B ) Effects of Ala point mutations of RILP on its dimerization. L287A serves as a positive control. ( C ) Effects of truncation or Ala point mutations in Rab7Q67L on its interaction with RILP. Rab7Q67L and E185A mutant serve as positive controls. Rab7ΔN contains residues 11–207, Rab7ΔC1 contains residues 1–176 and Rab7ΔC2 contains residues 1–185. ( D ) Effects of mutations of RILP on its interaction with Rab7Q67L. Wild-type (WT) RILP and RILPe serve as positive controls.
Figure Legend Snippet: Effects of mutations on RILP dimerization and Rab7–RILP interaction. ( A ) RILP forms homodimer via self-interaction in a manner that is dependent on residues (241–260) in its coiled-coil region. Wild type (WT) refers to full-length RILP. ( B ) Effects of Ala point mutations of RILP on its dimerization. L287A serves as a positive control. ( C ) Effects of truncation or Ala point mutations in Rab7Q67L on its interaction with RILP. Rab7Q67L and E185A mutant serve as positive controls. Rab7ΔN contains residues 11–207, Rab7ΔC1 contains residues 1–176 and Rab7ΔC2 contains residues 1–185. ( D ) Effects of mutations of RILP on its interaction with Rab7Q67L. Wild-type (WT) RILP and RILPe serve as positive controls.

Techniques Used: Positive Control, Mutagenesis

Structural comparison of the complexes of Rab3A–Rabphilin3A, Rab5–Rabaptin5, Rab7–RILP and Arl1–GRIP. The regions of GTPases involved in interactions with their effectors are highlighted in magenta. The N- and C-termini of GTPases and their effectors are labeled.
Figure Legend Snippet: Structural comparison of the complexes of Rab3A–Rabphilin3A, Rab5–Rabaptin5, Rab7–RILP and Arl1–GRIP. The regions of GTPases involved in interactions with their effectors are highlighted in magenta. The N- and C-termini of GTPases and their effectors are labeled.

Techniques Used: Labeling

4) Product Images from "Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile"

Article Title: Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile

Journal: Journal of Bacteriology

doi: 10.1128/JB.185.15.4461-4470.2003

Polymorphism of the functional domain of Cwp84, from amino acid 17 to 370. The seven sequences represents the different alleles recovered from the 28 strains studied. Only amino acid differences from serogroup C reference strain (ATCC 43596) are indicated. Identical amino acids are represented by dashes. RefC, same sequence than following strains (serogroup): 630(C), C253(C), 1075(C), Kohn(A), 95938(G), 53444(H), 57027, RefI, 56026(I), RefK, 94416(K), RefX, 36678(X). RefH, same sequence as the following: 93369(H), 90204(H), 68750(A), and 79685(S3). RefG, same sequence as strain CD268. Ex560(B), same sequence as CO109(B). RefA, same sequence as RefB. RefD, same sequence as 93136(D).
Figure Legend Snippet: Polymorphism of the functional domain of Cwp84, from amino acid 17 to 370. The seven sequences represents the different alleles recovered from the 28 strains studied. Only amino acid differences from serogroup C reference strain (ATCC 43596) are indicated. Identical amino acids are represented by dashes. RefC, same sequence than following strains (serogroup): 630(C), C253(C), 1075(C), Kohn(A), 95938(G), 53444(H), 57027, RefI, 56026(I), RefK, 94416(K), RefX, 36678(X). RefH, same sequence as the following: 93369(H), 90204(H), 68750(A), and 79685(S3). RefG, same sequence as strain CD268. Ex560(B), same sequence as CO109(B). RefA, same sequence as RefB. RefD, same sequence as 93136(D).

Techniques Used: Functional Assay, Sequencing

Transcriptional analysis of cwp cluster. Hybridization DNA-membrane-immobilized RNA on strain 630; 15, 30, and 25 μg of total RNA were used for hybridization with probes specific to slpA (A), cwp66 (B), and cwp84 (C), respectively. MW, RNA molecular weight marker (Sigma); lanes 1A, 1B, and 1C, RNA from stationary growth phase (18-h culture); lanes 2A, 2B, and 2C, RNA from the middle of the exponential growth phase (OD 600 of ∼0.7); lanes 3A, 3B, and 3C: RNA from the beginning of the exponential growth phase (OD 600 of ∼0.3). Sizes of transcripts are indicated with arrows. The probe specific for the transcript of the gdh ) (data not shown).
Figure Legend Snippet: Transcriptional analysis of cwp cluster. Hybridization DNA-membrane-immobilized RNA on strain 630; 15, 30, and 25 μg of total RNA were used for hybridization with probes specific to slpA (A), cwp66 (B), and cwp84 (C), respectively. MW, RNA molecular weight marker (Sigma); lanes 1A, 1B, and 1C, RNA from stationary growth phase (18-h culture); lanes 2A, 2B, and 2C, RNA from the middle of the exponential growth phase (OD 600 of ∼0.7); lanes 3A, 3B, and 3C: RNA from the beginning of the exponential growth phase (OD 600 of ∼0.3). Sizes of transcripts are indicated with arrows. The probe specific for the transcript of the gdh ) (data not shown).

Techniques Used: Hybridization, Molecular Weight, Marker

Immunoblot analysis of purified fraction GST-Cwp84. Equivalent amounts of the purified fraction were separated by SDS-12% polyacrylamide gel electrophoresis, transferred to a Hybond-P membrane (Amersham Biosciences), and incubated either with anti-GST antibody (lane 2) or anti-Cwp66Nter (lane 3). Revelation was done with phosphatase alkaline-conjugate antigoat antibodies or phosphatase alkaline-conjugate antirabbit antibodies, respectively, with nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Invitrogen). Lane 1, low-range SDS-polyacrylamide gel electrophoresis standard (Bio-Rad). Size markers are given in kilodaltons on the left.
Figure Legend Snippet: Immunoblot analysis of purified fraction GST-Cwp84. Equivalent amounts of the purified fraction were separated by SDS-12% polyacrylamide gel electrophoresis, transferred to a Hybond-P membrane (Amersham Biosciences), and incubated either with anti-GST antibody (lane 2) or anti-Cwp66Nter (lane 3). Revelation was done with phosphatase alkaline-conjugate antigoat antibodies or phosphatase alkaline-conjugate antirabbit antibodies, respectively, with nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Invitrogen). Lane 1, low-range SDS-polyacrylamide gel electrophoresis standard (Bio-Rad). Size markers are given in kilodaltons on the left.

Techniques Used: Purification, Polyacrylamide Gel Electrophoresis, Incubation

5) Product Images from "NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane"

Article Title: NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043050

Immobilization of AAT-6 on the intestinal apical membrane by NRFL-1. A , FRAP analysis of the AAT-6 dynamics was performed in 4-day old worms. Confocal images of AAT-6 (AAT-6 1−517 ::GFP::AAT-6 518–523 ) was compared between aat-6 and nrfl-1 ; aat-6 genetic backgrounds. Top pictures indicate representative images prior to photobleaching ( pre-bleach ), immediately after photobleaching ( post-bleach ), and 300 sec after photobleaching ( recovery ). B , Graph depicts the time course of recovery of AAT-6 fluorescence for nrfl-1 ; aat-6 (•) and aat-6 (□). Recovery was measured with the pre-bleach fluorescence intensity being 100% and the post-bleach intensity being 0%. The recovery curves were generated from 5 separate experiments and the values were expressed as mean ± S.E. (n = 5). Scale bars: 2 µm.
Figure Legend Snippet: Immobilization of AAT-6 on the intestinal apical membrane by NRFL-1. A , FRAP analysis of the AAT-6 dynamics was performed in 4-day old worms. Confocal images of AAT-6 (AAT-6 1−517 ::GFP::AAT-6 518–523 ) was compared between aat-6 and nrfl-1 ; aat-6 genetic backgrounds. Top pictures indicate representative images prior to photobleaching ( pre-bleach ), immediately after photobleaching ( post-bleach ), and 300 sec after photobleaching ( recovery ). B , Graph depicts the time course of recovery of AAT-6 fluorescence for nrfl-1 ; aat-6 (•) and aat-6 (□). Recovery was measured with the pre-bleach fluorescence intensity being 100% and the post-bleach intensity being 0%. The recovery curves were generated from 5 separate experiments and the values were expressed as mean ± S.E. (n = 5). Scale bars: 2 µm.

Techniques Used: Size-exclusion Chromatography, Fluorescence, Generated

Maintenance of AAT-6 on the intestinal luminal membrane by NRFL-1. A , The localization of AAT-6 1−517 ::GFP::AAT-6 518–523 was compared between aat-6 and nrfl-1 ( tm3501 ); aat-6 genetic backgrounds. Epifluorescence images of the distribution of AAT-6 in the intestine are shown for worms two, four and six days after hatching. In six-day old worm, the membranous localization of AAT-6 decayed in nrfl-1 ( tm3501 ); aat-6 , whereas AAT-6 was retained on the luminal membrane in six days in the presence of NRFL-1 ( aat-6 ). Scale bars: 100 µm. Representative pictures from more than ten worms analyzed for each are shown. B , Fluorescence intensity was measured to quantify the age-dependent regulation. The intensity of the intestinal luminal surface was peaked at day four with significantly stronger signal in aat-6 (gray column) compared with nrfl-1 ( tm3501 ); aat-6 (white column). The intensity at day six did not differ significantly between the strains ( luminal membrane ). C , The fluorescence intensity of the whole intestine showed a similar pattern ( whole intestine ). The localization index, luminal intensity divided by whole intestine intensity, quantifies the membranous localization. The six-day old nrfl-1 ( tm3501 ); aat-6 worm had a significantly lower score, showing age-dependent decay in luminal localization ( localization index ). Gray column, aat-6 . White column, nrfl-1 ( tm3501 ); aat-6 . Values are presented with mean ± S.E. (n = 5). D , Immunoblot and densitometric analysis of AAT-6 1−517 ::GFP::AAT-6 518–523 in six-day old worm. Densitometric analysis followed by anti-GFP antibody immunobloting exhibited no significant difference in band intensity between the genetic backgrounds. A representative blot was presented with actin as a loading control. The bar graph indicates the relative band intensities of the respective sample. Values are presented with mean ± S.E. (n = 4).
Figure Legend Snippet: Maintenance of AAT-6 on the intestinal luminal membrane by NRFL-1. A , The localization of AAT-6 1−517 ::GFP::AAT-6 518–523 was compared between aat-6 and nrfl-1 ( tm3501 ); aat-6 genetic backgrounds. Epifluorescence images of the distribution of AAT-6 in the intestine are shown for worms two, four and six days after hatching. In six-day old worm, the membranous localization of AAT-6 decayed in nrfl-1 ( tm3501 ); aat-6 , whereas AAT-6 was retained on the luminal membrane in six days in the presence of NRFL-1 ( aat-6 ). Scale bars: 100 µm. Representative pictures from more than ten worms analyzed for each are shown. B , Fluorescence intensity was measured to quantify the age-dependent regulation. The intensity of the intestinal luminal surface was peaked at day four with significantly stronger signal in aat-6 (gray column) compared with nrfl-1 ( tm3501 ); aat-6 (white column). The intensity at day six did not differ significantly between the strains ( luminal membrane ). C , The fluorescence intensity of the whole intestine showed a similar pattern ( whole intestine ). The localization index, luminal intensity divided by whole intestine intensity, quantifies the membranous localization. The six-day old nrfl-1 ( tm3501 ); aat-6 worm had a significantly lower score, showing age-dependent decay in luminal localization ( localization index ). Gray column, aat-6 . White column, nrfl-1 ( tm3501 ); aat-6 . Values are presented with mean ± S.E. (n = 5). D , Immunoblot and densitometric analysis of AAT-6 1−517 ::GFP::AAT-6 518–523 in six-day old worm. Densitometric analysis followed by anti-GFP antibody immunobloting exhibited no significant difference in band intensity between the genetic backgrounds. A representative blot was presented with actin as a loading control. The bar graph indicates the relative band intensities of the respective sample. Values are presented with mean ± S.E. (n = 4).

Techniques Used: Fluorescence, Western Blot

Interaction of AAT-6 with NRFL-1 in vivo . A , Expression of AAT-6 in worms. AAT-6 1−517 ::GFP::AAT-6 518–523 was localized to the luminal surface ( single arrowhead ) but not to the basal side ( double arrowhead ) of the intestinal epithelia. Scale bar, 25 µm. Non-specific fluorescence on gut granules was seen. More than twenty worms were analyzed. B , Co-localization of AAT-6 and NRFL-1. GFP fluorescence from AAT-6 1−517 ::GFP::AAT-6 518–523 ( top ) was co-localized with immunostaining of NRFL-1 by anti-NRFL-1 antibody visualized by Cy3-labeled secondary antibody ( middle ). Bottom image is merged from top and middle images. Confocal images of a representative intestine section (whole worm) are shown. Scale bar: 25 µm. More than five worms were analyzed. C , Intensity profile along the line A–B in the merged image shows an overlapping of the peaks of the NRFL-1and the AAT-6 signal. D , Immunoprecipitation of NRFL-1/AAT-6 complex from worm lysate. The worm lysate was immunoprecipitated with anti-GFP monoclonal antibody (mouse) and immunoblotted using anti-NRFL-1 antibody. Top : input (2.5%). Middle and bottom : immunoprecipitant was immunoblotted using anti-NRFL-1 antibody and anti-GFP antibody (chicken), respectively. In the middle blot, two major bands of NRFL-1 detected ( arrowheads ), probably reflecting partial dephosphorylation during immunoprecipitation process. A representative blot of two separate experiments is shown.
Figure Legend Snippet: Interaction of AAT-6 with NRFL-1 in vivo . A , Expression of AAT-6 in worms. AAT-6 1−517 ::GFP::AAT-6 518–523 was localized to the luminal surface ( single arrowhead ) but not to the basal side ( double arrowhead ) of the intestinal epithelia. Scale bar, 25 µm. Non-specific fluorescence on gut granules was seen. More than twenty worms were analyzed. B , Co-localization of AAT-6 and NRFL-1. GFP fluorescence from AAT-6 1−517 ::GFP::AAT-6 518–523 ( top ) was co-localized with immunostaining of NRFL-1 by anti-NRFL-1 antibody visualized by Cy3-labeled secondary antibody ( middle ). Bottom image is merged from top and middle images. Confocal images of a representative intestine section (whole worm) are shown. Scale bar: 25 µm. More than five worms were analyzed. C , Intensity profile along the line A–B in the merged image shows an overlapping of the peaks of the NRFL-1and the AAT-6 signal. D , Immunoprecipitation of NRFL-1/AAT-6 complex from worm lysate. The worm lysate was immunoprecipitated with anti-GFP monoclonal antibody (mouse) and immunoblotted using anti-NRFL-1 antibody. Top : input (2.5%). Middle and bottom : immunoprecipitant was immunoblotted using anti-NRFL-1 antibody and anti-GFP antibody (chicken), respectively. In the middle blot, two major bands of NRFL-1 detected ( arrowheads ), probably reflecting partial dephosphorylation during immunoprecipitation process. A representative blot of two separate experiments is shown.

Techniques Used: In Vivo, Expressing, Fluorescence, Immunostaining, Labeling, Immunoprecipitation, De-Phosphorylation Assay

PDZ interaction between NRFL-1 and AAT-6. A , Yeast-two hybrid assay. Full-length NRFL-1 was used as a prey, whereas the empty bait vector ( control ), AAT-6 C -terminus tail corresponding to residues 487–523 ( AAT-6 ), and AAT-6 C -terminus tail without PDZ bindings motif (Δ TRM ) were used as baits. Each bait-prey pair was assessed for LEU2 and GFP reporters. The pair of AAT-6 C -terminus tail and NRFL-1 grew on the medium without leucine and glowed. Similar results were obtained in three different experiments. B , GST pull-down assay. 3×FLAG-NRFL-1 was pulled down by GST fusion of AAT-6 C -terminus tail corresponding to residues 487–523 ( GST-AAT-6 ), but not by GST ( GST ) or GST fusion of AAT-6 C -terminus tail without PDZ binding motif ( GST- Δ TRM ). Upper , pull-down products probed by anti-FLAG antibody. Lower , pull-down products reprobed by anti-GST antibody. A representative blot from three experiments is shown. C , Domain analysis by GST pull-down assay. Lanes 1, 2, 3 and 4 are for 3×FLAG-NRFL-1 (wild type), 3×FLAG-NRFL-1 with PDZ I/PDZ II both mutated (G26A/Y27A and E154A/F155A), 3×FLAG-NRFL-1 with PDZ I mutated (G26A/Y27A), and 3×FLAG-NRFL-1 with PDZ II mutated (E154A/F155A), respectively. GST fusion of AAT-6 C -terminus tail corresponding to residues 487–523 ( GST-AAT-6 ) pulled down 3×FLAG-NRFL-1 (wild type) and 3×FLAG-NRFL-1 with PDZ II mutated but not 3×FLAG-NRFL-1 with PDZ I/PDZ II both mutated and 3×FLAG-NRFL-1 with PDZ II mutated, suggesting that PDZ II is the preferred domain for interacting with AAT-6. + and – in the figure denote wild type and mutated domain, respectively. Upper , input (1/10 of sample volume); middle , pull-down products probed by anti-FLAG antibody; bottom , pull-down product reprobed by anti-GST antibody. A representative blot from three experiments is shown.
Figure Legend Snippet: PDZ interaction between NRFL-1 and AAT-6. A , Yeast-two hybrid assay. Full-length NRFL-1 was used as a prey, whereas the empty bait vector ( control ), AAT-6 C -terminus tail corresponding to residues 487–523 ( AAT-6 ), and AAT-6 C -terminus tail without PDZ bindings motif (Δ TRM ) were used as baits. Each bait-prey pair was assessed for LEU2 and GFP reporters. The pair of AAT-6 C -terminus tail and NRFL-1 grew on the medium without leucine and glowed. Similar results were obtained in three different experiments. B , GST pull-down assay. 3×FLAG-NRFL-1 was pulled down by GST fusion of AAT-6 C -terminus tail corresponding to residues 487–523 ( GST-AAT-6 ), but not by GST ( GST ) or GST fusion of AAT-6 C -terminus tail without PDZ binding motif ( GST- Δ TRM ). Upper , pull-down products probed by anti-FLAG antibody. Lower , pull-down products reprobed by anti-GST antibody. A representative blot from three experiments is shown. C , Domain analysis by GST pull-down assay. Lanes 1, 2, 3 and 4 are for 3×FLAG-NRFL-1 (wild type), 3×FLAG-NRFL-1 with PDZ I/PDZ II both mutated (G26A/Y27A and E154A/F155A), 3×FLAG-NRFL-1 with PDZ I mutated (G26A/Y27A), and 3×FLAG-NRFL-1 with PDZ II mutated (E154A/F155A), respectively. GST fusion of AAT-6 C -terminus tail corresponding to residues 487–523 ( GST-AAT-6 ) pulled down 3×FLAG-NRFL-1 (wild type) and 3×FLAG-NRFL-1 with PDZ II mutated but not 3×FLAG-NRFL-1 with PDZ I/PDZ II both mutated and 3×FLAG-NRFL-1 with PDZ II mutated, suggesting that PDZ II is the preferred domain for interacting with AAT-6. + and – in the figure denote wild type and mutated domain, respectively. Upper , input (1/10 of sample volume); middle , pull-down products probed by anti-FLAG antibody; bottom , pull-down product reprobed by anti-GST antibody. A representative blot from three experiments is shown.

Techniques Used: Y2H Assay, Plasmid Preparation, Pull Down Assay, Binding Assay

6) Product Images from "Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons"

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons

Journal: Biochimica et Biophysica Acta

doi: 10.1016/j.bbamcr.2013.02.012

Subcellular distribution of RTN1A in Purkinje cells. (A) Electron micrograph of a Purkinje cell dendrite immunolabeled for RTN1A (MON162 antibody) using the HRP-DAB technique. (B) Higher magnification of the area boxed in A. The electron opaque peroxidase end product can be seen around cisternal organelles and vesicles of the smooth endoplasmic reticulum (indicated by filled arrows), but not the plasma membrane of the Purkinje cell. Empty arrows indicate unlabeled organelles. (C) Electron micrograph of a Purkinje cell dendrite immunolabeled for RTN1A (MON162 antibody) using the silver-enhanced nanogold technique. Immunometal particles can be seen decorating the membrane of cisternal organelles and vesicles of the smooth endoplasmic reticulum but not the mitochondria (m). (D) Immunometal particles for RTN1A can be observed associated with the smooth endoplasmic reticulum within Purkinje cell spines (sp). Scale bars: A, 2 μm; B, 1 μm; C–D, 500 nm.
Figure Legend Snippet: Subcellular distribution of RTN1A in Purkinje cells. (A) Electron micrograph of a Purkinje cell dendrite immunolabeled for RTN1A (MON162 antibody) using the HRP-DAB technique. (B) Higher magnification of the area boxed in A. The electron opaque peroxidase end product can be seen around cisternal organelles and vesicles of the smooth endoplasmic reticulum (indicated by filled arrows), but not the plasma membrane of the Purkinje cell. Empty arrows indicate unlabeled organelles. (C) Electron micrograph of a Purkinje cell dendrite immunolabeled for RTN1A (MON162 antibody) using the silver-enhanced nanogold technique. Immunometal particles can be seen decorating the membrane of cisternal organelles and vesicles of the smooth endoplasmic reticulum but not the mitochondria (m). (D) Immunometal particles for RTN1A can be observed associated with the smooth endoplasmic reticulum within Purkinje cell spines (sp). Scale bars: A, 2 μm; B, 1 μm; C–D, 500 nm.

Techniques Used: Immunolabeling

GST-RTN1 523 inhibits specific [ 3 H]ryanodine binding to rat brain synaptosomes. (A) Equilibrium [ 3 H]ryanodine binding to rat forebrain synaptosomal membrane preparations was carried out in binding buffer containing 10 nM [ 3 H]ryanodine at the indicated free calcium concentrations in control conditions ( closed circles ) and in the presence of 0.1 μM GST ( closed triangles ) or 0.1 μM GST-RTN1 523 ( open squares ). [Ca 2 + ] was maintained, in the range 0.01 μM–1 mM, by a combination of EGTA and CaCl 2 . Free Ca 2 + concentrations were calculated as described in material and methods. Data points shown are the mean ± S.E.M., from three separate experiments performed in triplicates. (B) [ 3 H]ryanodine binding in the presence of 0.1 μM GST or GST-RTN1 523 is presented as percent of control. No specific [ 3 H]ryanodine binding was observed at 0.01 μM Ca 2 + in the presence of GST or GST-RTN1 523 . Difference in [ 3 H]ryanodine binding was plotted as percent decrease in specific binding. Data points shown are the mean ± S.E.M., from three separate experiments (* p = 0.011 by Student's t -test). (C) RyR2 evoked Ca 2 + oscillations in HEK293. Upper and lower left panels represent Fura-2 ratio time-courses of single cells expressing RyR2 together with mcherry, mcherry-RTN1A or EGFP-RTN4A. Cells were continuously perfused with buffer containing 0 mM Ca 2 + (nominal free), 1 mM Ca 2 + and 0 mM Ca 2 + + 10 mM caffeine as indicated by the bars at the top. Lower right panel shows a quantitative analysis performed by integration of the respective single peak areas referred to area under curve for estimation of the total amount of the cytosolic [Ca 2 + ] arising through RyR2 dependent Ca 2 + oscillations. The fraction of cells that showed both oscillations as well as a clear caffeine peak in comparison to those that lacked oscillations before a single caffeine peak are given in percentages in the graph. A two-sample t-test was carried out to test for significance as indicated by the p values at the bottom of the panel.
Figure Legend Snippet: GST-RTN1 523 inhibits specific [ 3 H]ryanodine binding to rat brain synaptosomes. (A) Equilibrium [ 3 H]ryanodine binding to rat forebrain synaptosomal membrane preparations was carried out in binding buffer containing 10 nM [ 3 H]ryanodine at the indicated free calcium concentrations in control conditions ( closed circles ) and in the presence of 0.1 μM GST ( closed triangles ) or 0.1 μM GST-RTN1 523 ( open squares ). [Ca 2 + ] was maintained, in the range 0.01 μM–1 mM, by a combination of EGTA and CaCl 2 . Free Ca 2 + concentrations were calculated as described in material and methods. Data points shown are the mean ± S.E.M., from three separate experiments performed in triplicates. (B) [ 3 H]ryanodine binding in the presence of 0.1 μM GST or GST-RTN1 523 is presented as percent of control. No specific [ 3 H]ryanodine binding was observed at 0.01 μM Ca 2 + in the presence of GST or GST-RTN1 523 . Difference in [ 3 H]ryanodine binding was plotted as percent decrease in specific binding. Data points shown are the mean ± S.E.M., from three separate experiments (* p = 0.011 by Student's t -test). (C) RyR2 evoked Ca 2 + oscillations in HEK293. Upper and lower left panels represent Fura-2 ratio time-courses of single cells expressing RyR2 together with mcherry, mcherry-RTN1A or EGFP-RTN4A. Cells were continuously perfused with buffer containing 0 mM Ca 2 + (nominal free), 1 mM Ca 2 + and 0 mM Ca 2 + + 10 mM caffeine as indicated by the bars at the top. Lower right panel shows a quantitative analysis performed by integration of the respective single peak areas referred to area under curve for estimation of the total amount of the cytosolic [Ca 2 + ] arising through RyR2 dependent Ca 2 + oscillations. The fraction of cells that showed both oscillations as well as a clear caffeine peak in comparison to those that lacked oscillations before a single caffeine peak are given in percentages in the graph. A two-sample t-test was carried out to test for significance as indicated by the p values at the bottom of the panel.

Techniques Used: Binding Assay, Expressing

Immunohistochemical distribution pattern of RTN1A and RyR2 in rat hippocampus and cerebellum. Representative staining patterns for RTN1A (A,C,D) and RyR2 (B,E) on sections of rat hippocampus (A,B) and cerebellar cortex (C,D,E). In the hippocampus, immunoreactivity for both proteins is found in granule cells (G), mossy fiber axons, and in stratum lucidum (SL). In the cerebellum, RTN1A-immunoreactivity was confined to Purkinje cell bodies (P), their dendrites in ML (C; arrow) and axons (D; arrowheads). (E) Confocal immunofluorescent image showing RyR2 staining in Purkinje cells. Unlike RTN1A, RyR2 was also found in granule cell layer (Gl). Scale bars: A and B, 500 μm; H, hilus; G, Granule cell layer; So, stratum oriens; Sr, stratum radiatum; Slm, stratum lacunosum molecular; Iml, inner molecular layer; M + Oml, Middle outer molecular layer; CA1-3, Cornu ammonis; SL, stratum lucidum; S, Subiculum; Pr, Presubiculum; Pa, Parasubiculum.
Figure Legend Snippet: Immunohistochemical distribution pattern of RTN1A and RyR2 in rat hippocampus and cerebellum. Representative staining patterns for RTN1A (A,C,D) and RyR2 (B,E) on sections of rat hippocampus (A,B) and cerebellar cortex (C,D,E). In the hippocampus, immunoreactivity for both proteins is found in granule cells (G), mossy fiber axons, and in stratum lucidum (SL). In the cerebellum, RTN1A-immunoreactivity was confined to Purkinje cell bodies (P), their dendrites in ML (C; arrow) and axons (D; arrowheads). (E) Confocal immunofluorescent image showing RyR2 staining in Purkinje cells. Unlike RTN1A, RyR2 was also found in granule cell layer (Gl). Scale bars: A and B, 500 μm; H, hilus; G, Granule cell layer; So, stratum oriens; Sr, stratum radiatum; Slm, stratum lacunosum molecular; Iml, inner molecular layer; M + Oml, Middle outer molecular layer; CA1-3, Cornu ammonis; SL, stratum lucidum; S, Subiculum; Pr, Presubiculum; Pa, Parasubiculum.

Techniques Used: Immunohistochemistry, Staining

Identification of RyR2 as a binding partner of RTN1A. (A) Schematic representation of full length RTN1A and the GST-RTN1 523 construct ( right ). RHD: reticulon homology domain; TM1 and TM2: transmembrane domain 1 and 2. GST pull-downs were performed with GST-RTN1 523 using detergent-solubilized mouse brain proteins. GST or empty glutathione beads served as negative controls, whereas GST-NiR was tested to control for GST-RTN1 523 binding specificity. Arrow denotes protein band that was consistently pulled down with GST-RTN1 523 and from which RyR2 was identified by mass spectrometry. Note that this band is absent in the different control samples. Asterisks indicate the GST fusion proteins and their relative amounts used in the GST pull-down. The silver stained gel shown is representative of three independent experiments. (B) Upper panel , Western Blot of samples from (A) probed with RyR2 antibody. Note the double-band that is identified as RyR2. The higher molecular mass band corresponds to intact RyR2, while the lower band presumably represents a proteolytic degradation fragment of RyR2. The intensity of the RyR2 bands increase with increasing amounts of GST-RTN1 523 . Lower panel , shows Ponceau S staining of the pull-downs to assess the relative amounts of each GST fusion protein. Input lane shows one-twentieth of the amount used for pull-down. WB, Western blot. The Western blot shown is representative of three independent experiments.
Figure Legend Snippet: Identification of RyR2 as a binding partner of RTN1A. (A) Schematic representation of full length RTN1A and the GST-RTN1 523 construct ( right ). RHD: reticulon homology domain; TM1 and TM2: transmembrane domain 1 and 2. GST pull-downs were performed with GST-RTN1 523 using detergent-solubilized mouse brain proteins. GST or empty glutathione beads served as negative controls, whereas GST-NiR was tested to control for GST-RTN1 523 binding specificity. Arrow denotes protein band that was consistently pulled down with GST-RTN1 523 and from which RyR2 was identified by mass spectrometry. Note that this band is absent in the different control samples. Asterisks indicate the GST fusion proteins and their relative amounts used in the GST pull-down. The silver stained gel shown is representative of three independent experiments. (B) Upper panel , Western Blot of samples from (A) probed with RyR2 antibody. Note the double-band that is identified as RyR2. The higher molecular mass band corresponds to intact RyR2, while the lower band presumably represents a proteolytic degradation fragment of RyR2. The intensity of the RyR2 bands increase with increasing amounts of GST-RTN1 523 . Lower panel , shows Ponceau S staining of the pull-downs to assess the relative amounts of each GST fusion protein. Input lane shows one-twentieth of the amount used for pull-down. WB, Western blot. The Western blot shown is representative of three independent experiments.

Techniques Used: Binding Assay, Construct, Mass Spectrometry, Staining, Western Blot

RTN1A associates preferentially with RyR2 channel in vivo . (A) Left panels , detergent-solubilized protein from HEK293 cells transiently transfected with untagged RyR2 plus RTN1A-myc was immunoprecipitated (IP) with rabbit polyclonal anti-RTN1A antibodies or control rabbit IgG. Immunoprecipitated proteins were detected on immunoblots with monoclonal anti-RyR2 or anti-RTN1A antibodies. Note that native HEK293 cells do not express endogenous levels of RTN1A or RyR2. Right panels , detergent-solubilized protein from HEK293 cells transiently transfected with untagged RyR2 plus RTN4A-myc was immunoprecipitated with rabbit polyclonal anti-RTN4 antibodies or control rabbit IgG. Immunoprecipitated proteins were detected on immunoblots with monoclonal anti-RyR2 or anti-RTN4A antibodies. Input lane shows one-eighth of the amount used for immunoprecipitation. WB, Western blot. (B) Detergent-solubilized protein from rat cerebellum was used for co-immunoprecipitations with rabbit anti-RTN1A, rabbit anti-RTN1A, or control rabbit IgG. Immunoprecipitated proteins were resolved by SDS-PAGE blotted on PVDF membranes and probed with monoclonal antibodies as indicated at the right. Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. (C) Detergent-solubilized protein from rat cerebellum was used for co-immunoprecipitations with mouse anti-RyR2, mouse anti-RTN1A, mouse anti-RTN1A, or control mouse IgG. Immunoprecipitated proteins were resolved by SDS-PAGE, blotted on PVDF membranes and probed with antibodies as indicated at the right. Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. (D) Detergent-solubilized protein from rat cerebellum was immunoprecipitated with mouse anti-RTN1A, mouse anti-RyR2, or control mouse IgG. Immunoprecipitated proteins were resolved by SDS-PAGE, blotted on PVDF membranes and probed with antibodies as indicated at the right. Note that RyR1 co-immunoprecipitates with mouse anti-RyR2, but not with mouse anti-RTN1A antibodies. Input lane shows one-fifth of the amount used for immunoprecipitation. WB, Western blot.
Figure Legend Snippet: RTN1A associates preferentially with RyR2 channel in vivo . (A) Left panels , detergent-solubilized protein from HEK293 cells transiently transfected with untagged RyR2 plus RTN1A-myc was immunoprecipitated (IP) with rabbit polyclonal anti-RTN1A antibodies or control rabbit IgG. Immunoprecipitated proteins were detected on immunoblots with monoclonal anti-RyR2 or anti-RTN1A antibodies. Note that native HEK293 cells do not express endogenous levels of RTN1A or RyR2. Right panels , detergent-solubilized protein from HEK293 cells transiently transfected with untagged RyR2 plus RTN4A-myc was immunoprecipitated with rabbit polyclonal anti-RTN4 antibodies or control rabbit IgG. Immunoprecipitated proteins were detected on immunoblots with monoclonal anti-RyR2 or anti-RTN4A antibodies. Input lane shows one-eighth of the amount used for immunoprecipitation. WB, Western blot. (B) Detergent-solubilized protein from rat cerebellum was used for co-immunoprecipitations with rabbit anti-RTN1A, rabbit anti-RTN1A, or control rabbit IgG. Immunoprecipitated proteins were resolved by SDS-PAGE blotted on PVDF membranes and probed with monoclonal antibodies as indicated at the right. Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. (C) Detergent-solubilized protein from rat cerebellum was used for co-immunoprecipitations with mouse anti-RyR2, mouse anti-RTN1A, mouse anti-RTN1A, or control mouse IgG. Immunoprecipitated proteins were resolved by SDS-PAGE, blotted on PVDF membranes and probed with antibodies as indicated at the right. Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. (D) Detergent-solubilized protein from rat cerebellum was immunoprecipitated with mouse anti-RTN1A, mouse anti-RyR2, or control mouse IgG. Immunoprecipitated proteins were resolved by SDS-PAGE, blotted on PVDF membranes and probed with antibodies as indicated at the right. Note that RyR1 co-immunoprecipitates with mouse anti-RyR2, but not with mouse anti-RTN1A antibodies. Input lane shows one-fifth of the amount used for immunoprecipitation. WB, Western blot.

Techniques Used: In Vivo, Transfection, Immunoprecipitation, Western Blot, SDS Page

Identification of the RyR2 binding domain. (A) Schematic representation of rat RTN1A protein and RTN1A fragments used to construct GST fusion proteins for the pull-down experiments. HHD: high homology domain; LNT: long N-terminal fragment. (B) GST-RTN1 fragments were used as baits in pull-down experiments using detergent-solubilized mouse brain proteins. GST, GST-NiR or empty glutathione beads served as negative controls. Binding of RyR2 was subsequently detected by immunoblot ( upper panel ). Ponceau S staining of the pull-downs shows the relative amounts of each GST fusion protein ( lower panel ). Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. Results are representative of three independent experiments.
Figure Legend Snippet: Identification of the RyR2 binding domain. (A) Schematic representation of rat RTN1A protein and RTN1A fragments used to construct GST fusion proteins for the pull-down experiments. HHD: high homology domain; LNT: long N-terminal fragment. (B) GST-RTN1 fragments were used as baits in pull-down experiments using detergent-solubilized mouse brain proteins. GST, GST-NiR or empty glutathione beads served as negative controls. Binding of RyR2 was subsequently detected by immunoblot ( upper panel ). Ponceau S staining of the pull-downs shows the relative amounts of each GST fusion protein ( lower panel ). Input lane shows one-tenth of the amount used for immunoprecipitation. WB, Western blot. Results are representative of three independent experiments.

Techniques Used: Binding Assay, Construct, Staining, Immunoprecipitation, Western Blot

7) Product Images from "Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production"

Article Title: Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production

Journal: Proceedings of the Japan Academy. Series B, Physical and Biological Sciences

doi: 10.2183/pjab.87.563

NEDD4 activated Akt signaling pathway through diminished PTEN protein level in fibroblasts. (A) In vitro ubiquitination assay of PTEN by NEDD4. NEDD4 ubiquitinated PTEN directly. (B) NEDD4 ubiquitinated PTEN directly and promoted the protein degradation. Immunoblot analysis for endogenous PTEN in NEDD4 over-expressing NIH3T3 cells. Control or NEDD4 expression vector were transfected and incubated for 48 h. β-actin (ACTB) was blotted as the loading control. (C) Over-expression of NEDD4 in NIH3T3 cells enhanced the phosphorylation level of Akt. Control or NEDD4 expression vector were transfected and incubated for 48 h. Phosphor-Akt and total Akt were detected by immunoblotting. β-actin (ACTB) was blotted as the loading control.
Figure Legend Snippet: NEDD4 activated Akt signaling pathway through diminished PTEN protein level in fibroblasts. (A) In vitro ubiquitination assay of PTEN by NEDD4. NEDD4 ubiquitinated PTEN directly. (B) NEDD4 ubiquitinated PTEN directly and promoted the protein degradation. Immunoblot analysis for endogenous PTEN in NEDD4 over-expressing NIH3T3 cells. Control or NEDD4 expression vector were transfected and incubated for 48 h. β-actin (ACTB) was blotted as the loading control. (C) Over-expression of NEDD4 in NIH3T3 cells enhanced the phosphorylation level of Akt. Control or NEDD4 expression vector were transfected and incubated for 48 h. Phosphor-Akt and total Akt were detected by immunoblotting. β-actin (ACTB) was blotted as the loading control.

Techniques Used: In Vitro, Ubiquitin Assay, Expressing, Plasmid Preparation, Transfection, Incubation, Over Expression

8) Product Images from "Aprataxin, causative gene product for EAOH/AOA1, repairs DNA single-strand breaks with damaged 3?-phosphate and 3?-phosphoglycolate ends"

Article Title: Aprataxin, causative gene product for EAOH/AOA1, repairs DNA single-strand breaks with damaged 3?-phosphate and 3?-phosphoglycolate ends

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkm158

Model of aprataxin-dependent SSBR pathway. Four SSBR pathways defined by the type of enzyme that removes damaged 3′-ends are shown (a, b, c and d). SSBs can arise directly from sugar damage or TOP1 cleavage or indirectly from base damage. Red circles denote the damaged ends, the specific types of which are dependent on the source of the break. [1,2] PARP detects SSBs, thereby recruiting the XRCC1 and Lig3 complex. XRCC1 then replaces PARP. [ 3 ] The processing of damaged 3′-ends is mediated by either APE1 ( a ), aprataxin ( b ), PNKP ( c ) or TDP1 ( d ), depending on the type of damaged 3′-end. These damaged 3′-ends should be converted to 3′-OH ends for subsequent repair processes. In the pathway for repairing indirectly induced SSBs, damaged 3′-α, β unsaturated aldehyde ends are removed by APE1 (a). In the pathway for repairing directly induced SSBs, 3′-PG ends might be removed by aprataxin (b) and 3′-phosphate ends by aprataxin or PNKP (b,c). In the pathway for repairing TOP1-mediated SSBs, TOP1 covalent complexes at the 3′-ends are restored to 3′-phosphate ends by TDP1 (d). [ 4 ] After removing damaged 3′-ends, Pol β fills the gap (red dot line). [ 5 ] Lig3 seals the single-strand nick (red line).
Figure Legend Snippet: Model of aprataxin-dependent SSBR pathway. Four SSBR pathways defined by the type of enzyme that removes damaged 3′-ends are shown (a, b, c and d). SSBs can arise directly from sugar damage or TOP1 cleavage or indirectly from base damage. Red circles denote the damaged ends, the specific types of which are dependent on the source of the break. [1,2] PARP detects SSBs, thereby recruiting the XRCC1 and Lig3 complex. XRCC1 then replaces PARP. [ 3 ] The processing of damaged 3′-ends is mediated by either APE1 ( a ), aprataxin ( b ), PNKP ( c ) or TDP1 ( d ), depending on the type of damaged 3′-end. These damaged 3′-ends should be converted to 3′-OH ends for subsequent repair processes. In the pathway for repairing indirectly induced SSBs, damaged 3′-α, β unsaturated aldehyde ends are removed by APE1 (a). In the pathway for repairing directly induced SSBs, 3′-PG ends might be removed by aprataxin (b) and 3′-phosphate ends by aprataxin or PNKP (b,c). In the pathway for repairing TOP1-mediated SSBs, TOP1 covalent complexes at the 3′-ends are restored to 3′-phosphate ends by TDP1 (d). [ 4 ] After removing damaged 3′-ends, Pol β fills the gap (red dot line). [ 5 ] Lig3 seals the single-strand nick (red line).

Techniques Used:

Expression and purification of recombinant aprataxin in baculovirus expression system. ( A ) Construct of His-tagged long-form aprataxin (His-LA) expressed using Bac-to-Bac® Baculovirus Expression System. ( B ) Chromatogram of gel-filtered aprataxin. Following immobilized metal affinity chromatography, the aprataxin-rich fraction was purified by gel filtration column chromatography. A major peak was observed for each of the fractions from 13 to 20 in the chromatogram. ( C ) The fractionated extracts were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). A 39-kDa single band is detected for each of the fractions from 14 to 19. Western blot analysis using the anti-His antibody ( D ) and anti-aprataxin antibody ( E ) shows a 39-kDa immunoreactive product in each of the fractions from 13 to 21.
Figure Legend Snippet: Expression and purification of recombinant aprataxin in baculovirus expression system. ( A ) Construct of His-tagged long-form aprataxin (His-LA) expressed using Bac-to-Bac® Baculovirus Expression System. ( B ) Chromatogram of gel-filtered aprataxin. Following immobilized metal affinity chromatography, the aprataxin-rich fraction was purified by gel filtration column chromatography. A major peak was observed for each of the fractions from 13 to 20 in the chromatogram. ( C ) The fractionated extracts were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). A 39-kDa single band is detected for each of the fractions from 14 to 19. Western blot analysis using the anti-His antibody ( D ) and anti-aprataxin antibody ( E ) shows a 39-kDa immunoreactive product in each of the fractions from 13 to 21.

Techniques Used: Expressing, Purification, Recombinant, Construct, BAC Assay, Affinity Chromatography, Filtration, Column Chromatography, SDS Page, Staining, Western Blot

Disease-associated mutant forms of aprataxin lack their 3′-end processing activity. ( A ) Mutant forms of aprataxin fail to remove 3′-phosphate. The 5′-FITC-labeled 3′-phosphate (3′ − PO 3 ⁁ −) oligonucleotide was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 2–4), SA (lanes 5–7), FHA (lanes 8–10), P206L (lanes 11–13), and V263G (lanes 14–16) at different incubation times (0, 30 and 60 min). A band of the same size as that corresponding to the 3′-hydroxyl (3′-OH) oligonucleotide (lane 1) appears in lanes with LA (lanes 3 and 4). SA showed a weak phosphatase activity (lanes 5–7). Neither FHA, P206L nor V263G showed phosphatase activity (lanes 8–16). ( B ) Mutant forms of aprataxin fail to remove 3′-phosphoglycolate. The 5′-FITC-labeled 3′-PG oligonucleotide was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 3–5), SA (lanes 6–8), FHA (lanes 9–11), P206L (lanes 12–14) and V263G (lanes 15–17) at different incubation times (0, 30 and 60 min). A band of the same size as that corresponding to the 3′-OH oligonucleotide (lane 2) appears in lanes with LA (lanes 3 and 4). SA showed a weak 3′-PG hydrolase activity (lanes 6–8). Neither FHA, P206L nor V263G removed 3′-PG (lanes 9–17).
Figure Legend Snippet: Disease-associated mutant forms of aprataxin lack their 3′-end processing activity. ( A ) Mutant forms of aprataxin fail to remove 3′-phosphate. The 5′-FITC-labeled 3′-phosphate (3′ − PO 3 ⁁ −) oligonucleotide was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 2–4), SA (lanes 5–7), FHA (lanes 8–10), P206L (lanes 11–13), and V263G (lanes 14–16) at different incubation times (0, 30 and 60 min). A band of the same size as that corresponding to the 3′-hydroxyl (3′-OH) oligonucleotide (lane 1) appears in lanes with LA (lanes 3 and 4). SA showed a weak phosphatase activity (lanes 5–7). Neither FHA, P206L nor V263G showed phosphatase activity (lanes 8–16). ( B ) Mutant forms of aprataxin fail to remove 3′-phosphoglycolate. The 5′-FITC-labeled 3′-PG oligonucleotide was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 3–5), SA (lanes 6–8), FHA (lanes 9–11), P206L (lanes 12–14) and V263G (lanes 15–17) at different incubation times (0, 30 and 60 min). A band of the same size as that corresponding to the 3′-OH oligonucleotide (lane 2) appears in lanes with LA (lanes 3 and 4). SA showed a weak 3′-PG hydrolase activity (lanes 6–8). Neither FHA, P206L nor V263G removed 3′-PG (lanes 9–17).

Techniques Used: Mutagenesis, Activity Assay, Labeling, Incubation, Recombinant

Aprataxin 3′-end processing activities on ss and ds DNA substrates. ( A–C ) 3′-Phosphatase activity of aprataxin on ss and ds DNA substrates. (A) The ss, recessed, one-nucleotide gapped and nicked DNA substrates with 3′-phosphate ends used are shown schematically. (B) Aprataxin preferentially acts on ss DNA. The substrates were incubated with 20 nM LA for the indicated times (0, 30, 60 and 90 min) at 37°C. Products were separated by denaturing PAGE and visualized using a Typhoon 9400 scanner (GE Healthcare). (C) Production rates in each reaction were quantified by ImageQuant TL (GE Healthcare). Error bars indicate standard errors for more than three independent experiments. ( D–F ) 3′-PG hydrolase activity of aprataxin on ss and ds DNA substrates. (D) The ss, recessed, one-nucleotide gapped and nicked DNA substrates with 3′-PG ends used are shown schematically. (E) Aprataxin preferentially acts on ss and gapped DNA. The substrates were incubated with 20 nM LA for the indicated times (0, 30, 60 and 90 min) at 37°C. (F) Production rates in each reaction were quantified as described above.
Figure Legend Snippet: Aprataxin 3′-end processing activities on ss and ds DNA substrates. ( A–C ) 3′-Phosphatase activity of aprataxin on ss and ds DNA substrates. (A) The ss, recessed, one-nucleotide gapped and nicked DNA substrates with 3′-phosphate ends used are shown schematically. (B) Aprataxin preferentially acts on ss DNA. The substrates were incubated with 20 nM LA for the indicated times (0, 30, 60 and 90 min) at 37°C. Products were separated by denaturing PAGE and visualized using a Typhoon 9400 scanner (GE Healthcare). (C) Production rates in each reaction were quantified by ImageQuant TL (GE Healthcare). Error bars indicate standard errors for more than three independent experiments. ( D–F ) 3′-PG hydrolase activity of aprataxin on ss and ds DNA substrates. (D) The ss, recessed, one-nucleotide gapped and nicked DNA substrates with 3′-PG ends used are shown schematically. (E) Aprataxin preferentially acts on ss and gapped DNA. The substrates were incubated with 20 nM LA for the indicated times (0, 30, 60 and 90 min) at 37°C. (F) Production rates in each reaction were quantified as described above.

Techniques Used: Activity Assay, Incubation, Polyacrylamide Gel Electrophoresis

Expression of recombinant GST-aprataxin fusion protein. ( A ) Constructs of GST-aprataxin fusion proteins. Constructs of GST fusion protein containing full-length aprataxin (long-form aprataxin, LA), the C-terminal region of aprataxin (short-form aprataxin, SA), the N-terminal FHA domain of aprataxin (FHA) and full-length aprataxin with P206L or V263G (P206L, V263G). ( B ) Expression and purification of GST-aprataxin fusion proteins. Recombinant GST fusion proteins containing LA (lanes 1, 6 and 11), SA (lanes 2, 7 and 12), FHA (lanes 3, 8 and 13), P206L (lanes 4, 9 and 14) and V263G (lanes 5, 10 and 15) were expressed in the bacterial expression system. Purified products were analyzed by CBB staining (left panel), and western blotting using the anti-GST antibody (middle panel) or anti-aprataxin antibody (right panel).
Figure Legend Snippet: Expression of recombinant GST-aprataxin fusion protein. ( A ) Constructs of GST-aprataxin fusion proteins. Constructs of GST fusion protein containing full-length aprataxin (long-form aprataxin, LA), the C-terminal region of aprataxin (short-form aprataxin, SA), the N-terminal FHA domain of aprataxin (FHA) and full-length aprataxin with P206L or V263G (P206L, V263G). ( B ) Expression and purification of GST-aprataxin fusion proteins. Recombinant GST fusion proteins containing LA (lanes 1, 6 and 11), SA (lanes 2, 7 and 12), FHA (lanes 3, 8 and 13), P206L (lanes 4, 9 and 14) and V263G (lanes 5, 10 and 15) were expressed in the bacterial expression system. Purified products were analyzed by CBB staining (left panel), and western blotting using the anti-GST antibody (middle panel) or anti-aprataxin antibody (right panel).

Techniques Used: Expressing, Recombinant, Construct, Purification, Staining, Western Blot

3′-End processing by aprataxin. ( A ) Aprataxin removes 3′-phosphate. The 5′-FITC-labeled 3′-phosphate (3′ − PO 3 ⁁ −) oligonucleotide was incubated in the absence (lane 2) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 3–5). A band with the same size as that of the 3′-hydroxyl (3′-OH) oligonucleotide (lane 1) appears in lanes with aprataxin (lanes 3–5). 5′-Polynucleotide kinase 3′-phosphatase (PNKP) was used as the positive control (lane 6). Reaction products were separated by 20% PAGE and visualized using a fluorescence gel scanner. ( B ) Aprataxin removes DNA 3′-phosphoglycolate. The 5′-FITC–labeled 3′-phosphoglycolate (3′-PG) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-OH oligonucleotide increases with aprataxin concentration (lanes 2–4). Apurinic/apyrimidinic endonuclease (APE1) was used as the positive control (lane 5). ( C ) Aprataxin fails to remove 3′-α, β-unsaturated aldehyde. The 5′-FITC-labeled 3′-α, β-unsaturated aldehyde (3′-UA) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-UA oligonucleotide does not decrease with increasing aprataxin concentration (lanes 2–4). The 3′-OH oligonucleotides were generated in the presence of APE1 (lane 5). The faint smear corresponding to the 3′-UA oligonucleotide in lanes 1–5 is an artifact generated under the electrophoresis conditions employed. ( D ) Aprataxin fails to remove 3′-phosphotyrosine end. The 5′-FITC-labeled 3′-phosphotyrosine (3′-Y) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-Y oligonucleotide do not decrease with increasing aprataxin concentration (lanes 2–4). 3′-PO 3 oligonucleotides were generated in the presence of tyrosyl-DNA phosphodiesterase 1 (TDP1) (lane 5).
Figure Legend Snippet: 3′-End processing by aprataxin. ( A ) Aprataxin removes 3′-phosphate. The 5′-FITC-labeled 3′-phosphate (3′ − PO 3 ⁁ −) oligonucleotide was incubated in the absence (lane 2) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 3–5). A band with the same size as that of the 3′-hydroxyl (3′-OH) oligonucleotide (lane 1) appears in lanes with aprataxin (lanes 3–5). 5′-Polynucleotide kinase 3′-phosphatase (PNKP) was used as the positive control (lane 6). Reaction products were separated by 20% PAGE and visualized using a fluorescence gel scanner. ( B ) Aprataxin removes DNA 3′-phosphoglycolate. The 5′-FITC–labeled 3′-phosphoglycolate (3′-PG) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-OH oligonucleotide increases with aprataxin concentration (lanes 2–4). Apurinic/apyrimidinic endonuclease (APE1) was used as the positive control (lane 5). ( C ) Aprataxin fails to remove 3′-α, β-unsaturated aldehyde. The 5′-FITC-labeled 3′-α, β-unsaturated aldehyde (3′-UA) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-UA oligonucleotide does not decrease with increasing aprataxin concentration (lanes 2–4). The 3′-OH oligonucleotides were generated in the presence of APE1 (lane 5). The faint smear corresponding to the 3′-UA oligonucleotide in lanes 1–5 is an artifact generated under the electrophoresis conditions employed. ( D ) Aprataxin fails to remove 3′-phosphotyrosine end. The 5′-FITC-labeled 3′-phosphotyrosine (3′-Y) oligonucleotide was incubated in the absence (lane 1) or presence of aprataxin at different concentrations (25, 50 and 100 nM, lanes 2–4). The amount of the 3′-Y oligonucleotide do not decrease with increasing aprataxin concentration (lanes 2–4). 3′-PO 3 oligonucleotides were generated in the presence of tyrosyl-DNA phosphodiesterase 1 (TDP1) (lane 5).

Techniques Used: Labeling, Incubation, Positive Control, Polyacrylamide Gel Electrophoresis, Fluorescence, Concentration Assay, Generated, Electrophoresis

Removal of adenylate residues from 5′-ends by aprataxin. ( A ) Aprataxin removes AMP from 5′-ends of nicked ds DNA. The 45-mer ds DNA harboring a nick with 5′-AMP ends was incubated with the indicated amounts of aprataxin for 1 h. A band of the same size as that corresponding to the 5′-phosphate (5′ − PO 3 ⁁ −) oligonucleotide appears in lanes with aprataxin. PNKP was used as the negative control. ( B ) Mutant forms of aprataxin fail to remove 5′-AMP. The 45-mer ds DNA harboring a nick with 5′-AMP ends was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 2–4), SA (lanes 5–7), FHA (lanes 8–10), P206L (lanes 11–13) and V263G (lanes 14–16) at different incubation times (0, 30 and 60 min). SA showed a lower 5′-AMP hydrolysis activity (lanes 5–7) than LA. Neither FHA, P206L nor V263G removed 5′-AMP (lanes 8–16). ( C ) Production rates in each reaction were quantified. Error bars indicate standard errors for more than three independent experiments.
Figure Legend Snippet: Removal of adenylate residues from 5′-ends by aprataxin. ( A ) Aprataxin removes AMP from 5′-ends of nicked ds DNA. The 45-mer ds DNA harboring a nick with 5′-AMP ends was incubated with the indicated amounts of aprataxin for 1 h. A band of the same size as that corresponding to the 5′-phosphate (5′ − PO 3 ⁁ −) oligonucleotide appears in lanes with aprataxin. PNKP was used as the negative control. ( B ) Mutant forms of aprataxin fail to remove 5′-AMP. The 45-mer ds DNA harboring a nick with 5′-AMP ends was incubated in the presence of 50 nM recombinant GST fusion proteins containing LA (lanes 2–4), SA (lanes 5–7), FHA (lanes 8–10), P206L (lanes 11–13) and V263G (lanes 14–16) at different incubation times (0, 30 and 60 min). SA showed a lower 5′-AMP hydrolysis activity (lanes 5–7) than LA. Neither FHA, P206L nor V263G removed 5′-AMP (lanes 8–16). ( C ) Production rates in each reaction were quantified. Error bars indicate standard errors for more than three independent experiments.

Techniques Used: Incubation, Negative Control, Mutagenesis, Recombinant, Activity Assay

Aprataxin repairs SSBs with damaged 3′-ends. ( A ) DNA repair assay employing gapped dsDNA with 3′-phosphate ends as substrate. The 45-mer ds DNA substrate harboring a 1-nt gap with 3′-phosphate (3′ − PO 3 ⁁ −) ends was incubated in the absence (lane 3) or presence of each of the indicated recombinant human proteins for 90 min (lanes 4–9). The 45-mer ds DNA substrate, harboring a 1-nt gap with 3′-hydroxyl (3′-OH) ends, was incubated in the absence (lane 1) or presence of each indicated recombinant human protein (lane 2). Complete repair is indicated by the generation of the 5′-FITC-labeled 45-mer oligonucleotide. The amount of 5′-FITC-labeled 45-mer increased with the concentration of aprataxin (lanes 6–8). PNKP was used as the positive control (lane 9). ( B ) DNA repair assay employing gapped dsDNA with 3′-phosphoglycolate ends as substrate. The 45-mer duplex substrate harboring a 1-nt gap with 3′-phosphoglycolate (3′-PG) ends was incubated in the absence (lane 3) or presence of each of the indicated recombinant human proteins for 90 min (lanes 4–9). The 45-mer duplex substrate harboring a 1-nt gap with 3′-OH ends was incubated in the absence (lane 1) or presence of each indicated recombinant human protein (lane 2). The amount of the FITC-labeled 45-mer oligonucleotide increases with aprataxin concentration (lanes 6–8). APE1 was used as the positive control (lane 9). The structures of the substrates employed in these experiments are shown on the right side of each panel.
Figure Legend Snippet: Aprataxin repairs SSBs with damaged 3′-ends. ( A ) DNA repair assay employing gapped dsDNA with 3′-phosphate ends as substrate. The 45-mer ds DNA substrate harboring a 1-nt gap with 3′-phosphate (3′ − PO 3 ⁁ −) ends was incubated in the absence (lane 3) or presence of each of the indicated recombinant human proteins for 90 min (lanes 4–9). The 45-mer ds DNA substrate, harboring a 1-nt gap with 3′-hydroxyl (3′-OH) ends, was incubated in the absence (lane 1) or presence of each indicated recombinant human protein (lane 2). Complete repair is indicated by the generation of the 5′-FITC-labeled 45-mer oligonucleotide. The amount of 5′-FITC-labeled 45-mer increased with the concentration of aprataxin (lanes 6–8). PNKP was used as the positive control (lane 9). ( B ) DNA repair assay employing gapped dsDNA with 3′-phosphoglycolate ends as substrate. The 45-mer duplex substrate harboring a 1-nt gap with 3′-phosphoglycolate (3′-PG) ends was incubated in the absence (lane 3) or presence of each of the indicated recombinant human proteins for 90 min (lanes 4–9). The 45-mer duplex substrate harboring a 1-nt gap with 3′-OH ends was incubated in the absence (lane 1) or presence of each indicated recombinant human protein (lane 2). The amount of the FITC-labeled 45-mer oligonucleotide increases with aprataxin concentration (lanes 6–8). APE1 was used as the positive control (lane 9). The structures of the substrates employed in these experiments are shown on the right side of each panel.

Techniques Used: Incubation, Recombinant, Labeling, Concentration Assay, Positive Control

Recombinant aprataxin fails to efficiently hydrolase GpppBODIPY or ApppBODIPY. GpppBODIPY ( A ) or ApppBODIPY ( B ) was incubated with recombinant His-tagged long-form aprataxin obtained from the baculovirus expression system (His-LA, lanes 4–6), recombinant GST fusion proteins containing LA (lanes 7 and 8), SA (lanes 9 and 10) and FHA (lanes 11 and 12). None of them showed lysine hydrolase activity (lanes 4–12). Fhit at 10 and 100 mU as the positive control showed GMP-lysine hydrolase activity (lanes 2 and 3).
Figure Legend Snippet: Recombinant aprataxin fails to efficiently hydrolase GpppBODIPY or ApppBODIPY. GpppBODIPY ( A ) or ApppBODIPY ( B ) was incubated with recombinant His-tagged long-form aprataxin obtained from the baculovirus expression system (His-LA, lanes 4–6), recombinant GST fusion proteins containing LA (lanes 7 and 8), SA (lanes 9 and 10) and FHA (lanes 11 and 12). None of them showed lysine hydrolase activity (lanes 4–12). Fhit at 10 and 100 mU as the positive control showed GMP-lysine hydrolase activity (lanes 2 and 3).

Techniques Used: Recombinant, Incubation, Expressing, Activity Assay, Positive Control

9) Product Images from "Novel structural arrangement of nematode cystathionine ?-synthases: characterization of Caenorhabditis elegans CBS-1"

Article Title: Novel structural arrangement of nematode cystathionine ?-synthases: characterization of Caenorhabditis elegans CBS-1

Journal: Biochemical Journal

doi: 10.1042/BJ20111478

Determination of the quaternary structure of CBS-1 ( A ) SEC. The bold solid curve represents the elution profile of purified recombinant CBS-1, which has a retention time of 5.776 min and an estimated molecular mass of 168 kDa. The thin solid curve represents human 45CBS, which has a retention time of 5.846 min and an estimated molecular mass of 148 kDa. The dashed curve represents BSA with a retention time of 6.028. The grey (dotted) curve represents molecular standards eluted at the following retention times: ferritin (440 kDa), 5.325 min; aldolase (158 kDa), 5.827 min; and conalbumin (70 kDa), 6.426 min. AU, absorbance unit. ( B ) Cross-linking. Purified CBS-1 and human 45CBS were cross-linked with BS 3 in appropriate molar ratios of protein/modifier, as indicated in the Figure, and subjected to SDS/PAGE. In contrast with human 45CBS, which forms dimers, the mobility of CBS-1 does not change after cross-linking. ( C ) BN-PAGE. CBS-1, with a molecular mass of 78 kDa (four different amounts of loaded protein), migrates between molecular mass markers of 66 kDa and 140 kDa. The molecular protein mass markers include thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), lactate dehydrogenase (140 kDa), BSA (66 kDa) and aldolase (158 kDa). ( D ) Native PAGE. CBS-1, with a molecular mass of 78 kDa, migrates between molecular mass markers of 66 kDa and 132 kDa, similar to a ~90 kDa dimer of human 45CBS. In ( B – D ) the molecular mass is given in kDa on the left-hand side. M, marker. ( E ) Schematic diagram of the hypothetical quaternary structure of CBS-1 and comparison of its structure with that of human 45CBS.
Figure Legend Snippet: Determination of the quaternary structure of CBS-1 ( A ) SEC. The bold solid curve represents the elution profile of purified recombinant CBS-1, which has a retention time of 5.776 min and an estimated molecular mass of 168 kDa. The thin solid curve represents human 45CBS, which has a retention time of 5.846 min and an estimated molecular mass of 148 kDa. The dashed curve represents BSA with a retention time of 6.028. The grey (dotted) curve represents molecular standards eluted at the following retention times: ferritin (440 kDa), 5.325 min; aldolase (158 kDa), 5.827 min; and conalbumin (70 kDa), 6.426 min. AU, absorbance unit. ( B ) Cross-linking. Purified CBS-1 and human 45CBS were cross-linked with BS 3 in appropriate molar ratios of protein/modifier, as indicated in the Figure, and subjected to SDS/PAGE. In contrast with human 45CBS, which forms dimers, the mobility of CBS-1 does not change after cross-linking. ( C ) BN-PAGE. CBS-1, with a molecular mass of 78 kDa (four different amounts of loaded protein), migrates between molecular mass markers of 66 kDa and 140 kDa. The molecular protein mass markers include thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), lactate dehydrogenase (140 kDa), BSA (66 kDa) and aldolase (158 kDa). ( D ) Native PAGE. CBS-1, with a molecular mass of 78 kDa, migrates between molecular mass markers of 66 kDa and 132 kDa, similar to a ~90 kDa dimer of human 45CBS. In ( B – D ) the molecular mass is given in kDa on the left-hand side. M, marker. ( E ) Schematic diagram of the hypothetical quaternary structure of CBS-1 and comparison of its structure with that of human 45CBS.

Techniques Used: Size-exclusion Chromatography, Purification, Recombinant, SDS Page, Polyacrylamide Gel Electrophoresis, Clear Native PAGE, Marker

Expression pattern of cbs-1 in worms The images show transgenic worms that carry the translational fusion vector cbs-1–GFP. ( A ) L4 larval stage showing the distribution of the GFP signal in the pharyngeal muscles, intestine, hypodermis and muscle cells. The middle part of the adult body (inset) shows the GFP signal in the body wall muscles and hypodermis. ( B ) Head of the worm showing GFP signal in pharyngeal muscles and a head muscle cell with its muscle arm; the GFP signal is distributed in the pharyngeal muscles pm3, pm4, pm6, pm7 and pm8. Some worms also exhibited a GFP signal in pm5 (inset).
Figure Legend Snippet: Expression pattern of cbs-1 in worms The images show transgenic worms that carry the translational fusion vector cbs-1–GFP. ( A ) L4 larval stage showing the distribution of the GFP signal in the pharyngeal muscles, intestine, hypodermis and muscle cells. The middle part of the adult body (inset) shows the GFP signal in the body wall muscles and hypodermis. ( B ) Head of the worm showing GFP signal in pharyngeal muscles and a head muscle cell with its muscle arm; the GFP signal is distributed in the pharyngeal muscles pm3, pm4, pm6, pm7 and pm8. Some worms also exhibited a GFP signal in pm5 (inset).

Techniques Used: Expressing, Transgenic Assay, Plasmid Preparation

Computationally modelled CBS-1 domains The images show the fold and PLP-binding site of human 45CBS, C-terminal module of CBS-1 (CBS-1_C) and N-terminal module of CBS-1 (CBS-1_N). The crystal structure of the human enzyme shows hydrogen bonds between amino acid residues and PLP, as indicated by broken green lines. Computational modelling of the individual CBS-1 modules revealed that both modules belong to the family of fold-type II PLP-dependent proteins and that the N-terminal module cannot bind PLP due to the absence of lysine and glycine residues in the consensus PLP-binding pocket.
Figure Legend Snippet: Computationally modelled CBS-1 domains The images show the fold and PLP-binding site of human 45CBS, C-terminal module of CBS-1 (CBS-1_C) and N-terminal module of CBS-1 (CBS-1_N). The crystal structure of the human enzyme shows hydrogen bonds between amino acid residues and PLP, as indicated by broken green lines. Computational modelling of the individual CBS-1 modules revealed that both modules belong to the family of fold-type II PLP-dependent proteins and that the N-terminal module cannot bind PLP due to the absence of lysine and glycine residues in the consensus PLP-binding pocket.

Techniques Used: Plasmid Purification, Binding Assay

Structural and enzymatic analysis of recombinant CBS-1 variants ( A ) Illustration of the CBS-1 variants expressed in E. coli . ( B ) Detection of CBS-1 variants in E. coli lysate after expression using soluble and insoluble fractions separated by centrifugation. ( C ) BN-PAGE of purified recombinant CBS-1 variants shows the monomeric status of the WT, K421A and E62K proteins. The N-terminal domain exhibits monomeric and oligomeric forms. Molecular mass markers are shown in kDa on the left-hand side. ( D ) CBS activity of the purified CBS-1 variants; K421A and CBS-1b have no CBS activity. Results are means±S.D. ( E ) CD spectra at far-UV show a helical secondary structure for all of the purified CBS-1 variants. ( F ) The UV–visible spectrum of purified recombinant CBS-1 variants of equal concentration shows peaks in the 280 and 412 nm region, indicating light absorption by aromatic amino acids and PLP respectively. Soret peaks typical for haem are not present. ( G ) Emission spectrum after excitation of the tryptophan residues at 298 nm of purified recombinant CBS-1 variants of equal concentration.
Figure Legend Snippet: Structural and enzymatic analysis of recombinant CBS-1 variants ( A ) Illustration of the CBS-1 variants expressed in E. coli . ( B ) Detection of CBS-1 variants in E. coli lysate after expression using soluble and insoluble fractions separated by centrifugation. ( C ) BN-PAGE of purified recombinant CBS-1 variants shows the monomeric status of the WT, K421A and E62K proteins. The N-terminal domain exhibits monomeric and oligomeric forms. Molecular mass markers are shown in kDa on the left-hand side. ( D ) CBS activity of the purified CBS-1 variants; K421A and CBS-1b have no CBS activity. Results are means±S.D. ( E ) CD spectra at far-UV show a helical secondary structure for all of the purified CBS-1 variants. ( F ) The UV–visible spectrum of purified recombinant CBS-1 variants of equal concentration shows peaks in the 280 and 412 nm region, indicating light absorption by aromatic amino acids and PLP respectively. Soret peaks typical for haem are not present. ( G ) Emission spectrum after excitation of the tryptophan residues at 298 nm of purified recombinant CBS-1 variants of equal concentration.

Techniques Used: Recombinant, Expressing, Centrifugation, Polyacrylamide Gel Electrophoresis, Purification, Activity Assay, Concentration Assay, Plasmid Purification

Metabolite levels in crude extracts of CBS-1-knockdown animals The concentration of metabolites (in nanomoles per mg of protein) from RNAi and control experiments respectively. Homocysteine and cystathionine concentrations in CBS-1-deficient worms are significantly higher (10.1 and 107.1 nmol/mg of protein respectively) than in control worms (1.0 and 65.6 nmol/mg of protein respectively). Results are means±S.D. from three independent experiments. * P
Figure Legend Snippet: Metabolite levels in crude extracts of CBS-1-knockdown animals The concentration of metabolites (in nanomoles per mg of protein) from RNAi and control experiments respectively. Homocysteine and cystathionine concentrations in CBS-1-deficient worms are significantly higher (10.1 and 107.1 nmol/mg of protein respectively) than in control worms (1.0 and 65.6 nmol/mg of protein respectively). Results are means±S.D. from three independent experiments. * P

Techniques Used: Concentration Assay

Organization of the cbs-1 gene and domain architecture of CBS in various organisms ( A ) Gene organization. The top diagram shows the organization of gene ZC373.1 ( cbs-1 ) encoding CBS-1. The numbers indicate the codon position encoding the appropriate amino acid. Exons are indicated as black boxes, and the 5′- and 3′-UTR sequences are indicated as grey boxes. The middle diagram shows the novel splice ZC373.1 variant cbs-1b . The bottom diagram shows the translational fusion construct used in the GFP reporter assay. The length of the entire promoter used in the cbs-1–GFP construct is indicated by the number of base pairs of the 5′-upstream sequence. ( B ) Domain organization of various CBSs. The published structures of different CBSs were analysed for the presence of a haem-binding site (marked Heme), conserved catalytic regions with a PLP-binding site (marked PLP) and Bateman domain composed of two CBS domains (CBS1 and CBS2). The primary structures are aligned by the PLP-binding lysine residue; the numbers indicate the first and the last amino acid residues of conserved domains in the protein sequence. The aligned proteins are HsCBS ( Homo sapiens CBS, UniProt entry P35520), Hs45CBS (truncated human CBS with 1–413 residues), RnCBS ( Rattus norvegicus CBS, UniProt entry P32232), DmCBS ( D. melanogaster CBS, UniProt entry Q9VRD9), TcCBS ( T. cruzi CBS, UniProt entry Q9BH24), ScCBS ( S. cerevisiae CBS, UniProt entry P32582) and CBS-1 ( C. elegans CBS, UniProt entry Q23264). ( C ) Amino acid alignment of haem- and PLP-binding sites in various CBSs with separated N- and C-terminal conserved regions of CBS-1. The N-terminal region of CBS-1 does not contain the lysine residue that binds PLP. The cysteine and histidine residues that bind haem are indicated by asterisks, and the PLP-binding lysine residues are indicated by #.
Figure Legend Snippet: Organization of the cbs-1 gene and domain architecture of CBS in various organisms ( A ) Gene organization. The top diagram shows the organization of gene ZC373.1 ( cbs-1 ) encoding CBS-1. The numbers indicate the codon position encoding the appropriate amino acid. Exons are indicated as black boxes, and the 5′- and 3′-UTR sequences are indicated as grey boxes. The middle diagram shows the novel splice ZC373.1 variant cbs-1b . The bottom diagram shows the translational fusion construct used in the GFP reporter assay. The length of the entire promoter used in the cbs-1–GFP construct is indicated by the number of base pairs of the 5′-upstream sequence. ( B ) Domain organization of various CBSs. The published structures of different CBSs were analysed for the presence of a haem-binding site (marked Heme), conserved catalytic regions with a PLP-binding site (marked PLP) and Bateman domain composed of two CBS domains (CBS1 and CBS2). The primary structures are aligned by the PLP-binding lysine residue; the numbers indicate the first and the last amino acid residues of conserved domains in the protein sequence. The aligned proteins are HsCBS ( Homo sapiens CBS, UniProt entry P35520), Hs45CBS (truncated human CBS with 1–413 residues), RnCBS ( Rattus norvegicus CBS, UniProt entry P32232), DmCBS ( D. melanogaster CBS, UniProt entry Q9VRD9), TcCBS ( T. cruzi CBS, UniProt entry Q9BH24), ScCBS ( S. cerevisiae CBS, UniProt entry P32582) and CBS-1 ( C. elegans CBS, UniProt entry Q23264). ( C ) Amino acid alignment of haem- and PLP-binding sites in various CBSs with separated N- and C-terminal conserved regions of CBS-1. The N-terminal region of CBS-1 does not contain the lysine residue that binds PLP. The cysteine and histidine residues that bind haem are indicated by asterisks, and the PLP-binding lysine residues are indicated by #.

Techniques Used: Variant Assay, Construct, Reporter Assay, Sequencing, Binding Assay, Plasmid Purification

10) Product Images from "The exocyst component Sec5 is present on endocytic vesicles in the oocyte of Drosophila melanogaster"

Article Title: The exocyst component Sec5 is present on endocytic vesicles in the oocyte of Drosophila melanogaster

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200411053

Sec5 localization and function in other cell types. (A) Electron micrographs of coated pits and vesicles labeled with anti-Sec5 in cryosections of follicular epithelial cells from wild-type ovaries and S2 cultured cells. Bars, 100 nm. (B) Growth at the indicated temperatures of wild-type yeast (BY4741; wt), or the same strain with SEC5 truncated at residue 343 by insertion of a triple HA tag ( sec5- Δ 343-3xHA ). (C) Confocal micrograph of live yeast in which the single copy of the SEC5 gene is truncated at residue 343 by insertion of a GFP tag. (D) Confocal micrographs of sec5- Δ 343-3xHA strain expressing Snc1p-GFP and imaged after 4 h at 37°C. (E) Confocal micrographs of live yeast expressing a truncated form of the a -factor receptor Ste3p(Δ365) tagged in the genome with GFP. Cells were imaged after incubation for 2 h at 37°C (0 min) and then 45 min after addition of a -factor, and 30 min after a -factor was removed by washing. The truncated a -factor receptor is competent for ligand-stimulated endocytic recycling and localizes to the plasma membrane in both wild-type and sec5- Δ 343-3xHA mutant cells. 45 min after a -factor addition, the receptor is internalized and localizes to bright dots in the cytoplasm and to the plasma membrane at the emerging schmoos in wild-type cells. In sec5- Δ 343-3xHA cells, the receptor is internalized but shows a diffuse distribution. 30 min after a -factor was washed away, wild-type cells restore the plasma membrane localization of the receptor, whereas in the mutant cells the receptor still localizes internally.
Figure Legend Snippet: Sec5 localization and function in other cell types. (A) Electron micrographs of coated pits and vesicles labeled with anti-Sec5 in cryosections of follicular epithelial cells from wild-type ovaries and S2 cultured cells. Bars, 100 nm. (B) Growth at the indicated temperatures of wild-type yeast (BY4741; wt), or the same strain with SEC5 truncated at residue 343 by insertion of a triple HA tag ( sec5- Δ 343-3xHA ). (C) Confocal micrograph of live yeast in which the single copy of the SEC5 gene is truncated at residue 343 by insertion of a GFP tag. (D) Confocal micrographs of sec5- Δ 343-3xHA strain expressing Snc1p-GFP and imaged after 4 h at 37°C. (E) Confocal micrographs of live yeast expressing a truncated form of the a -factor receptor Ste3p(Δ365) tagged in the genome with GFP. Cells were imaged after incubation for 2 h at 37°C (0 min) and then 45 min after addition of a -factor, and 30 min after a -factor was removed by washing. The truncated a -factor receptor is competent for ligand-stimulated endocytic recycling and localizes to the plasma membrane in both wild-type and sec5- Δ 343-3xHA mutant cells. 45 min after a -factor addition, the receptor is internalized and localizes to bright dots in the cytoplasm and to the plasma membrane at the emerging schmoos in wild-type cells. In sec5- Δ 343-3xHA cells, the receptor is internalized but shows a diffuse distribution. 30 min after a -factor was washed away, wild-type cells restore the plasma membrane localization of the receptor, whereas in the mutant cells the receptor still localizes internally.

Techniques Used: Labeling, Cell Culture, Expressing, Incubation, Mutagenesis

Schematic illustration of the recycling route of Yolkless. Yolkless binds yolk and both are endocytosed in clathrin-coated vesicles. Yolk condenses in early endosomes and is excluded from tubules that are thought to recycle Yolkless (dotted line). The condensing yolk (dashed line) remains in the late endosomes, which fuse together to form mature granules. Membrane fusion events that could involve Sec5 are between endocytosed vesicles (1) and between recycling tubules and the plasma membrane (2). Model based on previous microscopy and endocytosis experiments ( Roth and Porter, 1964 ; Giorgi and Jacob, 1977 ; Tsuruhara et al., 1990 ).
Figure Legend Snippet: Schematic illustration of the recycling route of Yolkless. Yolkless binds yolk and both are endocytosed in clathrin-coated vesicles. Yolk condenses in early endosomes and is excluded from tubules that are thought to recycle Yolkless (dotted line). The condensing yolk (dashed line) remains in the late endosomes, which fuse together to form mature granules. Membrane fusion events that could involve Sec5 are between endocytosed vesicles (1) and between recycling tubules and the plasma membrane (2). Model based on previous microscopy and endocytosis experiments ( Roth and Porter, 1964 ; Giorgi and Jacob, 1977 ; Tsuruhara et al., 1990 ).

Techniques Used: Microscopy

Sec5 localizes to clathrin-coated pits and vesicles underneath the plasma membrane of Drosophila oocytes. (A and B) Electron micrographs of cryosections of a wild-type oocyte or of an oocyte from a sec5 E13 germline labeled with anti-Sec5 followed by protein A conjugated to 10-nm gold particles. The gold particles decorate structures with electron-dense coats, and such labeling is absent from the section from sec5 E13 . Bars, 200 nm. (C) Electron micrographs as in A of coated pits and vesicles labeled for Sec5, clathrin, and α-adaptin (AP2) as indicated.
Figure Legend Snippet: Sec5 localizes to clathrin-coated pits and vesicles underneath the plasma membrane of Drosophila oocytes. (A and B) Electron micrographs of cryosections of a wild-type oocyte or of an oocyte from a sec5 E13 germline labeled with anti-Sec5 followed by protein A conjugated to 10-nm gold particles. The gold particles decorate structures with electron-dense coats, and such labeling is absent from the section from sec5 E13 . Bars, 200 nm. (C) Electron micrographs as in A of coated pits and vesicles labeled for Sec5, clathrin, and α-adaptin (AP2) as indicated.

Techniques Used: Labeling

Analysis of membrane-trafficking processes in sec5 E13 oocytes. (A) Confocal microscopic sections of egg chambers from wild-type or sec5 E13 germlines labeled with antibodies to the plasma membrane SNARE syntaxin-1A or the adhesion molecule E-cadherin. (B) Confocal micrographs of unfixed ovaries incubated with FM4-64 for 30 min. Without back extraction, the bulk of the dye is in the plasma membrane, but after back extraction at 4°C only dye taken up into the endosomal system remains. Uptake into the oocyte from the sec5 E13 germline clone is significantly reduced, whereas the surrounding, somatically derived follicle cells internalize dye at wild-type levels.
Figure Legend Snippet: Analysis of membrane-trafficking processes in sec5 E13 oocytes. (A) Confocal microscopic sections of egg chambers from wild-type or sec5 E13 germlines labeled with antibodies to the plasma membrane SNARE syntaxin-1A or the adhesion molecule E-cadherin. (B) Confocal micrographs of unfixed ovaries incubated with FM4-64 for 30 min. Without back extraction, the bulk of the dye is in the plasma membrane, but after back extraction at 4°C only dye taken up into the endosomal system remains. Uptake into the oocyte from the sec5 E13 germline clone is significantly reduced, whereas the surrounding, somatically derived follicle cells internalize dye at wild-type levels.

Techniques Used: Labeling, Incubation, Derivative Assay

sec5 E13 oocytes have a defect in trafficking of the Yolkless receptor. (A) Eggs derived from a sec5 E13 germline have a yolkless phenotype, and are often collapsed due to the lack of yolk granules. The severity of the yolkless phenotype was indistinguishable between flies raised at 18, 25, or 30°C. (B) Low magnification electron micrographs of oocytes from wild-type or sec5 E13 germlines. The vitelline bodies of the forming vitelline membrane (vb) lie between the oocyte and the follicle cells (fc). The small pale inclusions in the cytoplasm of both oocytes are lipid droplets. Bars, 5 μm. (C–E) Electron micrographs of cryosections of stage 10 oocytes labeled with an anti-Yolkless antibody followed by protein A gold (10 nm). The sec5 E13 oocyte shows reduced Yolkless labeling on and below the plasma membrane and a reduction in endocytic structures (C). There is a two- to threefold increase in labeling in the Golgi (go; yolk granule, gr) (D) and a striking appearance of Yolkless in the rim of later endocytic compartments including large uncondensed yolk granules (E). Bars, 200 nm.
Figure Legend Snippet: sec5 E13 oocytes have a defect in trafficking of the Yolkless receptor. (A) Eggs derived from a sec5 E13 germline have a yolkless phenotype, and are often collapsed due to the lack of yolk granules. The severity of the yolkless phenotype was indistinguishable between flies raised at 18, 25, or 30°C. (B) Low magnification electron micrographs of oocytes from wild-type or sec5 E13 germlines. The vitelline bodies of the forming vitelline membrane (vb) lie between the oocyte and the follicle cells (fc). The small pale inclusions in the cytoplasm of both oocytes are lipid droplets. Bars, 5 μm. (C–E) Electron micrographs of cryosections of stage 10 oocytes labeled with an anti-Yolkless antibody followed by protein A gold (10 nm). The sec5 E13 oocyte shows reduced Yolkless labeling on and below the plasma membrane and a reduction in endocytic structures (C). There is a two- to threefold increase in labeling in the Golgi (go; yolk granule, gr) (D) and a striking appearance of Yolkless in the rim of later endocytic compartments including large uncondensed yolk granules (E). Bars, 200 nm.

Techniques Used: Derivative Assay, Labeling

Sec5 plasma membrane labeling is reduced in yl 15 mutant oocytes. (A) Confocal micrographs of oocytes from wild type (WT; Canton-S) or homozygous yl 15 females labeled for both Sec5 and the vitellogenin receptor Yolkless. In the yl 15 mutant, the receptor is still present but much accumulates internally, possibly in the ER, as seen for other yolkless alleles ( Schonbaum et al., 2000 ).
Figure Legend Snippet: Sec5 plasma membrane labeling is reduced in yl 15 mutant oocytes. (A) Confocal micrographs of oocytes from wild type (WT; Canton-S) or homozygous yl 15 females labeled for both Sec5 and the vitellogenin receptor Yolkless. In the yl 15 mutant, the receptor is still present but much accumulates internally, possibly in the ER, as seen for other yolkless alleles ( Schonbaum et al., 2000 ).

Techniques Used: Labeling, Mutagenesis

Sec5 in ovaries is assembled into the exocyst complex. (A) Protein blots with the indicated antibodies of immunoprecipitates from ovary extracts prepared from wild-type females. The precipitates were probed with sera against Sec5 or an irrelevant protein, Cog8 (Dor1), a component of the Golgi-localized COG complex (control). (B). Protein blots of fractions from a glycerol gradient separation of detergent-solubilized ovary extracts from wild-type females, probed with antisera to the indicated proteins. The four exocyst components examined peak toward the bottom of the gradient (fraction 1), with Exo84 being also present in less rapidly sedimenting fractions, which is consistent with a previous paper ( Moskalenko et al., 2003 ). The small GTPase Rho1 (21.7 kD), Discs large (Dlg; 102.5 kD), and Shibire, the Drosophila homologue of the GTPase dynamin (Dyn; 97.8) sediment less rapidly.
Figure Legend Snippet: Sec5 in ovaries is assembled into the exocyst complex. (A) Protein blots with the indicated antibodies of immunoprecipitates from ovary extracts prepared from wild-type females. The precipitates were probed with sera against Sec5 or an irrelevant protein, Cog8 (Dor1), a component of the Golgi-localized COG complex (control). (B). Protein blots of fractions from a glycerol gradient separation of detergent-solubilized ovary extracts from wild-type females, probed with antisera to the indicated proteins. The four exocyst components examined peak toward the bottom of the gradient (fraction 1), with Exo84 being also present in less rapidly sedimenting fractions, which is consistent with a previous paper ( Moskalenko et al., 2003 ). The small GTPase Rho1 (21.7 kD), Discs large (Dlg; 102.5 kD), and Shibire, the Drosophila homologue of the GTPase dynamin (Dyn; 97.8) sediment less rapidly.

Techniques Used:

Characterization of an anti-Sec5 antiserum. (A) Confocal micrographs of wild-type ovaries labeled with the rabbit anti-Sec5 antibody. Sec5 is enriched in the oocyte (o) and from around stage 7 (st. 7) becomes localized to the plasma membrane and remains plasma membrane localized throughout vitellogenesis from stages 8–10. Bars, 20 μm. (B) Anti-Sec5 protein blots of total proteins prepared from wild-type (Canton-S) and sec5 E13 eggs (left), or of an anti-Sec5 immunoprecipitation (IP; right) from wild-type ovary extract. The antibody recognizes two prominent bands, one of which is specific for native Sec5, whose predicted molecular mass is 100.7 kD. (C) As A, except anti-Sec5 was applied to stage 10 oocytes from wild-type or sec5 E13 germline clones. Anti-Sec5 staining along the plasma membrane of the wild-type oocyte is indicated by arrows and is absent in the sec5 E13 germline clone. The somatically derived border cells are positive for Sec5 in both wild type and mutant.
Figure Legend Snippet: Characterization of an anti-Sec5 antiserum. (A) Confocal micrographs of wild-type ovaries labeled with the rabbit anti-Sec5 antibody. Sec5 is enriched in the oocyte (o) and from around stage 7 (st. 7) becomes localized to the plasma membrane and remains plasma membrane localized throughout vitellogenesis from stages 8–10. Bars, 20 μm. (B) Anti-Sec5 protein blots of total proteins prepared from wild-type (Canton-S) and sec5 E13 eggs (left), or of an anti-Sec5 immunoprecipitation (IP; right) from wild-type ovary extract. The antibody recognizes two prominent bands, one of which is specific for native Sec5, whose predicted molecular mass is 100.7 kD. (C) As A, except anti-Sec5 was applied to stage 10 oocytes from wild-type or sec5 E13 germline clones. Anti-Sec5 staining along the plasma membrane of the wild-type oocyte is indicated by arrows and is absent in the sec5 E13 germline clone. The somatically derived border cells are positive for Sec5 in both wild type and mutant.

Techniques Used: Labeling, Immunoprecipitation, Clone Assay, Staining, Derivative Assay, Mutagenesis

Yolkless accumulates in endocytic compartments in sec5 E13 oocytes. (A) Confocal micrographs of 500-nm cryosections of egg chambers from wild-type or sec5 E13 germlines labeled with antibodies to Yolkless and a fluorescent secondary antibody. (B) Confocal micrographs of cryosections as in A, double labeled with antibodies to Yolkless and either yolk or the Cog3 subunit of the Drosophila COG complex (Golgi), which recognizes the Drosophila Golgi (Fig. S1 B). A region near the surface of the oocyte (ooc.) is shown along with adjacent follicle cells (foll.).
Figure Legend Snippet: Yolkless accumulates in endocytic compartments in sec5 E13 oocytes. (A) Confocal micrographs of 500-nm cryosections of egg chambers from wild-type or sec5 E13 germlines labeled with antibodies to Yolkless and a fluorescent secondary antibody. (B) Confocal micrographs of cryosections as in A, double labeled with antibodies to Yolkless and either yolk or the Cog3 subunit of the Drosophila COG complex (Golgi), which recognizes the Drosophila Golgi (Fig. S1 B). A region near the surface of the oocyte (ooc.) is shown along with adjacent follicle cells (foll.).

Techniques Used: Labeling

11) Product Images from "Structure function analysis of SH2D2A isoforms expressed in T cells reveals a crucial role for the proline rich region encoded by SH2D2A exon 7"

Article Title: Structure function analysis of SH2D2A isoforms expressed in T cells reveals a crucial role for the proline rich region encoded by SH2D2A exon 7

Journal: BMC Immunology

doi: 10.1186/1471-2172-7-15

Schematic presentation of TSAd functional domains and predicted sites . A Schematic presentation of functional regions of TSAd . B Predicted sites identified in high stringency Scansite search of SH2D2A-1 and SH2D2A-5 peptide sequences: Core amino acids are indicated. pY: tyrosine kinase phosphorylation site. SH2 and SH3: SH2 and SH3 binding sites respectively. ErkD: binding site for ErkD domain.
Figure Legend Snippet: Schematic presentation of TSAd functional domains and predicted sites . A Schematic presentation of functional regions of TSAd . B Predicted sites identified in high stringency Scansite search of SH2D2A-1 and SH2D2A-5 peptide sequences: Core amino acids are indicated. pY: tyrosine kinase phosphorylation site. SH2 and SH3: SH2 and SH3 binding sites respectively. ErkD: binding site for ErkD domain.

Techniques Used: Functional Assay, Binding Assay

SH2D2A exon 7 encodes ligands for Lck-SH2 and SH3 domains . A. TSAd interacts with Lck: Primary CD4+ T cells were stimulated with anti-CD3/CD28 beads for one day. TSAd was precipitated with anti-TSAd Abs or irrelevant serum (NRS) and protein A/G sepharose beads from precleared lysates. Precipitates were separated by SDS-PAGE and immunoblotted with anti-Lck and anti-TSAd Abs as indicated. B. TSAd variants interact with Lck in Jurkat T cells: Jurkat T cells were transiently transfected with pEF-HA or one of the pEF-HA-SH2D2A-1-5cDNAs. Immunoprecipitation was performed using anti-TSAd Abs and protein G magnetic beads. Precipitates were separated by SDS-PAGE and immunoblotted with anti-Lck and anti-HA as indicated. C. The SH2 domain and aa239–334 of TSAd is important for interaction with the Lck SH2 domain: 293T cells were transiently transfected with one of the pEF-HA-SH2D2A-1-5 cDNAs alone (-) or together (+) with pEF-Lck. Cell lysates were subjected to pull down experiment with GST-Lck-SH2 Sepharose beads. Precipitates were immunoblotted with anti-HA mAbs (upper panel). An anti-HA immunoblot of precleared lysates before GST-Lck-SH2 pull down is included to verify expression of the different HA-tagged TSAd variants (lower panel). D. Aa239–334 contains ligands for the Lck-SH3 domain: 293T cells were transiently transfected with pEF-HA or one of the pEF-HA-SH2D2A-1-5 cDNAs together (+) with pEF-Lck. Only the pEF-HA-SH2D2A-1 cDNA were also co-transfected with pEF-HA (-). Cell lysates were subjected to pull down experiment with GST-Lck-SH3 Sepharose beads, and precipitates (upper panel) and precleared lysates (lower panel) were immunoblotted as in C. E. Identification of TSAd structures interacting with Lck domains : 293T cells were transiently transfected with pEF-HA, the pEF-HA-TSAd-4YF or pEF-HA-TSAd-d239–256 cDNAs together with pEF-Lck. Cell lysates were subjected to pull down experiment with GST-Lck-SH2 or GST-Lck-SH3 Sepharose beads. GST-Lck-SH2 (panel 1) and GST-Lck-SH3 (panel 2) precipitates were immunoblotted with anti-HA mAbs, and the precleared lysates were immunoblotted with anti-HA mAbs (panel 3) or anti-Lck mAbs (panel 4). F. The SH2 domain of TSAd precipitates Lck in 293T cells: 293T cells were transiently transfected with pEF-HA, pEF-Lck, pEF-HA-SH2D2A-1 or pEF-Lck and pEF-HA-SH2D2A-1 cDNAs together. Precleared cell lysates were subjected to pull down experiment with GST-TSAd-SH2 Sepharose beads. Precipitates were immunoblotted with anti-Lck mAbs (upper panel). An anti-Lck immunoblot of precleared lysates before GST-TSAd-SH2 pull down is included to verify expression of Lck (lower panel).
Figure Legend Snippet: SH2D2A exon 7 encodes ligands for Lck-SH2 and SH3 domains . A. TSAd interacts with Lck: Primary CD4+ T cells were stimulated with anti-CD3/CD28 beads for one day. TSAd was precipitated with anti-TSAd Abs or irrelevant serum (NRS) and protein A/G sepharose beads from precleared lysates. Precipitates were separated by SDS-PAGE and immunoblotted with anti-Lck and anti-TSAd Abs as indicated. B. TSAd variants interact with Lck in Jurkat T cells: Jurkat T cells were transiently transfected with pEF-HA or one of the pEF-HA-SH2D2A-1-5cDNAs. Immunoprecipitation was performed using anti-TSAd Abs and protein G magnetic beads. Precipitates were separated by SDS-PAGE and immunoblotted with anti-Lck and anti-HA as indicated. C. The SH2 domain and aa239–334 of TSAd is important for interaction with the Lck SH2 domain: 293T cells were transiently transfected with one of the pEF-HA-SH2D2A-1-5 cDNAs alone (-) or together (+) with pEF-Lck. Cell lysates were subjected to pull down experiment with GST-Lck-SH2 Sepharose beads. Precipitates were immunoblotted with anti-HA mAbs (upper panel). An anti-HA immunoblot of precleared lysates before GST-Lck-SH2 pull down is included to verify expression of the different HA-tagged TSAd variants (lower panel). D. Aa239–334 contains ligands for the Lck-SH3 domain: 293T cells were transiently transfected with pEF-HA or one of the pEF-HA-SH2D2A-1-5 cDNAs together (+) with pEF-Lck. Only the pEF-HA-SH2D2A-1 cDNA were also co-transfected with pEF-HA (-). Cell lysates were subjected to pull down experiment with GST-Lck-SH3 Sepharose beads, and precipitates (upper panel) and precleared lysates (lower panel) were immunoblotted as in C. E. Identification of TSAd structures interacting with Lck domains : 293T cells were transiently transfected with pEF-HA, the pEF-HA-TSAd-4YF or pEF-HA-TSAd-d239–256 cDNAs together with pEF-Lck. Cell lysates were subjected to pull down experiment with GST-Lck-SH2 or GST-Lck-SH3 Sepharose beads. GST-Lck-SH2 (panel 1) and GST-Lck-SH3 (panel 2) precipitates were immunoblotted with anti-HA mAbs, and the precleared lysates were immunoblotted with anti-HA mAbs (panel 3) or anti-Lck mAbs (panel 4). F. The SH2 domain of TSAd precipitates Lck in 293T cells: 293T cells were transiently transfected with pEF-HA, pEF-Lck, pEF-HA-SH2D2A-1 or pEF-Lck and pEF-HA-SH2D2A-1 cDNAs together. Precleared cell lysates were subjected to pull down experiment with GST-TSAd-SH2 Sepharose beads. Precipitates were immunoblotted with anti-Lck mAbs (upper panel). An anti-Lck immunoblot of precleared lysates before GST-TSAd-SH2 pull down is included to verify expression of Lck (lower panel).

Techniques Used: SDS Page, Transfection, Immunoprecipitation, Magnetic Beads, Expressing

An overview of the polypeptides encoded by SH2D2A transcript variants . A. Schematic presentation of putative protein-interacting domains in the SH2D2A isoforms and mutants described in this study: The SH2D2A-1 encodes the full length TSAd, whereas the SH2D2A-2 and -3 variants represent different N-terminal sequences of TSAd. The SH2D2A-4 variant has a 10 aa insertion in the SH2-domain, whereas the fifth variant, SH2D2A-5, lacks aa239–334, containing the proline rich region including the four C-terminal tyrosines (Y = tyrosine). TSAd 4YF has the four C-terminal tyrosines exchanged with phenylalanine (F = phenylalanine). TSAd d239–256 has a deletion of amino acids 239–256 containing the motif PSQLLRPKPPIPAKPQLP. B. Comparison of the N-terminal amino acid sequences of the SH2D2A-1, -2 and -3 variants: The amino acid position is numbered according to full length TSAd (SH2D2A-1). The SH2D2A-2 and -3 variants differ from the SH2D2A-1 in the N-terminal 1–21 aa and 1–28 aa, respectively. C. Comparison of the N-terminus SH2 domain aa sequences of the SH2D2A-1 and -4 variants: The conserved arginine (R) at position 120 is marked. The SH2D2A-4 has an additional 10 aa (ins aa103–112) in the TSAd-SH2 domain. A SH2 consensus (con) sequence obtained from a Blast search, [42] is included for comparison. Conserved residues are marked in bold.
Figure Legend Snippet: An overview of the polypeptides encoded by SH2D2A transcript variants . A. Schematic presentation of putative protein-interacting domains in the SH2D2A isoforms and mutants described in this study: The SH2D2A-1 encodes the full length TSAd, whereas the SH2D2A-2 and -3 variants represent different N-terminal sequences of TSAd. The SH2D2A-4 variant has a 10 aa insertion in the SH2-domain, whereas the fifth variant, SH2D2A-5, lacks aa239–334, containing the proline rich region including the four C-terminal tyrosines (Y = tyrosine). TSAd 4YF has the four C-terminal tyrosines exchanged with phenylalanine (F = phenylalanine). TSAd d239–256 has a deletion of amino acids 239–256 containing the motif PSQLLRPKPPIPAKPQLP. B. Comparison of the N-terminal amino acid sequences of the SH2D2A-1, -2 and -3 variants: The amino acid position is numbered according to full length TSAd (SH2D2A-1). The SH2D2A-2 and -3 variants differ from the SH2D2A-1 in the N-terminal 1–21 aa and 1–28 aa, respectively. C. Comparison of the N-terminus SH2 domain aa sequences of the SH2D2A-1 and -4 variants: The conserved arginine (R) at position 120 is marked. The SH2D2A-4 has an additional 10 aa (ins aa103–112) in the TSAd-SH2 domain. A SH2 consensus (con) sequence obtained from a Blast search, [42] is included for comparison. Conserved residues are marked in bold.

Techniques Used: Variant Assay, Sequencing

12) Product Images from "Structural Insights into the Activation of the RhoA GTPase by the Lymphoid Blast Crisis (Lbc) Oncoprotein *"

Article Title: Structural Insights into the Activation of the RhoA GTPase by the Lymphoid Blast Crisis (Lbc) Oncoprotein *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M114.561787

RhoA nucleotide exchange as a function of onco-Lbc concentration. A , the formation of RhoA-Mant-GTP was followed by fluorescence (excitation, 356 nm; emission, 440 nm) for onco-Lbc concentrations ranging from 0 and 800 n m . The AKAP protein was injected at time 0. B , the exchange activity of RhoA deviates from a straight line ( dotted gray line ) with increasing onco-Lbc concentrations and follows a hyperbolic function ( dotted black line ) indicative of a two-step mechanism. a.u. , arbitrary units.
Figure Legend Snippet: RhoA nucleotide exchange as a function of onco-Lbc concentration. A , the formation of RhoA-Mant-GTP was followed by fluorescence (excitation, 356 nm; emission, 440 nm) for onco-Lbc concentrations ranging from 0 and 800 n m . The AKAP protein was injected at time 0. B , the exchange activity of RhoA deviates from a straight line ( dotted gray line ) with increasing onco-Lbc concentrations and follows a hyperbolic function ( dotted black line ) indicative of a two-step mechanism. a.u. , arbitrary units.

Techniques Used: Concentration Assay, Fluorescence, Injection, Activity Assay

Binding affinities of RhoA states for onco-Lbc and DHαPH. A , the dissociation constants of the RhoA-GDP·DHαPH, RhoA-GTP·DHαPH, RhoA-GDP·onco-Lbc, an d RhoA-GTP·onco-Lbc complexes were determined by surface plasmon resonance as illustrated by Biacore sensorgrams measured for onco-Lbc and DHαPH at varying concentrations (0–5 μ m ). B , the specific association of RhoA-GTP with the PH domain of onco-Lbc ( K d = 2.93 ± 0.37 μ m ) was contrasted with the inactive GDP-bound RhoA by surface plasmon resonance ( K d > 50 μ m ). The apparent dissociation constant of onco-Lbc that results from the binding of RhoA at two distinct sites was slightly lower for the active ( K d = 2.21 ± 0.26 μ m ) versus the inactive form of RhoA ( K d = 2. 88 ± 0.11 μ m ). C , model of the feedback mechanism triggered by RhoA-GTP binding. Following the association with RhoA-GDP, the DH domain of onco-Lbc exchanges the nucleotide of RhoA. Once released from the PH domain, RhoA-GTP translocates to membranes by virtue of its farnesylfarnesyl moiety ( dotted arrow ) and specifically recognizes the PH domain of onco-Lbc. The binding of RhoA-GTP by the PH domain does not compete with the GEF activity of the DH domain but rather constitutes a possible mechanism of regulation by orientation of onco-Lbc on the membrane by a PH domain that does not itself contain membrane-interacting sites.
Figure Legend Snippet: Binding affinities of RhoA states for onco-Lbc and DHαPH. A , the dissociation constants of the RhoA-GDP·DHαPH, RhoA-GTP·DHαPH, RhoA-GDP·onco-Lbc, an d RhoA-GTP·onco-Lbc complexes were determined by surface plasmon resonance as illustrated by Biacore sensorgrams measured for onco-Lbc and DHαPH at varying concentrations (0–5 μ m ). B , the specific association of RhoA-GTP with the PH domain of onco-Lbc ( K d = 2.93 ± 0.37 μ m ) was contrasted with the inactive GDP-bound RhoA by surface plasmon resonance ( K d > 50 μ m ). The apparent dissociation constant of onco-Lbc that results from the binding of RhoA at two distinct sites was slightly lower for the active ( K d = 2.21 ± 0.26 μ m ) versus the inactive form of RhoA ( K d = 2. 88 ± 0.11 μ m ). C , model of the feedback mechanism triggered by RhoA-GTP binding. Following the association with RhoA-GDP, the DH domain of onco-Lbc exchanges the nucleotide of RhoA. Once released from the PH domain, RhoA-GTP translocates to membranes by virtue of its farnesylfarnesyl moiety ( dotted arrow ) and specifically recognizes the PH domain of onco-Lbc. The binding of RhoA-GTP by the PH domain does not compete with the GEF activity of the DH domain but rather constitutes a possible mechanism of regulation by orientation of onco-Lbc on the membrane by a PH domain that does not itself contain membrane-interacting sites.

Techniques Used: Binding Assay, SPR Assay, Activity Assay

GEF activity of onco-Lbc mutants. A , the residues mutated in the DH-PH tandem are represented by atomic spheres . Mutations are colored according to the effects on GEF activity: red for inactivating except for Glu 2319 ( magenta ), which is activating. B , the exchange activity of onco-Lbc mutants is compared with the wild-type onco-Lbc. The curves represent the exchange of GDP to Mant-GTP after injection of 200 n m onco-Lbc at time 0. Curves are labeled for each mutant. C , the exchange activities of wild-type onco-Lbc and mutants as calculated for GDP to Mant-GTP exchanges are depicted: onco-Lbc, 100 ± 3.6; DH, 173.6 ± 33.4; E2001A, 8.4 ± 4.4; R2136G, 7.4 ± 6.0; R2289A, 10.9 ± 6.5; F2299A, 23.3 ± 22.1; and E2319A, 148.0 ± 8.9. a.u. , arbitrary units. Error bars represent S.D.
Figure Legend Snippet: GEF activity of onco-Lbc mutants. A , the residues mutated in the DH-PH tandem are represented by atomic spheres . Mutations are colored according to the effects on GEF activity: red for inactivating except for Glu 2319 ( magenta ), which is activating. B , the exchange activity of onco-Lbc mutants is compared with the wild-type onco-Lbc. The curves represent the exchange of GDP to Mant-GTP after injection of 200 n m onco-Lbc at time 0. Curves are labeled for each mutant. C , the exchange activities of wild-type onco-Lbc and mutants as calculated for GDP to Mant-GTP exchanges are depicted: onco-Lbc, 100 ± 3.6; DH, 173.6 ± 33.4; E2001A, 8.4 ± 4.4; R2136G, 7.4 ± 6.0; R2289A, 10.9 ± 6.5; F2299A, 23.3 ± 22.1; and E2319A, 148.0 ± 8.9. a.u. , arbitrary units. Error bars represent S.D.

Techniques Used: Activity Assay, Injection, Labeling, Mutagenesis

Assessment of the lipid binding by the PH domain of onco-Lbc. A , chemical shift perturbations were monitored in the 15 N-labeled AKAP DHαPH domain after addition of dihexanoyl phosphatidylserine ( PtdSer ) (5 m m ), PtdIns(4,5)P 2 (1 m m ), or PtdIns(3,4,5)P 3 (0.57 m m ). The absence of specific interaction was shown by the lack of any significant of chemical shift perturbations after each addition. The dotted line indicates significant chemical shift perturbations for a positive control protein (FAPP1-PH). Cross-sections of selected amide proton peaks extracted from the heteronuclear single quantum coherence spectra are compared for samples at the start ( black ) and end of the titration ( red ). The peaks are labeled with the corresponding residue. The chemical shift perturbations (Δδ) were calculated as follows: Δδ = [(Δδ H ) 2 + (0.15 Δδ N ) 2 ] 1/2 where Δδ H and Δδ N are the differences of chemical shift in ppm between the start and the end of the titration for the amide proton and nitrogen resonances, respectively. B , prediction of membrane interaction sites using MODA and PIER software packages ( 28 , 29 ). The NMR structure of the DHαPH solution structure and crystal structures of ARHGEF-1, -11, and -12 were used as inputs for predictions. The residues with high ( purple ) and medium ( orange ) propensities for membrane or protein interaction as predicted by MODA and PIER, respectively, are shown as follows: for onco-Lbc, PIER: 2287, 2299, 2302, 2303, 2308, 2310 ( purple ), 2277, 2278, 2286, 2288, 2306, 2307, 2309, 2312 ( orange ); MODA: none; for ARHGEF1, PIER: 445, 448, 449, 451, 539, 658, 704, 713–716, 726, 728, 736, 737, 739 ( purple ), 47, 66, 401, 403, 406, 431, 434, 441, 444, 447, 450, 482, 486, 514, 535, 538, 542, 543, 659, 691, 692, 710, 712, 717–720, 724, 730, 734, 735, 752, 756 ( orange ); MODA: none; for ARHGEF11, PIER: 749, 881, 1046, 1047, 1044, 1055 ( purple ), 743–745, 747, 748, 751, 752, 755, 877, 880, 884, 888, 927, 975, 1021, 1022, 1031–1037, 1048, 1049, 1052–1055, 1058 ( orange ); MODA: 1032, 1034, 1037–1038, 1046, 1048–1051, 1054, 1056 ( red ), 1047, 1052 ( orange ); for ARHGEF12, PIER: 793, 794, 797, 798, 801, 805, 808, 998, 1029, 1059, 1078, 1084, 1091, 1092, 1095, 1102, 1103, 1105, 1120–1122, 1125, 1128, 1129, 1131 ( purple ), 802, 936, 999, 1007, 1010, 1028, 1030, 1060, 1061, 1075–1077, 1080, 1085–1090, 1098, 1101, 1107–1111, 1124 ( orange ); MODA: 868, 918–920, 922–924, 1106–1108, 1088 ( purple ), 921, 1108 ( orange ). The proteins are predicted to associate with membrane-bound RhoA-GTP via the right-hand surfaces of their depicted PH domain orientations.
Figure Legend Snippet: Assessment of the lipid binding by the PH domain of onco-Lbc. A , chemical shift perturbations were monitored in the 15 N-labeled AKAP DHαPH domain after addition of dihexanoyl phosphatidylserine ( PtdSer ) (5 m m ), PtdIns(4,5)P 2 (1 m m ), or PtdIns(3,4,5)P 3 (0.57 m m ). The absence of specific interaction was shown by the lack of any significant of chemical shift perturbations after each addition. The dotted line indicates significant chemical shift perturbations for a positive control protein (FAPP1-PH). Cross-sections of selected amide proton peaks extracted from the heteronuclear single quantum coherence spectra are compared for samples at the start ( black ) and end of the titration ( red ). The peaks are labeled with the corresponding residue. The chemical shift perturbations (Δδ) were calculated as follows: Δδ = [(Δδ H ) 2 + (0.15 Δδ N ) 2 ] 1/2 where Δδ H and Δδ N are the differences of chemical shift in ppm between the start and the end of the titration for the amide proton and nitrogen resonances, respectively. B , prediction of membrane interaction sites using MODA and PIER software packages ( 28 , 29 ). The NMR structure of the DHαPH solution structure and crystal structures of ARHGEF-1, -11, and -12 were used as inputs for predictions. The residues with high ( purple ) and medium ( orange ) propensities for membrane or protein interaction as predicted by MODA and PIER, respectively, are shown as follows: for onco-Lbc, PIER: 2287, 2299, 2302, 2303, 2308, 2310 ( purple ), 2277, 2278, 2286, 2288, 2306, 2307, 2309, 2312 ( orange ); MODA: none; for ARHGEF1, PIER: 445, 448, 449, 451, 539, 658, 704, 713–716, 726, 728, 736, 737, 739 ( purple ), 47, 66, 401, 403, 406, 431, 434, 441, 444, 447, 450, 482, 486, 514, 535, 538, 542, 543, 659, 691, 692, 710, 712, 717–720, 724, 730, 734, 735, 752, 756 ( orange ); MODA: none; for ARHGEF11, PIER: 749, 881, 1046, 1047, 1044, 1055 ( purple ), 743–745, 747, 748, 751, 752, 755, 877, 880, 884, 888, 927, 975, 1021, 1022, 1031–1037, 1048, 1049, 1052–1055, 1058 ( orange ); MODA: 1032, 1034, 1037–1038, 1046, 1048–1051, 1054, 1056 ( red ), 1047, 1052 ( orange ); for ARHGEF12, PIER: 793, 794, 797, 798, 801, 805, 808, 998, 1029, 1059, 1078, 1084, 1091, 1092, 1095, 1102, 1103, 1105, 1120–1122, 1125, 1128, 1129, 1131 ( purple ), 802, 936, 999, 1007, 1010, 1028, 1030, 1060, 1061, 1075–1077, 1080, 1085–1090, 1098, 1101, 1107–1111, 1124 ( orange ); MODA: 868, 918–920, 922–924, 1106–1108, 1088 ( purple ), 921, 1108 ( orange ). The proteins are predicted to associate with membrane-bound RhoA-GTP via the right-hand surfaces of their depicted PH domain orientations.

Techniques Used: Binding Assay, Labeling, Positive Control, Titration, Software, Nuclear Magnetic Resonance

Putative RhoA binding sites. The putative location of RhoA-GTP bound to the onco-Lbc PH domain β5-β7 sheet is indicated by a blue dotted line circle . Mutated residues are represented by sticks and balls color-coded according to Fig. 4 . The position of RhoA-GDP on the DH domain is inferred from ARHGEF11 and -12. Residues corresponding to Lys 2318 and Glu 2319 are represented at the αCt helix of the PH domain for the model of onco-Lbc, ARHGEF11, and ARHGEF12. Residues Asp 97 and Arg 150 from RhoA and facing the PH domain are shown in the enlarged views .
Figure Legend Snippet: Putative RhoA binding sites. The putative location of RhoA-GTP bound to the onco-Lbc PH domain β5-β7 sheet is indicated by a blue dotted line circle . Mutated residues are represented by sticks and balls color-coded according to Fig. 4 . The position of RhoA-GDP on the DH domain is inferred from ARHGEF11 and -12. Residues corresponding to Lys 2318 and Glu 2319 are represented at the αCt helix of the PH domain for the model of onco-Lbc, ARHGEF11, and ARHGEF12. Residues Asp 97 and Arg 150 from RhoA and facing the PH domain are shown in the enlarged views .

Techniques Used: Binding Assay

Mapping of RhoA interaction site. A , binding of RhoA-GTP specifically broadens amide signals in the PH domain following the addition of 4 n m onco-Lbc with peak intensity reductions measured from a 1 H, 15 N-resolved two-dimensional experiment after 20 min. The y axis represents the normalized peak intensity reduction (1 = 100% reduction). B , the residues exhibiting line broadening upon RhoA-GTP binding are labeled and map to the exposed β sheet and proximal loops of the PH domain. C , the 15 N-resolved two-dimensional NMR spectra of the AKAP DHαPH domain sample containing RhoA-GDP (1:2 ratio) and GTP (1 m m ) are overlaid in the upper panel before ( black ) and after addition of onco-Lbc (4 n m ) ( red ). The lower panel shows the recovery of amide resonances from 15 N-labeled AKAP DHαPH after addition of calf intestinal alkaline phosphatase (CIP) ( blue ). Signals significantly broadened after addition of onco-Lbc are labeled by the residue. The S2278a and G2297b peaks are weak and located just outside the spectral region displayed, respectively.
Figure Legend Snippet: Mapping of RhoA interaction site. A , binding of RhoA-GTP specifically broadens amide signals in the PH domain following the addition of 4 n m onco-Lbc with peak intensity reductions measured from a 1 H, 15 N-resolved two-dimensional experiment after 20 min. The y axis represents the normalized peak intensity reduction (1 = 100% reduction). B , the residues exhibiting line broadening upon RhoA-GTP binding are labeled and map to the exposed β sheet and proximal loops of the PH domain. C , the 15 N-resolved two-dimensional NMR spectra of the AKAP DHαPH domain sample containing RhoA-GDP (1:2 ratio) and GTP (1 m m ) are overlaid in the upper panel before ( black ) and after addition of onco-Lbc (4 n m ) ( red ). The lower panel shows the recovery of amide resonances from 15 N-labeled AKAP DHαPH after addition of calf intestinal alkaline phosphatase (CIP) ( blue ). Signals significantly broadened after addition of onco-Lbc are labeled by the residue. The S2278a and G2297b peaks are weak and located just outside the spectral region displayed, respectively.

Techniques Used: Binding Assay, Labeling, Nuclear Magnetic Resonance

Solution structure of the full-length onco-Lbc. A , the dynamics of DHαPH is illustrated by the order parameters ( S 2 ) calculated using the RCI server ( 27 ). B , monomeric solution state of onco-Lbc as determined by velocity sedimentation. The distribution of the sedimentation coefficients is centered on 3.024 S, showing that onco-Lbc is monodispersed and monomeric in solution. C , interatomic distance distribution function for onco-Lbc calculated with PRIMUS. Models were generated with Modeler, and their theoretical scattering intensity was calculated with CRYSOL and fitted to the experimental data. The best fit calculated by CRYSOL between the experimental data and the model is represented in the left panel (χ 2 , 1.352). The best fit model of onco-Lbc is positioned in the molecular envelope generated with DAMMIF from the scattering pattern. Domains of onco-Lbc are color-coded as in Fig. 1 .
Figure Legend Snippet: Solution structure of the full-length onco-Lbc. A , the dynamics of DHαPH is illustrated by the order parameters ( S 2 ) calculated using the RCI server ( 27 ). B , monomeric solution state of onco-Lbc as determined by velocity sedimentation. The distribution of the sedimentation coefficients is centered on 3.024 S, showing that onco-Lbc is monodispersed and monomeric in solution. C , interatomic distance distribution function for onco-Lbc calculated with PRIMUS. Models were generated with Modeler, and their theoretical scattering intensity was calculated with CRYSOL and fitted to the experimental data. The best fit calculated by CRYSOL between the experimental data and the model is represented in the left panel (χ 2 , 1.352). The best fit model of onco-Lbc is positioned in the molecular envelope generated with DAMMIF from the scattering pattern. Domains of onco-Lbc are color-coded as in Fig. 1 .

Techniques Used: Sedimentation, Generated

13) Product Images from "Structural basis for the recognition of two consecutive mutually interacting DPF motifs by the SGIP1 μ homology domain"

Article Title: Structural basis for the recognition of two consecutive mutually interacting DPF motifs by the SGIP1 μ homology domain

Journal: Scientific Reports

doi: 10.1038/srep19565

Three-dimensional structures of the μHDs. ( a , b ) Ribbon models of the crystal structures of the SGIP1 μHD, in two different space groups. The α- and 3 10 -helices, β-sheets, and coil regions of the μHDs are colored salmon, light blue, and pale green, respectively. ( a ) The selenomethionine (SeMet)-substituted SGIP1 μHD in the P 42 1 2 space group. N and C indicate the amino and carboxy termini. Secondary structure elements are labeled. The α helix that is missing in the crystal structure of the SGIP1 μHD in the P 1 space group is indicated by a dashed circle. ( b ) One of the two SGIP1 μHD molecules in the asymmetric unit of the crystal in the P 1 space group. The β-sheets missing in the crystal structure of the SGIP1 μHD in the P 42 1 2 space group are indicated by dashed circles and labeled. ( c ) Stereoview of the superimposition of the backbone Cα atoms of the SGIP1 μHD (cyan), the μ2 μHD 23 (magenta; PDB ID code 1BW8), the μ3 μHD 24 (green; PDB ID code 4IKN), the μ4 μHD 25 (yellow; PDB ID code 3L81), the Syp1 μHD 8 (orange; PDB ID code 3G9H), the bovine COPI δ subunit μHD 26 (blue; PDB ID code 4O8Q), and the yeast δ-COP subunit μHD 27 (purple; PDB ID code 5FJZ). The circles indicate the locations of the C-terminal portion of α2 and the following connecting loop and the N-terminal portion of β7 in the SGIP1 μHD, which adopted unique conformations that significantly differed from other known μHD structures. The two conserved residues of SGIP1, Thr667 and Tyr668, which are located in the loop connecting α2 and β7 and at the N-terminus of β7, respectively, and are involved in interactions with Eps15 (see below), are shown as sticks.
Figure Legend Snippet: Three-dimensional structures of the μHDs. ( a , b ) Ribbon models of the crystal structures of the SGIP1 μHD, in two different space groups. The α- and 3 10 -helices, β-sheets, and coil regions of the μHDs are colored salmon, light blue, and pale green, respectively. ( a ) The selenomethionine (SeMet)-substituted SGIP1 μHD in the P 42 1 2 space group. N and C indicate the amino and carboxy termini. Secondary structure elements are labeled. The α helix that is missing in the crystal structure of the SGIP1 μHD in the P 1 space group is indicated by a dashed circle. ( b ) One of the two SGIP1 μHD molecules in the asymmetric unit of the crystal in the P 1 space group. The β-sheets missing in the crystal structure of the SGIP1 μHD in the P 42 1 2 space group are indicated by dashed circles and labeled. ( c ) Stereoview of the superimposition of the backbone Cα atoms of the SGIP1 μHD (cyan), the μ2 μHD 23 (magenta; PDB ID code 1BW8), the μ3 μHD 24 (green; PDB ID code 4IKN), the μ4 μHD 25 (yellow; PDB ID code 3L81), the Syp1 μHD 8 (orange; PDB ID code 3G9H), the bovine COPI δ subunit μHD 26 (blue; PDB ID code 4O8Q), and the yeast δ-COP subunit μHD 27 (purple; PDB ID code 5FJZ). The circles indicate the locations of the C-terminal portion of α2 and the following connecting loop and the N-terminal portion of β7 in the SGIP1 μHD, which adopted unique conformations that significantly differed from other known μHD structures. The two conserved residues of SGIP1, Thr667 and Tyr668, which are located in the loop connecting α2 and β7 and at the N-terminus of β7, respectively, and are involved in interactions with Eps15 (see below), are shown as sticks.

Techniques Used: Labeling

The Δ G values of the interactions between Eps15 fragments and various μHD and α-adaptin appendage domain samples, determined by ITC. The experiment numbers and Eps15 fragment names correspond to those in Supplementary Table 2 . For the ITC experiments analyzed with the two-site model, only the Δ G values for the higher-affinity binding sites are shown. The bars are colored according to the numbers of DPF motifs in the Eps15 fragment used in each ITC experiment (0–1 DPF motifs: purple; 2 DPF motifs: cyan; 3 DPF motifs: green; 4 DPF motifs: yellow; 5 DPF motifs: orange; 6–15 DPF motifs: red). The mean Δ G values of the interactions between the SGIP1 μHD and respective Eps15 fragments containing the same numbers of consecutive DPF motifs are indicated, and the data below the detection limit were excluded from the calculation of the mean values. Larger negative values of Δ G indicate higher affinities between the two molecules.
Figure Legend Snippet: The Δ G values of the interactions between Eps15 fragments and various μHD and α-adaptin appendage domain samples, determined by ITC. The experiment numbers and Eps15 fragment names correspond to those in Supplementary Table 2 . For the ITC experiments analyzed with the two-site model, only the Δ G values for the higher-affinity binding sites are shown. The bars are colored according to the numbers of DPF motifs in the Eps15 fragment used in each ITC experiment (0–1 DPF motifs: purple; 2 DPF motifs: cyan; 3 DPF motifs: green; 4 DPF motifs: yellow; 5 DPF motifs: orange; 6–15 DPF motifs: red). The mean Δ G values of the interactions between the SGIP1 μHD and respective Eps15 fragments containing the same numbers of consecutive DPF motifs are indicated, and the data below the detection limit were excluded from the calculation of the mean values. Larger negative values of Δ G indicate higher affinities between the two molecules.

Techniques Used: Binding Assay

Comparison of the known ligand-binding sites of the μHDs. ( a – c ) Complexes of the μHDs of various proteins and their peptide ligands. The μHDs (gray) and peptides (yellow) are shown as ribbon models and sticks, respectively. ( a ) The SGIP1 μHD in complex with Eps15-645–654. ( b ) The μ2 μHD in complex with the peptide FYRALM 23 (PDB ID code 1BW8). ( c ) The μ4 μHD in complex with the peptide TYKFFEQ 25 (PDB ID code 3L81). ( d ) The yeast δ-COP subunit μHD in complex with the peptide DWNWEV 27 (PDB ID code 5FJZ). ( e – h ) Conserved surface residues of the μHDs. The bound peptides are shown as in ( a) –( d ), respectively. ( e ) The surface of the SGIP1 μHD is colored according to the rate of sequence conservation among the 150 sequences of close homologs 46 , in a gradient from cyan (most variable residues) to white to magenta (most highly conserved residues). ( f ) The surface of the μ2 μHD is colored according to the rate of sequence conservation among the 150 sequences of close homologs, as in ( e ). ( g ) The surface of the μ4 μHD is colored according to the rate of sequence conservation among the 16 sequences of close homologs, as in ( e ). ( h ) The surface of the yeast δ-COP subunit μHD is colored according to the rate of sequence conservation among the 25 sequences of close homologs, as in ( e ).
Figure Legend Snippet: Comparison of the known ligand-binding sites of the μHDs. ( a – c ) Complexes of the μHDs of various proteins and their peptide ligands. The μHDs (gray) and peptides (yellow) are shown as ribbon models and sticks, respectively. ( a ) The SGIP1 μHD in complex with Eps15-645–654. ( b ) The μ2 μHD in complex with the peptide FYRALM 23 (PDB ID code 1BW8). ( c ) The μ4 μHD in complex with the peptide TYKFFEQ 25 (PDB ID code 3L81). ( d ) The yeast δ-COP subunit μHD in complex with the peptide DWNWEV 27 (PDB ID code 5FJZ). ( e – h ) Conserved surface residues of the μHDs. The bound peptides are shown as in ( a) –( d ), respectively. ( e ) The surface of the SGIP1 μHD is colored according to the rate of sequence conservation among the 150 sequences of close homologs 46 , in a gradient from cyan (most variable residues) to white to magenta (most highly conserved residues). ( f ) The surface of the μ2 μHD is colored according to the rate of sequence conservation among the 150 sequences of close homologs, as in ( e ). ( g ) The surface of the μ4 μHD is colored according to the rate of sequence conservation among the 16 sequences of close homologs, as in ( e ). ( h ) The surface of the yeast δ-COP subunit μHD is colored according to the rate of sequence conservation among the 25 sequences of close homologs, as in ( e ).

Techniques Used: Ligand Binding Assay, Sequencing

Crystal structures of the SGIP1 μHD in complex with Eps15-derived peptides. ( a ) Ribbon model of the crystal structure of the SGIP1 μHD in complex with Eps15-645–654. The μHD is colored as in Fig. 3a . The SGIP1 residues involved in the recognition of Eps15-645–654 are shown as magenta sticks. Eps15-645–654 is shown as yellow sticks. ( b ) Close-up view of the interaction between the μHD and Eps15-645–654 (amino acid sequence: YDPFKGSDPFA). The molecules are colored as in ( a ). Selected interface residues of the μHD are labeled. Dotted lines indicate intermolecular and intramolecular hydrogen bonding networks involved in Eps15-645–654 recognition by the μHD. ( c ) Superimposition of close-up views of the μHD in complex with Eps15-645–654 and that in complex with Eps15-640–649 (amino acid sequence: YDPFGGDPFKG). The μHD in complex with Eps15-645–654 is colored as in ( a) . The μHD in the Eps15-640–649 complex is colored gray. Eps15-640–649 and selected interface residues of the μHD in the Eps15-640–649 complex are shown as cyan and orange sticks, respectively. ( d ) The structure of Eps15-645–654 bound to the μHD. Only the Eps15-645–654 molecule is shown, as yellow sticks. Dotted straight lines indicate hydrogen bonds stabilizing the type-I β-turn conformations of the two DPF motifs, indicated by dashed circles. ( e ) A diagram showing the effects of the replacement of each residue of the two DPF motifs with the indicated amino acids on the affinity for the μHD.
Figure Legend Snippet: Crystal structures of the SGIP1 μHD in complex with Eps15-derived peptides. ( a ) Ribbon model of the crystal structure of the SGIP1 μHD in complex with Eps15-645–654. The μHD is colored as in Fig. 3a . The SGIP1 residues involved in the recognition of Eps15-645–654 are shown as magenta sticks. Eps15-645–654 is shown as yellow sticks. ( b ) Close-up view of the interaction between the μHD and Eps15-645–654 (amino acid sequence: YDPFKGSDPFA). The molecules are colored as in ( a ). Selected interface residues of the μHD are labeled. Dotted lines indicate intermolecular and intramolecular hydrogen bonding networks involved in Eps15-645–654 recognition by the μHD. ( c ) Superimposition of close-up views of the μHD in complex with Eps15-645–654 and that in complex with Eps15-640–649 (amino acid sequence: YDPFGGDPFKG). The μHD in complex with Eps15-645–654 is colored as in ( a) . The μHD in the Eps15-640–649 complex is colored gray. Eps15-640–649 and selected interface residues of the μHD in the Eps15-640–649 complex are shown as cyan and orange sticks, respectively. ( d ) The structure of Eps15-645–654 bound to the μHD. Only the Eps15-645–654 molecule is shown, as yellow sticks. Dotted straight lines indicate hydrogen bonds stabilizing the type-I β-turn conformations of the two DPF motifs, indicated by dashed circles. ( e ) A diagram showing the effects of the replacement of each residue of the two DPF motifs with the indicated amino acids on the affinity for the μHD.

Techniques Used: Derivative Assay, Sequencing, Labeling

Mutually non-exclusive high-affinity binding of the μHD and the appendage domain to Eps15. ( a ) SDS-PAGE gel pattern of the elution fractions from the gel filtration analysis, showing the equimolar binding of Eps15-530–896, the SGIP1 μHD, and the α-adaptin appendage domain. Eps15-530–896, the SGIP1 μHD, and the appendage domain were mixed in a 1:3:6 molar ratio and analyzed by gel filtration. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions showed that one peak corresponds to the ternary complex of Eps15-530–896, the SGIP1 μHD, and the appendage domain, and the other two peaks correspond to the SGIP1 μHD alone and the appendage domain alone. ( b ) A model of FCHo1/FCHo2, the AP-2 complex, and Eps15 participating in the clathrin assembly step of CME. The high-affinity interactions between the FCHo1/FCHo2 μHD and Eps15, and between the AP-2 complex and Eps15 are emphasized by the thick double arrows. Only major interactions are shown, for clarity.
Figure Legend Snippet: Mutually non-exclusive high-affinity binding of the μHD and the appendage domain to Eps15. ( a ) SDS-PAGE gel pattern of the elution fractions from the gel filtration analysis, showing the equimolar binding of Eps15-530–896, the SGIP1 μHD, and the α-adaptin appendage domain. Eps15-530–896, the SGIP1 μHD, and the appendage domain were mixed in a 1:3:6 molar ratio and analyzed by gel filtration. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions showed that one peak corresponds to the ternary complex of Eps15-530–896, the SGIP1 μHD, and the appendage domain, and the other two peaks correspond to the SGIP1 μHD alone and the appendage domain alone. ( b ) A model of FCHo1/FCHo2, the AP-2 complex, and Eps15 participating in the clathrin assembly step of CME. The high-affinity interactions between the FCHo1/FCHo2 μHD and Eps15, and between the AP-2 complex and Eps15 are emphasized by the thick double arrows. Only major interactions are shown, for clarity.

Techniques Used: Binding Assay, SDS Page, Filtration

Identification of the SGIP1 μHD-binding sites in Eps15. ( a ) Eps15 fragments used for analytical gel filtration and ITC experiments. The amino acid sequence of the C-terminal region of Eps15 is shown, with the DPF motifs colored red and indicated by black dots. Eps15 fragments used for analytical gel filtration and ITC experiments are indicated as bars below the corresponding regions of the amino acid sequence of Eps15. The bars are colored red, orange, yellow, green, and cyan, according to the binding strength of the corresponding fragments to the μHD. The fragments are labeled according to the fragment names in Supplementary Tables 1 and 2 . ( b ) The SDS-PAGE gel pattern of the elution fractions from the gel filtration analysis of Eps15-530–896. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions revealed that the apparent molecular weight of Eps15-530–896 deduced from the elution volume is significantly higher than the true molecular weight. ( c ) The SDS-PAGE gel pattern of the elution fractions from gel filtration, showing the equimolar binding of Eps15-530–896 and the SGIP1 μHD. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions demonstrated that one peak corresponds to the complex of Eps15-530–896 and the SGIP1 μHD, and the other peak corresponds to the SGIP1 μHD alone.
Figure Legend Snippet: Identification of the SGIP1 μHD-binding sites in Eps15. ( a ) Eps15 fragments used for analytical gel filtration and ITC experiments. The amino acid sequence of the C-terminal region of Eps15 is shown, with the DPF motifs colored red and indicated by black dots. Eps15 fragments used for analytical gel filtration and ITC experiments are indicated as bars below the corresponding regions of the amino acid sequence of Eps15. The bars are colored red, orange, yellow, green, and cyan, according to the binding strength of the corresponding fragments to the μHD. The fragments are labeled according to the fragment names in Supplementary Tables 1 and 2 . ( b ) The SDS-PAGE gel pattern of the elution fractions from the gel filtration analysis of Eps15-530–896. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions revealed that the apparent molecular weight of Eps15-530–896 deduced from the elution volume is significantly higher than the true molecular weight. ( c ) The SDS-PAGE gel pattern of the elution fractions from gel filtration, showing the equimolar binding of Eps15-530–896 and the SGIP1 μHD. The Superdex 200 elution profile and the SDS-PAGE analysis of the fractions demonstrated that one peak corresponds to the complex of Eps15-530–896 and the SGIP1 μHD, and the other peak corresponds to the SGIP1 μHD alone.

Techniques Used: Binding Assay, Filtration, Sequencing, Labeling, SDS Page, Molecular Weight

14) Product Images from "Oestrogen receptor β regulates epigenetic patterns at specific genomic loci through interaction with thymine DNA glycosylase"

Article Title: Oestrogen receptor β regulates epigenetic patterns at specific genomic loci through interaction with thymine DNA glycosylase

Journal: Epigenetics & Chromatin

doi: 10.1186/s13072-016-0055-7

ERβ interacts directly with TDG. a Interaction of ERβ and TDG in GST-pulldown assays. GST-tagged ERβ or GST alone was immobilised on Glutathione Sepharose and incubated with recombinant TDG. The left panel shows representative western blots of the eluates using an anti-GST and an anti-TDG antibody. Quantification of four independent experiments is shown the right panel. Asterisk indicates significantly ( p
Figure Legend Snippet: ERβ interacts directly with TDG. a Interaction of ERβ and TDG in GST-pulldown assays. GST-tagged ERβ or GST alone was immobilised on Glutathione Sepharose and incubated with recombinant TDG. The left panel shows representative western blots of the eluates using an anti-GST and an anti-TDG antibody. Quantification of four independent experiments is shown the right panel. Asterisk indicates significantly ( p

Techniques Used: Incubation, Recombinant, Western Blot

ERβ–TDG interaction affects gene regulation. a TDG increases ERβ transcriptional activity in reporter assays. Tdg −/− MEFs were transfected with plasmids encoding for the reporter gene 3× ERE-luc, TK-renilla, ERβ, and TDG in different concentrations (50, 150, and 300 ng transfected plasmid), and treated with 10 nM E2. After 16 h, firefly luciferase activity was measured and normalised against renilla luciferase activity (means + SD; n ≥ 3). TDG co-expression increased luciferase activity significantly (** p
Figure Legend Snippet: ERβ–TDG interaction affects gene regulation. a TDG increases ERβ transcriptional activity in reporter assays. Tdg −/− MEFs were transfected with plasmids encoding for the reporter gene 3× ERE-luc, TK-renilla, ERβ, and TDG in different concentrations (50, 150, and 300 ng transfected plasmid), and treated with 10 nM E2. After 16 h, firefly luciferase activity was measured and normalised against renilla luciferase activity (means + SD; n ≥ 3). TDG co-expression increased luciferase activity significantly (** p

Techniques Used: Activity Assay, Transfection, Plasmid Preparation, Luciferase, Expressing

ERβ deficiency leads to altered DNA methylation patterns. a Histogram showing the distribution of methylation at the sequenced cytosines in wt and βerko MEFs. b Scatterplot of percentage (%) methylation in wt vs. βerko MEFs at cytosines covered in both cell types. c Pie chart presenting the genomic distribution of hypo- and hypermethylated positions. A position was considered hypermethylated if more than 80 % of the reads indicated methylation and hypomethylated if less than 20 % indicated methylation in βerko MEFs. d Enrichment (log2 ratios of observed over random) of hypo- and hypermethylated positions at different genomic features. e Comparison of regions identified by RRBS with datasets for histone modifications in MEFs [ 36 ] using GenomeInspector (Genomatix). Bar plots indicate percentages of hypomethylated (hypo) and hypermethylated (hyper) CpGs either marked by H3K4m3 ( red ), H3K27me3 ( orange ), both marks ( yellow ), or none of them (negative, white ), or H3K4m1 ( blue ), H3K4m1 plus H3K27ac ( green ), or none of them (negative, white ). Odds ratios (ORs) and p values according to Fisher exact test. f Enrichment (log2 ratios of observed over random) of histone modifications at hypo- and hypermethylated positions
Figure Legend Snippet: ERβ deficiency leads to altered DNA methylation patterns. a Histogram showing the distribution of methylation at the sequenced cytosines in wt and βerko MEFs. b Scatterplot of percentage (%) methylation in wt vs. βerko MEFs at cytosines covered in both cell types. c Pie chart presenting the genomic distribution of hypo- and hypermethylated positions. A position was considered hypermethylated if more than 80 % of the reads indicated methylation and hypomethylated if less than 20 % indicated methylation in βerko MEFs. d Enrichment (log2 ratios of observed over random) of hypo- and hypermethylated positions at different genomic features. e Comparison of regions identified by RRBS with datasets for histone modifications in MEFs [ 36 ] using GenomeInspector (Genomatix). Bar plots indicate percentages of hypomethylated (hypo) and hypermethylated (hyper) CpGs either marked by H3K4m3 ( red ), H3K27me3 ( orange ), both marks ( yellow ), or none of them (negative, white ), or H3K4m1 ( blue ), H3K4m1 plus H3K27ac ( green ), or none of them (negative, white ). Odds ratios (ORs) and p values according to Fisher exact test. f Enrichment (log2 ratios of observed over random) of histone modifications at hypo- and hypermethylated positions

Techniques Used: DNA Methylation Assay, Methylation

Hyper- but not hypomethylation in βerko MEFs is reversible by re-introduction of ERβ into βerko MEFs. a DNA methylation analysis of ten hypo- and eight hypermethylated positions. DNA methylation was assessed by methylation-specific enzymatic digest followed by qPCR. Positions with gene names in brackets were chosen for further analysis. b DNA methylation ( left panel ) and histone modifications ( right panel ) of differentially methylated genes in wt, βerko, and βerkohERβ MEFs. DNA methylation was assessed by pyrosequencing of bisulfite-treated DNA; black arrows mark DMPs identified by RRBS. Triple Asterisk indicates significant differences ( p
Figure Legend Snippet: Hyper- but not hypomethylation in βerko MEFs is reversible by re-introduction of ERβ into βerko MEFs. a DNA methylation analysis of ten hypo- and eight hypermethylated positions. DNA methylation was assessed by methylation-specific enzymatic digest followed by qPCR. Positions with gene names in brackets were chosen for further analysis. b DNA methylation ( left panel ) and histone modifications ( right panel ) of differentially methylated genes in wt, βerko, and βerkohERβ MEFs. DNA methylation was assessed by pyrosequencing of bisulfite-treated DNA; black arrows mark DMPs identified by RRBS. Triple Asterisk indicates significant differences ( p

Techniques Used: DNA Methylation Assay, Methylation, Real-time Polymerase Chain Reaction

ERβ binds to regions around DMPs. a ERβ recruitment to differentially methylated genes in MEFs ( left panel ) and ESCs ( right panel ). HA-tagged ERβ was precipitated and differentially methylated regions were analysed by qRT-PCR. Asterisk indicates significant ( p
Figure Legend Snippet: ERβ binds to regions around DMPs. a ERβ recruitment to differentially methylated genes in MEFs ( left panel ) and ESCs ( right panel ). HA-tagged ERβ was precipitated and differentially methylated regions were analysed by qRT-PCR. Asterisk indicates significant ( p

Techniques Used: Methylation, Quantitative RT-PCR

ERβ-dependent transcription of differentially methylated genes in MEFs and ESCs. a Venn diagram visualising overlaps between differentially methylated (identified by RRBS) and differentially expressed (identified by microarray expression analysis) genes in wt and βerko cells. b Gene expression analysis of hypomethylated ( Dyx1c1 , HoxD9 ), hypermethylated complementable ( HoxA9, HoxA10, and Tnfaip2 ), and hypermethylated non-complementable genes in wt, βerko, and βerkohERβ MEFs. Gene expression was analysed by RT-qPCR (mean + SD; n ≥ 3). c DNA methylation of differentially methylated genes in wt MEFs and ESCs, assessed by methylation-specific enzymatic digest followed by qPCR. d ERβ-dependent expression of differentially methylated genes in ESCs. Gene expression was assessed by qRT-PCR 4 days after transfection with plasmid encoding for shRNA against ERβ or non-targeting control (means + SD; n ≥ 3). All the genes showed significantly decreased expression compared to shcontrol (** p
Figure Legend Snippet: ERβ-dependent transcription of differentially methylated genes in MEFs and ESCs. a Venn diagram visualising overlaps between differentially methylated (identified by RRBS) and differentially expressed (identified by microarray expression analysis) genes in wt and βerko cells. b Gene expression analysis of hypomethylated ( Dyx1c1 , HoxD9 ), hypermethylated complementable ( HoxA9, HoxA10, and Tnfaip2 ), and hypermethylated non-complementable genes in wt, βerko, and βerkohERβ MEFs. Gene expression was analysed by RT-qPCR (mean + SD; n ≥ 3). c DNA methylation of differentially methylated genes in wt MEFs and ESCs, assessed by methylation-specific enzymatic digest followed by qPCR. d ERβ-dependent expression of differentially methylated genes in ESCs. Gene expression was assessed by qRT-PCR 4 days after transfection with plasmid encoding for shRNA against ERβ or non-targeting control (means + SD; n ≥ 3). All the genes showed significantly decreased expression compared to shcontrol (** p

Techniques Used: Methylation, Microarray, Expressing, Quantitative RT-PCR, DNA Methylation Assay, Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, shRNA

15) Product Images from "Phosphorylation and SCF-mediated degradation regulate CREB-H transcription of metabolic targets"

Article Title: Phosphorylation and SCF-mediated degradation regulate CREB-H transcription of metabolic targets

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E15-04-0247

Multiple species of the N-terminal product of CREB-H due to phosphorylation. (a) Schematic indicating the conserved bZip and transmembrane (TM) domains, the S1P and S2P cleavage sites (x), and the mature cleaved product, termed CREB-HΔTMC. (b) Western blot showing CREB-HΔTMC after transfection in COS cells, migrating as multiple species (lane 1), which comigrate with those produced by brefeldin A (BFA)–induced cleavage of the full-length (FL) precursor form (lane 3), as discussed in the text. (c) Soluble extracts of cells expressing CREB-HΔTMC were treated with λ phosphatase for increasing times at 37°C (0, 2, 5, 7, 10, 15, 30 min; lanes 3–9) or as controls, without phosphatase (lane 1) or with phosphatase in the presence of phosphatase inhibitors (10 mM sodium orthovanadate and 20 mM NaF; lane 2). Phosphatase treatment converts the upper form, N 1 , to the N form, with species likely representing multiple phosphorylated forms (small arrows) closely migrating between N and N 1 .
Figure Legend Snippet: Multiple species of the N-terminal product of CREB-H due to phosphorylation. (a) Schematic indicating the conserved bZip and transmembrane (TM) domains, the S1P and S2P cleavage sites (x), and the mature cleaved product, termed CREB-HΔTMC. (b) Western blot showing CREB-HΔTMC after transfection in COS cells, migrating as multiple species (lane 1), which comigrate with those produced by brefeldin A (BFA)–induced cleavage of the full-length (FL) precursor form (lane 3), as discussed in the text. (c) Soluble extracts of cells expressing CREB-HΔTMC were treated with λ phosphatase for increasing times at 37°C (0, 2, 5, 7, 10, 15, 30 min; lanes 3–9) or as controls, without phosphatase (lane 1) or with phosphatase in the presence of phosphatase inhibitors (10 mM sodium orthovanadate and 20 mM NaF; lane 2). Phosphatase treatment converts the upper form, N 1 , to the N form, with species likely representing multiple phosphorylated forms (small arrows) closely migrating between N and N 1 .

Techniques Used: Western Blot, Transfection, Produced, Expressing

16) Product Images from "Avoiding drug resistance through extended drug target interfaces: a case for stapled peptides"

Article Title: Avoiding drug resistance through extended drug target interfaces: a case for stapled peptides

Journal: Oncotarget

doi: 10.18632/oncotarget.8572

PM2 resistance is also seen when point mutants are introduced into full-length HDM2 A. In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to indicated C8-derived point mutants (asterisk) present in full-length HDM2 The point mutant F55L also shows reduced inhibition by Nutlin (10μM). Blank indicates background p53 binding in absence of HDM2. B. As in A, additionally showing levels of wild type and indicated HDM2 variants co-eluted off beads after pull-down following mock (panel 3) and PM2 treatment (panel 4). Note exposure time for p53 pull-down in absence of treatment (panel 1) is 5s and 10 minutes for pull-down after PM2 treatment (panel 2, developed using film). Exposure time for HDM2 input and HDM2 (+ indicated variants) eluted off beads after pull-down is 30 seconds (digitally acquired).
Figure Legend Snippet: PM2 resistance is also seen when point mutants are introduced into full-length HDM2 A. In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to indicated C8-derived point mutants (asterisk) present in full-length HDM2 The point mutant F55L also shows reduced inhibition by Nutlin (10μM). Blank indicates background p53 binding in absence of HDM2. B. As in A, additionally showing levels of wild type and indicated HDM2 variants co-eluted off beads after pull-down following mock (panel 3) and PM2 treatment (panel 4). Note exposure time for p53 pull-down in absence of treatment (panel 1) is 5s and 10 minutes for pull-down after PM2 treatment (panel 2, developed using film). Exposure time for HDM2 input and HDM2 (+ indicated variants) eluted off beads after pull-down is 30 seconds (digitally acquired).

Techniques Used: In Vitro, Pull Down Assay, Inhibition, Derivative Assay, Mutagenesis, Binding Assay

Projection of HDM2-C8 mutants onto HDM2 N-terminal domain structure Shown is structure of M06 stapled peptide (cyan, grey) bound to HDM2-M62A N-terminal domain (pink). The residues contributing to the resistance phenotype are coloured yellow, and the rest are purple. Adapted from 4UMN.
Figure Legend Snippet: Projection of HDM2-C8 mutants onto HDM2 N-terminal domain structure Shown is structure of M06 stapled peptide (cyan, grey) bound to HDM2-M62A N-terminal domain (pink). The residues contributing to the resistance phenotype are coloured yellow, and the rest are purple. Adapted from 4UMN.

Techniques Used:

Stapled peptide recapitulates key p53 signature residues that interact with HDM2 N-terminal domain Overlay of p53 peptide (green) and MO6 stapled peptide (cyan, with staple moiety in grey) when bound to HDM2 N-terminal domains. The relative configurations of the key F19 and W23 residues are conserved, with some deviation in the orientation of L26. Adapted from 1YCR and 4UMN. Shown below is alignment of p53 peptide, PM2 and MO6, with signature residues shaded and residue differing between PM2 and MO6 highlighted in red.
Figure Legend Snippet: Stapled peptide recapitulates key p53 signature residues that interact with HDM2 N-terminal domain Overlay of p53 peptide (green) and MO6 stapled peptide (cyan, with staple moiety in grey) when bound to HDM2 N-terminal domains. The relative configurations of the key F19 and W23 residues are conserved, with some deviation in the orientation of L26. Adapted from 1YCR and 4UMN. Shown below is alignment of p53 peptide, PM2 and MO6, with signature residues shaded and residue differing between PM2 and MO6 highlighted in red.

Techniques Used:

The staple moiety makes favourable contacts with F55 in the N-terminal domain of HDM2 Left: Overlay of p53 peptide (green) and MO6 stapled peptide (cyan, staple in gray) bound to HDM2 N-terminal domain (magenta, surface representation). The positions of the F55 and I99 residues are indicated in yellow. Right: Same as left, highlighting the relative orientation of the p53 peptide and MO6 stapled peptide L26 side chains in respect to I99 in HDM2.
Figure Legend Snippet: The staple moiety makes favourable contacts with F55 in the N-terminal domain of HDM2 Left: Overlay of p53 peptide (green) and MO6 stapled peptide (cyan, staple in gray) bound to HDM2 N-terminal domain (magenta, surface representation). The positions of the F55 and I99 residues are indicated in yellow. Right: Same as left, highlighting the relative orientation of the p53 peptide and MO6 stapled peptide L26 side chains in respect to I99 in HDM2.

Techniques Used:

Selected HDM2 variants display in vitro PM2-resistance phenotype A. In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to binding of p53 for indicated parental HDM2 variants and WT HDM2 (residues 1-125). Note: exposure time for HDM2 inputs is 8 hours and 1 second for all other panels. B. in vitro pull-down assay showing little impact upon reversion of the M62A mutation to PM2 binding in HDM2-C8 (residues1-125). Blank indicates background p53 binding in absence of HDM2. Note: exposure time for HDM2 inputs (developed using film) is 8 hours and 10 second for all other panels (digitally acquired).
Figure Legend Snippet: Selected HDM2 variants display in vitro PM2-resistance phenotype A. In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to binding of p53 for indicated parental HDM2 variants and WT HDM2 (residues 1-125). Note: exposure time for HDM2 inputs is 8 hours and 1 second for all other panels. B. in vitro pull-down assay showing little impact upon reversion of the M62A mutation to PM2 binding in HDM2-C8 (residues1-125). Blank indicates background p53 binding in absence of HDM2. Note: exposure time for HDM2 inputs (developed using film) is 8 hours and 10 second for all other panels (digitally acquired).

Techniques Used: In Vitro, Pull Down Assay, Inhibition, Binding Assay, Mutagenesis

Sequence alignment of selectant HDM2 clones showing PM2 resistance Mutated residues are highlighted in red, with those present in more than one selectant boxed. The M62A mutation (green) was incorporated into the selection library.
Figure Legend Snippet: Sequence alignment of selectant HDM2 clones showing PM2 resistance Mutated residues are highlighted in red, with those present in more than one selectant boxed. The M62A mutation (green) was incorporated into the selection library.

Techniques Used: Sequencing, Clone Assay, Mutagenesis, Selection

PM2 resistance comes at cost of reduced interaction with p53 In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to indicated point mutants (asterisk) derived from HDM2-C8 (residues 1-125). The point mutants L34P, F55L, Y60C and C77R also show reduced inhibition by Nutlin (10μM). Blank indicates background p53 binding in absence of HDM2. Note: exposure time for HDM2 inputs is 8 hours (developed using film) and 3 minutes for all other panels (digitally acquired).
Figure Legend Snippet: PM2 resistance comes at cost of reduced interaction with p53 In vitro pull-down assay showing reduced inhibition by PM2 (10 μM) to indicated point mutants (asterisk) derived from HDM2-C8 (residues 1-125). The point mutants L34P, F55L, Y60C and C77R also show reduced inhibition by Nutlin (10μM). Blank indicates background p53 binding in absence of HDM2. Note: exposure time for HDM2 inputs is 8 hours (developed using film) and 3 minutes for all other panels (digitally acquired).

Techniques Used: In Vitro, Pull Down Assay, Inhibition, Derivative Assay, Binding Assay

PM2 shows reduced inhibition of selected HDM2 variants in p53/MDM2-null DKO cells A. Wild-type and HDM2-C8 (full-length) were co-transfected with p53 and p53-reporter gene, and reporter gene activity measured in the presence of PM2 (20 μM) or Nutlin (10 μM). p53 activity is denoted as percentage of that observed when p53-alone co-transfected with reporter gene. Shown below are Western blots indicating expression levels of HDM2 variants and p53 cotransfected into DKO cells. B and C. As in ‘A’, with wild-type HDM2 and indicated HDM2-C8 derived point mutants (full length) co-transfected into DKO cells. p53 activity is denoted as percentage of that observed when p53-alone co-transfected with reporter gene. Shown below are Western blots indicating expression levels of HDM2 variants and p53 cotransfected into DKO cells.
Figure Legend Snippet: PM2 shows reduced inhibition of selected HDM2 variants in p53/MDM2-null DKO cells A. Wild-type and HDM2-C8 (full-length) were co-transfected with p53 and p53-reporter gene, and reporter gene activity measured in the presence of PM2 (20 μM) or Nutlin (10 μM). p53 activity is denoted as percentage of that observed when p53-alone co-transfected with reporter gene. Shown below are Western blots indicating expression levels of HDM2 variants and p53 cotransfected into DKO cells. B and C. As in ‘A’, with wild-type HDM2 and indicated HDM2-C8 derived point mutants (full length) co-transfected into DKO cells. p53 activity is denoted as percentage of that observed when p53-alone co-transfected with reporter gene. Shown below are Western blots indicating expression levels of HDM2 variants and p53 cotransfected into DKO cells.

Techniques Used: Inhibition, Transfection, Activity Assay, Western Blot, Expressing, Derivative Assay

Selection of PM2-resistant HDM2 by in vitro compartmentalisation 1. HDM2 expression constructs (blue and purple bars) appended with 2CONA p53 response element (“RE”, green) and HA-tag coding sequence (black) and p53 expression construct (red bar) are segregated into aqueous emulsion compartments along with PM2 (cyan helix). Protein expression occurs within compartments. PM2 inhibition of HDM2 results in no HDM2-p53-DNA complex formation (left bubble), whereas resistant HDM2 can form the complex (right bubble). 2–3 . The emulsion is broken and complexes captured with anti-HA antibody. DNA encoding resistant HDM2 variants is amplified by PCR. 4. Selectants further evaluated by secondary pull-down assay or subjected to further rounds of selection.
Figure Legend Snippet: Selection of PM2-resistant HDM2 by in vitro compartmentalisation 1. HDM2 expression constructs (blue and purple bars) appended with 2CONA p53 response element (“RE”, green) and HA-tag coding sequence (black) and p53 expression construct (red bar) are segregated into aqueous emulsion compartments along with PM2 (cyan helix). Protein expression occurs within compartments. PM2 inhibition of HDM2 results in no HDM2-p53-DNA complex formation (left bubble), whereas resistant HDM2 can form the complex (right bubble). 2–3 . The emulsion is broken and complexes captured with anti-HA antibody. DNA encoding resistant HDM2 variants is amplified by PCR. 4. Selectants further evaluated by secondary pull-down assay or subjected to further rounds of selection.

Techniques Used: Selection, In Vitro, Expressing, Construct, Sequencing, Inhibition, Amplification, Polymerase Chain Reaction, Pull Down Assay

17) Product Images from "Comparative Cell Biology and Evolution of Annexins in Diplomonads"

Article Title: Comparative Cell Biology and Evolution of Annexins in Diplomonads

Journal: mSphere

doi: 10.1128/mSphere.00032-15

Membrane- and phospholipid-binding characteristics of S. salmonicida annexins. Membrane fractionation of transfected cell lines was performed to enrich for integral membrane proteins. (A) The presence of the annexins in the resulting hydrophilic (cytoplasmic) and hydrophobic (membrane) fractions was analyzed by Western blotting with the HA epitope tag. The lower two panel rows show the corresponding loading controls with the Bio-Rad stain-free TGX system. Membrane strips containing 15 biologically active lipids were used to investigate the phospholipid-binding preferences of purified recombinant annexin 3 (B), annexin 5 (C), and alpha-14 giardin (D). Abbreviations: DAG, diacylglycerol; PA, phosphatidic acid; PE, phosphatidylethanolamine; PC, phosphatidylcholine; PI, phosphatidylinositol; PtdIns(3,5)P 3 , phosphatidylinositol 3,5-triphosphate. Molecular sizes in kilodaltons are indicated to the left of the blots.
Figure Legend Snippet: Membrane- and phospholipid-binding characteristics of S. salmonicida annexins. Membrane fractionation of transfected cell lines was performed to enrich for integral membrane proteins. (A) The presence of the annexins in the resulting hydrophilic (cytoplasmic) and hydrophobic (membrane) fractions was analyzed by Western blotting with the HA epitope tag. The lower two panel rows show the corresponding loading controls with the Bio-Rad stain-free TGX system. Membrane strips containing 15 biologically active lipids were used to investigate the phospholipid-binding preferences of purified recombinant annexin 3 (B), annexin 5 (C), and alpha-14 giardin (D). Abbreviations: DAG, diacylglycerol; PA, phosphatidic acid; PE, phosphatidylethanolamine; PC, phosphatidylcholine; PI, phosphatidylinositol; PtdIns(3,5)P 3 , phosphatidylinositol 3,5-triphosphate. Molecular sizes in kilodaltons are indicated to the left of the blots.

Techniques Used: Binding Assay, Fractionation, Transfection, Western Blot, Staining, Purification, Recombinant

18) Product Images from "Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica"

Article Title: Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2016.01352

The binding activity of CjWRKY1 to the CYP80B2 promoter. (A) The oligonucleotide sequence used for the EMSA contains three repeats of W-box sequences (TGACT). (B) The in vitro binding activity of CjWRKY1 protein to the W-box DNA sequence motif was confirmed by EMSA analysis. EMSA was carried out with a purified GST-CjWRKY1 recombinant protein and a biotin-labeled probe. Arrows indicate the shifted bands corresponding to the protein-DNA complexes. (C) CjWRKY1 directly binds to the CYP80B2 promoter region in vivo . A ChIP assay was performed with anti-GFP antibodies. The left panel indicates the structure of the coding region of the CYP80B2 and the α -tubulin genes. Arrows indicate specific primer pairs used for PCR. The right panel shows PCR products from immunoprecipitated chromatin and input controls incubated without (-Ab) or with (+Ab) anti-GFP antibodies before immunoprecipitation.
Figure Legend Snippet: The binding activity of CjWRKY1 to the CYP80B2 promoter. (A) The oligonucleotide sequence used for the EMSA contains three repeats of W-box sequences (TGACT). (B) The in vitro binding activity of CjWRKY1 protein to the W-box DNA sequence motif was confirmed by EMSA analysis. EMSA was carried out with a purified GST-CjWRKY1 recombinant protein and a biotin-labeled probe. Arrows indicate the shifted bands corresponding to the protein-DNA complexes. (C) CjWRKY1 directly binds to the CYP80B2 promoter region in vivo . A ChIP assay was performed with anti-GFP antibodies. The left panel indicates the structure of the coding region of the CYP80B2 and the α -tubulin genes. Arrows indicate specific primer pairs used for PCR. The right panel shows PCR products from immunoprecipitated chromatin and input controls incubated without (-Ab) or with (+Ab) anti-GFP antibodies before immunoprecipitation.

Techniques Used: Binding Assay, Activity Assay, Sequencing, In Vitro, Purification, Recombinant, Labeling, In Vivo, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Immunoprecipitation, Incubation

19) Product Images from "A Major Role for Side-Chain Polyglutamine Hydrogen Bonding in Irreversible Ataxin-3 Aggregation"

Article Title: A Major Role for Side-Chain Polyglutamine Hydrogen Bonding in Irreversible Ataxin-3 Aggregation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0018789

Progress of the aggregation of AT3 variants. (A) Aggregation was monitored by measuring changes in ThT fluorescence of proteins incubated at 37°C at a 25 µM concentration in PBS, pH 7.2, and in the presence of 20 µM ThT. Fluorescence was recorded using a plate reader with values read every 30 min. Individual values are the mean of three independent determinations, with standard deviations never exceeding 5% of the mean value. Fluorescence is relative to the highest value, achieved at a 60 h-incubation. (B) Time course of oligomeric AT3 form appearance, as detected by dot blot. AT3 variants were incubated at 37°C in PBS, pH 7.2, for the times indicated. Samples were withdrawn, applied to an Immobilon membrane, immunodecorated using anti-oligomer, conformation-specific antibodies (19) and revealed using ECL Western blotting reagent.
Figure Legend Snippet: Progress of the aggregation of AT3 variants. (A) Aggregation was monitored by measuring changes in ThT fluorescence of proteins incubated at 37°C at a 25 µM concentration in PBS, pH 7.2, and in the presence of 20 µM ThT. Fluorescence was recorded using a plate reader with values read every 30 min. Individual values are the mean of three independent determinations, with standard deviations never exceeding 5% of the mean value. Fluorescence is relative to the highest value, achieved at a 60 h-incubation. (B) Time course of oligomeric AT3 form appearance, as detected by dot blot. AT3 variants were incubated at 37°C in PBS, pH 7.2, for the times indicated. Samples were withdrawn, applied to an Immobilon membrane, immunodecorated using anti-oligomer, conformation-specific antibodies (19) and revealed using ECL Western blotting reagent.

Techniques Used: Fluorescence, Incubation, Concentration Assay, Dot Blot, Western Blot

Kinetics of aggregation of AT3 variants monitored by FTIR spectroscopy. Second derivative spectra of AT3 variants were taken at different times of incubation in PBS at 37°C. Arrows point to increasing time.
Figure Legend Snippet: Kinetics of aggregation of AT3 variants monitored by FTIR spectroscopy. Second derivative spectra of AT3 variants were taken at different times of incubation in PBS at 37°C. Arrows point to increasing time.

Techniques Used: Spectroscopy, Incubation

FTIR spectra of freshly purified AT3 variants. Absorption spectra (dotted line) and their second derivatives (continuous line) in the amide I region of AT3 variants: JD (A), AT3Q24 (B), and AT3Q55 (C). Band assignment to the secondary structure components is indicated.
Figure Legend Snippet: FTIR spectra of freshly purified AT3 variants. Absorption spectra (dotted line) and their second derivatives (continuous line) in the amide I region of AT3 variants: JD (A), AT3Q24 (B), and AT3Q55 (C). Band assignment to the secondary structure components is indicated.

Techniques Used: Purification

20) Product Images from "xnd-1 Regulates the Global Recombination Landscape in C. elegans"

Article Title: xnd-1 Regulates the Global Recombination Landscape in C. elegans

Journal: Nature

doi: 10.1038/nature09429

xnd-1  is required for efficient DSB formation on the X chromosome. (a-c) Achiasmate chromosomes are observed at diakinesis in  xnd-1 . FISH probes mark Chromosomes V (yellow) and X (magenta); DNA is stained with DAPI, (green). (a) Six DAPI-staining bodies indicate that all chromosomes have recombined, (b) seven reveal the achiasmate X’s in  xnd-1  oocytes. (c) Quantification of achiasmate X frequency. Chromosome V was never achiasmate in wt or  xnd-1 . (d) Ionizing radiation (IR) rescues the CO defects of  xnd-1 . Quantification of IR rescue as assessed by the number of DAPI staining bodies at diakinesis 24 hrs post-irradiation. ( wt  −/+ IR, N=91, 82;  spo-11  −/+ IR, N=73, 100;  xnd-1  −/+ IR, N= 190, 157;  him-8  −/+ IR, N=83, 65). (e) Fewer RAD-51 foci are observed on the X chromosome (white circles) in  xnd-1 .  rad-54(RNAi)  treated animals  9  were dissected and germlines co-stained for DNA (green), HTZ-1 (which marks autosomes  17 , yellow), and the DNA repair protein, RAD-51 (magenta), which acts as a marker of DSBs  9 ). The percentage of nuclei in which RAD-51 foci were observed on the X was quantified ( wt , N=369;  xnd-1 , N=391).
Figure Legend Snippet: xnd-1 is required for efficient DSB formation on the X chromosome. (a-c) Achiasmate chromosomes are observed at diakinesis in xnd-1 . FISH probes mark Chromosomes V (yellow) and X (magenta); DNA is stained with DAPI, (green). (a) Six DAPI-staining bodies indicate that all chromosomes have recombined, (b) seven reveal the achiasmate X’s in xnd-1 oocytes. (c) Quantification of achiasmate X frequency. Chromosome V was never achiasmate in wt or xnd-1 . (d) Ionizing radiation (IR) rescues the CO defects of xnd-1 . Quantification of IR rescue as assessed by the number of DAPI staining bodies at diakinesis 24 hrs post-irradiation. ( wt −/+ IR, N=91, 82; spo-11 −/+ IR, N=73, 100; xnd-1 −/+ IR, N= 190, 157; him-8 −/+ IR, N=83, 65). (e) Fewer RAD-51 foci are observed on the X chromosome (white circles) in xnd-1 . rad-54(RNAi) treated animals 9 were dissected and germlines co-stained for DNA (green), HTZ-1 (which marks autosomes 17 , yellow), and the DNA repair protein, RAD-51 (magenta), which acts as a marker of DSBs 9 ). The percentage of nuclei in which RAD-51 foci were observed on the X was quantified ( wt , N=369; xnd-1 , N=391).

Techniques Used: Fluorescence In Situ Hybridization, Staining, Irradiation, Marker

xnd-1  is needed for the normal recombination landscape in  C. elegans . (a) C05D2.5 was identified by its increase in the number of recombinant progeny with the phenotype of the middle of three genetic markers, either  unc-45 dpy-18 unc-64  ( wt , n=8750, std. dev= 0.06;  xnd-1 , n=3980, std. dev= 0.15) (i) or  dpy-1 lon-1 dpy-18  ( wt , n=2229, std. dev= 0;  xnd-1 , n=1863, std dev= 0.21) (ii) Error bars represent the standard deviation from three or two independent experiments, respectively. (b) Chromosome I recombination maps for wt and  xnd-1  oocytes (top) and sperm (bottom). (c) X chromosome recombination maps for wt and  xnd-1  oocytes (data for b,c are found in Supplementary Tables   1 -  3 ). Genetic and physical markers are shown above and below the graphic representation of each chromosome, respectively. Boxes represent the relative map size for each interval as determined by SNP analysis (see Methods). Significant differences between wt and  xnd-1  are marked (*p
Figure Legend Snippet: xnd-1 is needed for the normal recombination landscape in C. elegans . (a) C05D2.5 was identified by its increase in the number of recombinant progeny with the phenotype of the middle of three genetic markers, either unc-45 dpy-18 unc-64 ( wt , n=8750, std. dev= 0.06; xnd-1 , n=3980, std. dev= 0.15) (i) or dpy-1 lon-1 dpy-18 ( wt , n=2229, std. dev= 0; xnd-1 , n=1863, std dev= 0.21) (ii) Error bars represent the standard deviation from three or two independent experiments, respectively. (b) Chromosome I recombination maps for wt and xnd-1 oocytes (top) and sperm (bottom). (c) X chromosome recombination maps for wt and xnd-1 oocytes (data for b,c are found in Supplementary Tables 1 - 3 ). Genetic and physical markers are shown above and below the graphic representation of each chromosome, respectively. Boxes represent the relative map size for each interval as determined by SNP analysis (see Methods). Significant differences between wt and xnd-1 are marked (*p

Techniques Used: Recombinant, Standard Deviation

XND-1 is an autosomal protein that regulates X chromosome crossing over. (a) Anti-XND-1 antibody staining of a wt hermaphrodite germline. (b) Close-up of wt nuclei reveals the absence of staining on one chromosome (yellow arrowheads). (c) Co-staining of wt pachytene nuclei with anti-XND-1 and anti-H4K12Ac reveals that these proteins are coincident, indicating that XND-1 is enriched on autosomes. A yellow arrowhead indicates the unstained X. (d) Localization of XND-1 is independent of the X chromosome silencing gene  mes-2 . XND-1 antibody staining in  mes-2  (M-Z-) mutants with rare pachytene nuclei reveals normal XND-1 localization (X marked by white arrowhead). (e) Activating HPTMs remain excluded from the X in  xnd-1 mutants (yellow arrowheads). Histone H4K12Ac (magenta) is enriched on autosomes in wt (top) and  xnd-1  (bottom). (f) Suppression of  xnd-1  HIM phenotype by  mes-2(bn11)  and  mes-3(RNAi  ) ( xnd -1, n =  > 8000;  mes-2 =  > 2000;  mes-2; xnd-1 , n=733;  GFP(RNAi) , n= 192;  mes-3RNAi) , n= 283). Error bars represent standard deviation from at least three experiments.
Figure Legend Snippet: XND-1 is an autosomal protein that regulates X chromosome crossing over. (a) Anti-XND-1 antibody staining of a wt hermaphrodite germline. (b) Close-up of wt nuclei reveals the absence of staining on one chromosome (yellow arrowheads). (c) Co-staining of wt pachytene nuclei with anti-XND-1 and anti-H4K12Ac reveals that these proteins are coincident, indicating that XND-1 is enriched on autosomes. A yellow arrowhead indicates the unstained X. (d) Localization of XND-1 is independent of the X chromosome silencing gene mes-2 . XND-1 antibody staining in mes-2 (M-Z-) mutants with rare pachytene nuclei reveals normal XND-1 localization (X marked by white arrowhead). (e) Activating HPTMs remain excluded from the X in xnd-1 mutants (yellow arrowheads). Histone H4K12Ac (magenta) is enriched on autosomes in wt (top) and xnd-1 (bottom). (f) Suppression of xnd-1 HIM phenotype by mes-2(bn11) and mes-3(RNAi ) ( xnd -1, n = > 8000; mes-2 = > 2000; mes-2; xnd-1 , n=733; GFP(RNAi) , n= 192; mes-3RNAi) , n= 283). Error bars represent standard deviation from at least three experiments.

Techniques Used: Staining, Standard Deviation

21) Product Images from "A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis"

Article Title: A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis

Journal: BMC Genomics

doi: 10.1186/1471-2164-11-457

MptpB and related phosphatases have both protein phosphatase and lipid phosphatase activity . ( A ) Specific activity (SA) for His-MptpB WT, Lmo1800 WT, Lmo1935 WT, His-LM1 and His-TbPTP1 [ 15 ] towards phosphorylated peptide substrates tested. ( B ) Specific activity of the same proteins towards PI substrates is shown. None of the phosphatases had activity on PI(3,4)P2, PI(4,5)P2 or PI(3,4,5)P3. Error bars indicate SEM.
Figure Legend Snippet: MptpB and related phosphatases have both protein phosphatase and lipid phosphatase activity . ( A ) Specific activity (SA) for His-MptpB WT, Lmo1800 WT, Lmo1935 WT, His-LM1 and His-TbPTP1 [ 15 ] towards phosphorylated peptide substrates tested. ( B ) Specific activity of the same proteins towards PI substrates is shown. None of the phosphatases had activity on PI(3,4)P2, PI(4,5)P2 or PI(3,4,5)P3. Error bars indicate SEM.

Techniques Used: Activity Assay

22) Product Images from "Structure-function analysis of the EF-hand protein centrin-2 for its intracellular localization and nucleotide excision repair"

Article Title: Structure-function analysis of the EF-hand protein centrin-2 for its intracellular localization and nucleotide excision repair

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt434

The C-terminal half of centrin-2 is necessary and sufficient for interaction with XPC. ( A ) Purified GST-centrin-2 (WT, N or C) and the FLAG-XPC/RAD23B-His complex (0.1 µg each) were subjected to SDS–PAGE followed by silver staining. ( B ) Purified GST-centrin-2 (WT, N or C) or GST alone (as a negative control) was incubated with FLAG-XPC/RAD23B-His and then pulled down with anti-FLAG antibody beads. Two different amounts (4 and 8%) of the precipitated proteins were subjected to immunoblotting with the indicated antibodies. ( C ) FLAG-XPC and HA-centrin-2 were transiently expressed in XP4PASV cells and solubilized proteins were subjected to immunoprecipitation with anti-FLAG and anti-HA (3F10) antibodies as indicated. The precipitated proteins, along with 1% of the input extracts, were subjected to immunoblotting with anti-XPC and anti-HA (12CA5) antibodies, respectively. ( D ) FLAG-XPC and HA-centrin-2 point mutants (M1–M4) were transiently expressed in XP4PASV cells and subjected to immunoprecipitation with anti-FLAG antibody. The amino acids changed to alanines in each mutant are as follows: M1, F113A/L133A; M2, F113A/M145A; M3, L112A/F113A/L133A; M4. L112A/F113A/L133A/M145A. For lanes 10–14, the amounts of centrin-2 pulled down were quantified, normalized with the amounts of XPC and expressed as relative values (the value of WT centrin-2 was set as 1).
Figure Legend Snippet: The C-terminal half of centrin-2 is necessary and sufficient for interaction with XPC. ( A ) Purified GST-centrin-2 (WT, N or C) and the FLAG-XPC/RAD23B-His complex (0.1 µg each) were subjected to SDS–PAGE followed by silver staining. ( B ) Purified GST-centrin-2 (WT, N or C) or GST alone (as a negative control) was incubated with FLAG-XPC/RAD23B-His and then pulled down with anti-FLAG antibody beads. Two different amounts (4 and 8%) of the precipitated proteins were subjected to immunoblotting with the indicated antibodies. ( C ) FLAG-XPC and HA-centrin-2 were transiently expressed in XP4PASV cells and solubilized proteins were subjected to immunoprecipitation with anti-FLAG and anti-HA (3F10) antibodies as indicated. The precipitated proteins, along with 1% of the input extracts, were subjected to immunoblotting with anti-XPC and anti-HA (12CA5) antibodies, respectively. ( D ) FLAG-XPC and HA-centrin-2 point mutants (M1–M4) were transiently expressed in XP4PASV cells and subjected to immunoprecipitation with anti-FLAG antibody. The amino acids changed to alanines in each mutant are as follows: M1, F113A/L133A; M2, F113A/M145A; M3, L112A/F113A/L133A; M4. L112A/F113A/L133A/M145A. For lanes 10–14, the amounts of centrin-2 pulled down were quantified, normalized with the amounts of XPC and expressed as relative values (the value of WT centrin-2 was set as 1).

Techniques Used: Purification, SDS Page, Silver Staining, Negative Control, Incubation, Immunoprecipitation, Mutagenesis

23) Product Images from "Nuclear Exportin Receptor CAS Regulates the NPI-1-Mediated Nuclear Import of HIV-1 Vpr"

Article Title: Nuclear Exportin Receptor CAS Regulates the NPI-1-Mediated Nuclear Import of HIV-1 Vpr

Journal: PLoS ONE

doi: 10.1371/journal.pone.0027815

CAS disrupts the interaction between Vpr and NPI-1. (A) Twenty-five pmol of purified recombinant RanQ69L and CAS were resolved by 10% SDS-PAGE and stained with CBB. (B) Glutathione-Sepharose beads coupled with the GST-Impα isoforms, Rch1, Qip1 and NPI-1 (each 25 pmol) or GST (25 pmol), were incubated with mRFP-Vpr, Q69LRanGTP (25 pmol) and/or CAS protein (5 and 50 pmol, respectively). The bound fractions of mRFP-Vpr and mRFP were analyzed by immunoblotting with anti-Flag M2 MAb. (C) The immunoblots of mRFP-Vpr binding were analyzed by densitometry and each sample was normalized to the Impα isoforms without CAS protein. Each column and error bar represents the means ± SD of results from three experiments. The asterisk* represents a p -value of
Figure Legend Snippet: CAS disrupts the interaction between Vpr and NPI-1. (A) Twenty-five pmol of purified recombinant RanQ69L and CAS were resolved by 10% SDS-PAGE and stained with CBB. (B) Glutathione-Sepharose beads coupled with the GST-Impα isoforms, Rch1, Qip1 and NPI-1 (each 25 pmol) or GST (25 pmol), were incubated with mRFP-Vpr, Q69LRanGTP (25 pmol) and/or CAS protein (5 and 50 pmol, respectively). The bound fractions of mRFP-Vpr and mRFP were analyzed by immunoblotting with anti-Flag M2 MAb. (C) The immunoblots of mRFP-Vpr binding were analyzed by densitometry and each sample was normalized to the Impα isoforms without CAS protein. Each column and error bar represents the means ± SD of results from three experiments. The asterisk* represents a p -value of

Techniques Used: Purification, Recombinant, SDS Page, Staining, Incubation, Western Blot, Binding Assay

24) Product Images from "Mass Spectrometric Analysis of Ehrlichia chaffeensis Tandem Repeat Proteins Reveals Evidence of Phosphorylation and Absence of Glycosylation"

Article Title: Mass Spectrometric Analysis of Ehrlichia chaffeensis Tandem Repeat Proteins Reveals Evidence of Phosphorylation and Absence of Glycosylation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0009552

EDC modification of native and recombinant E. chaffeensis TRP47. ( A ) Western immunoblot of native TRP47 detected with rabbit anti-TRP47 serum. Lane 1, molecular mass standards; lane 2, unmodified native TRP47 (2.5 µg); lane 3, EDC-modified TRP47 (2.5 µg). ( B ) Schematic representation of TRP47 showing amino-terminal (N), tandem repeats (TR), and carboxy-terminal (C) regions with predicted molecular weight and pI of native protein, also represented are the recombinant GST-NterTRP47 and GST-CterTRP47. ( C ) Coomassie blue staining of proteins resolved by SDS-PAGE, 1, molecular mass standards; lane 2, unmodified GST-only (2.5 µg); lane 3, EDC-modified GST-only (2.5 µg); lane 4, unmodified GST-TRP47 (2.5 µg); lane 5, EDC-modified GST-TRP47 (2.5 µg); lane 6, unmodified GST-NterTRP47 (1.5 µg); lane 7, EDC-modified GST-NterTRP47 (1.5 µg); lane 8, unmodified GST-CterTRP47 (2.5 µg); lane 9, EDC-modified GST-CterTRP47 in excess of ethanolamine. (−), unmodified; (+), EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide)-modified; arrow, indicates the EDC modified protein band; aa, amino acids; MW, molecular weight; and pI, isoelectric potential.
Figure Legend Snippet: EDC modification of native and recombinant E. chaffeensis TRP47. ( A ) Western immunoblot of native TRP47 detected with rabbit anti-TRP47 serum. Lane 1, molecular mass standards; lane 2, unmodified native TRP47 (2.5 µg); lane 3, EDC-modified TRP47 (2.5 µg). ( B ) Schematic representation of TRP47 showing amino-terminal (N), tandem repeats (TR), and carboxy-terminal (C) regions with predicted molecular weight and pI of native protein, also represented are the recombinant GST-NterTRP47 and GST-CterTRP47. ( C ) Coomassie blue staining of proteins resolved by SDS-PAGE, 1, molecular mass standards; lane 2, unmodified GST-only (2.5 µg); lane 3, EDC-modified GST-only (2.5 µg); lane 4, unmodified GST-TRP47 (2.5 µg); lane 5, EDC-modified GST-TRP47 (2.5 µg); lane 6, unmodified GST-NterTRP47 (1.5 µg); lane 7, EDC-modified GST-NterTRP47 (1.5 µg); lane 8, unmodified GST-CterTRP47 (2.5 µg); lane 9, EDC-modified GST-CterTRP47 in excess of ethanolamine. (−), unmodified; (+), EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide)-modified; arrow, indicates the EDC modified protein band; aa, amino acids; MW, molecular weight; and pI, isoelectric potential.

Techniques Used: Modification, Recombinant, Western Blot, Molecular Weight, Staining, SDS Page

25) Product Images from "Tandem UIMs confer Lys48 ubiquitin chain substrate preference to deubiquitinase USP25"

Article Title: Tandem UIMs confer Lys48 ubiquitin chain substrate preference to deubiquitinase USP25

Journal: Scientific Reports

doi: 10.1038/srep45037

Ubiquitin chain binding features of UIMs in USP25. ( A ) Schematic structures of GST-USP25 UIM fusion proteins used in ( B , C ) are shown. The GST-USP37 UIM fusion protein was used as a positive control. ( B , C ) Indicated GST-UIM fusion proteins illustrated in ( A ) were immobilized on glutathione beads and incubated with indicated concentrations of Lys48 (K48)- or Lys63 (K63)-linked tetra-ubiquitin ( B ) or ubiquitin oligomers (mixture of dimer-heptamer) ( C ). After washing the beads, bound ubiquitin chains were detected by immunoblotting with anti-ubiquitin antibody (top). The amounts of the GST-fusion protein used in the experiments were assessed by staining with Ponceau S (bottom). ( D , E ) Indicated Flag-tagged USP25 proteins were immunopurified from the “hot-lysis” lysates of transfected HEK293T cells, immobilized on anti-Flag antibody-conjugated beads, and incubated with Lys48 (K48)- or Lys63 (K63)-linked ubiquitin oligomers (mixture of dimer-heptamer). After washing the beads, bound ubiquitin chains were detected by immunoblotting with anti-ubiquitin antibody (top). The amounts of Flag-USP25 proteins used in the experiments were assessed by anti-Flag immunoblotting (bottom).
Figure Legend Snippet: Ubiquitin chain binding features of UIMs in USP25. ( A ) Schematic structures of GST-USP25 UIM fusion proteins used in ( B , C ) are shown. The GST-USP37 UIM fusion protein was used as a positive control. ( B , C ) Indicated GST-UIM fusion proteins illustrated in ( A ) were immobilized on glutathione beads and incubated with indicated concentrations of Lys48 (K48)- or Lys63 (K63)-linked tetra-ubiquitin ( B ) or ubiquitin oligomers (mixture of dimer-heptamer) ( C ). After washing the beads, bound ubiquitin chains were detected by immunoblotting with anti-ubiquitin antibody (top). The amounts of the GST-fusion protein used in the experiments were assessed by staining with Ponceau S (bottom). ( D , E ) Indicated Flag-tagged USP25 proteins were immunopurified from the “hot-lysis” lysates of transfected HEK293T cells, immobilized on anti-Flag antibody-conjugated beads, and incubated with Lys48 (K48)- or Lys63 (K63)-linked ubiquitin oligomers (mixture of dimer-heptamer). After washing the beads, bound ubiquitin chains were detected by immunoblotting with anti-ubiquitin antibody (top). The amounts of Flag-USP25 proteins used in the experiments were assessed by anti-Flag immunoblotting (bottom).

Techniques Used: Binding Assay, Positive Control, Incubation, Staining, Lysis, Transfection

UIM-dependent USP25 binding to endogenous ubiquitin-protein conjugates. ( A ) A schematic domain structure of human USP25 and the sequence alignment of UIM1 and UIM2, together with the consensus UIM sequence, are shown. The Ala/Val and Ser residues indicated with a dot in the consensus sequence were replaced by Gly and Ala, respectively, in the mutants shown in ( B ). ( B ) USP25 mutants lacking functional UIMs, UBA domain, and catalytic activity, used in this study are shown. Asterisks indicate the point mutations in UIMs introduced in each mutant. CS indicates a replacement of Cys 178 to Ser in the Cys-box of the catalytic core. ( C ) HEK293T cells were transfected with the indicated Flag-USP25 constructs. Their lysates were immunoprecipitated (IP) with anti-Flag antibody, and immunoblotted (IB) with anti-ubiquitin (Ub) and anti-Flag antibodies. IgG-H: IgG heavy chain used for immunoprecipitation; asterisk: non-specific band. ( D , E ) Lysates of HEK293T cells transfected with HA-tagged ubiquitin K48R (K48R) or ubiquitin K63R (K63R) were mixed with the lysate of HEK293T cells transfected with Flag-USP25 CS . The mixed lysates were immunoprecipitated (IP) with anti-Flag ( D ) or anti-HA ( E ) antibody, and immunoblotted (IB) with indicated antibodies.
Figure Legend Snippet: UIM-dependent USP25 binding to endogenous ubiquitin-protein conjugates. ( A ) A schematic domain structure of human USP25 and the sequence alignment of UIM1 and UIM2, together with the consensus UIM sequence, are shown. The Ala/Val and Ser residues indicated with a dot in the consensus sequence were replaced by Gly and Ala, respectively, in the mutants shown in ( B ). ( B ) USP25 mutants lacking functional UIMs, UBA domain, and catalytic activity, used in this study are shown. Asterisks indicate the point mutations in UIMs introduced in each mutant. CS indicates a replacement of Cys 178 to Ser in the Cys-box of the catalytic core. ( C ) HEK293T cells were transfected with the indicated Flag-USP25 constructs. Their lysates were immunoprecipitated (IP) with anti-Flag antibody, and immunoblotted (IB) with anti-ubiquitin (Ub) and anti-Flag antibodies. IgG-H: IgG heavy chain used for immunoprecipitation; asterisk: non-specific band. ( D , E ) Lysates of HEK293T cells transfected with HA-tagged ubiquitin K48R (K48R) or ubiquitin K63R (K63R) were mixed with the lysate of HEK293T cells transfected with Flag-USP25 CS . The mixed lysates were immunoprecipitated (IP) with anti-Flag ( D ) or anti-HA ( E ) antibody, and immunoblotted (IB) with indicated antibodies.

Techniques Used: Binding Assay, Sequencing, Functional Assay, Activity Assay, Mutagenesis, Transfection, Construct, Immunoprecipitation

Ubiquitin chain-binding preference of UIMs determines ubiquitin chain substrate preference of USP25 catalytic activity. ( A ) Full-length WT USP25 and its mutants indicated in Fig. 4A were immunopurified from transfected HEK293T cells and detected by Coomassie staining as in Fig. 3A . ( B ) USP25 proteins prepared in ( A ) were incubated with Lys48- or Lys63-linked tetra-ubiquitin (Ub4) for 10 min at 37 °C. The reaction products were separated by SDS-PAGE, and ubiquitin oligomers (Ub2, Ub3) and mono-ubiquitin (Ub1) were detected by silver staining. ( C ) Schematic model for the role of tandem UIMs in USP25. By preferentially binding to the Lys48-linked poly-ubiquitin moiety, the tandem UIMs in USP25 hold Lys48 polyubiquitinated substrate proteins in close proximity to the catalytic core (Cys- and His-boxes), thereby conferring the substrate preference toward Lys48 polyubiquitinated proteins.
Figure Legend Snippet: Ubiquitin chain-binding preference of UIMs determines ubiquitin chain substrate preference of USP25 catalytic activity. ( A ) Full-length WT USP25 and its mutants indicated in Fig. 4A were immunopurified from transfected HEK293T cells and detected by Coomassie staining as in Fig. 3A . ( B ) USP25 proteins prepared in ( A ) were incubated with Lys48- or Lys63-linked tetra-ubiquitin (Ub4) for 10 min at 37 °C. The reaction products were separated by SDS-PAGE, and ubiquitin oligomers (Ub2, Ub3) and mono-ubiquitin (Ub1) were detected by silver staining. ( C ) Schematic model for the role of tandem UIMs in USP25. By preferentially binding to the Lys48-linked poly-ubiquitin moiety, the tandem UIMs in USP25 hold Lys48 polyubiquitinated substrate proteins in close proximity to the catalytic core (Cys- and His-boxes), thereby conferring the substrate preference toward Lys48 polyubiquitinated proteins.

Techniques Used: Binding Assay, Activity Assay, Transfection, Staining, Incubation, SDS Page, Silver Staining

26) Product Images from "Chemorepulsion from the Quorum Signal Autoinducer-2 Promotes Helicobacter pylori Biofilm Dispersal"

Article Title: Chemorepulsion from the Quorum Signal Autoinducer-2 Promotes Helicobacter pylori Biofilm Dispersal

Journal: mBio

doi: 10.1128/mBio.00379-15

AI-2 chemotaxis requires two periplasmic binding proteins, AibA and AibB, that bind AI-2 independently. (A) Chemotaxis response of wild-type and Δ HPG27 _ 277 (Δ aibA ) and Δ HPG27 _ 431 (Δ aibB ) mutant H. pylori to brucella broth (BB10), 100 mM HCl, and 100 µM synthetic DPD (AI-2). Representative wet-mount images of bacterial cells (white dots) are shown. Formation of a barrier (marked by white arrows) indicates a chemotactic response. Bar, 200 µm. (B) In vitro AI-2 binding assay performed with purified proteins using a V. harveyi bioluminescence readout. Percentages of relative luminescence units (RLU) were normalized to an AI-2 positive control in each independent experiment. Error bars represent standard errors of the means of the results of comparisons of experimental data. Daggers indicate a significant ( P
Figure Legend Snippet: AI-2 chemotaxis requires two periplasmic binding proteins, AibA and AibB, that bind AI-2 independently. (A) Chemotaxis response of wild-type and Δ HPG27 _ 277 (Δ aibA ) and Δ HPG27 _ 431 (Δ aibB ) mutant H. pylori to brucella broth (BB10), 100 mM HCl, and 100 µM synthetic DPD (AI-2). Representative wet-mount images of bacterial cells (white dots) are shown. Formation of a barrier (marked by white arrows) indicates a chemotactic response. Bar, 200 µm. (B) In vitro AI-2 binding assay performed with purified proteins using a V. harveyi bioluminescence readout. Percentages of relative luminescence units (RLU) were normalized to an AI-2 positive control in each independent experiment. Error bars represent standard errors of the means of the results of comparisons of experimental data. Daggers indicate a significant ( P

Techniques Used: Chemotaxis Assay, Binding Assay, Mutagenesis, In Vitro, Purification, Positive Control

27) Product Images from "Gradient-reading and mechano-effector machinery for netrin-1-induced axon guidance"

Article Title: Gradient-reading and mechano-effector machinery for netrin-1-induced axon guidance

Journal: eLife

doi: 10.7554/eLife.34593

Generation of Shootin1 knockout mice. ( A ) Schematic representations of Shootin1 gene-targeting strategy. Upper panel, Shootin1 genomic locus including exons 1 and 2. Middle panel, targeting vector for homologous recombination. The targeting vector deleted a 509-base genomic sequence including exon one with the start codon (asterisk). Lower panel, targeted gene after homologous recombination. The probe used in Southern blot analysis is indicated. ( B ) Genomic DNAs isolated from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mouse tails were digested with EcoRV and then analyzed by Southern blot analysis using the probe. DNA fragments of 9.2 and 5.4 kb are expected for the wild-type allele and mutant allele, respectively. ( C ) Immunoblot analysis of brain lysates prepared from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mouse brains, at P0 using anti-shootin1a and anti-actin antibodies. ( D ) Coronal sections of mouse cerebral cortex at P0 from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mice labeled with anti-shootin1a antibody (red) and DAPI (blue). Bars: 500 μm.
Figure Legend Snippet: Generation of Shootin1 knockout mice. ( A ) Schematic representations of Shootin1 gene-targeting strategy. Upper panel, Shootin1 genomic locus including exons 1 and 2. Middle panel, targeting vector for homologous recombination. The targeting vector deleted a 509-base genomic sequence including exon one with the start codon (asterisk). Lower panel, targeted gene after homologous recombination. The probe used in Southern blot analysis is indicated. ( B ) Genomic DNAs isolated from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mouse tails were digested with EcoRV and then analyzed by Southern blot analysis using the probe. DNA fragments of 9.2 and 5.4 kb are expected for the wild-type allele and mutant allele, respectively. ( C ) Immunoblot analysis of brain lysates prepared from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mouse brains, at P0 using anti-shootin1a and anti-actin antibodies. ( D ) Coronal sections of mouse cerebral cortex at P0 from wild-type (+/+), heterozygous (+/-) and homozygous (-/-) mice labeled with anti-shootin1a antibody (red) and DAPI (blue). Bars: 500 μm.

Techniques Used: Knock-Out, Mouse Assay, Plasmid Preparation, Homologous Recombination, Sequencing, Southern Blot, Isolation, Mutagenesis, Labeling

28) Product Images from "The Coxsackievirus–Adenovirus Receptor Reveals Complex Homophilic and Heterophilic Interactions on Neural Cells"

Article Title: The Coxsackievirus–Adenovirus Receptor Reveals Complex Homophilic and Heterophilic Interactions on Neural Cells

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.5725-09.2010

Summary of molecular interactions of CAR. A , Scheme of putative molecular interactions of CAR on the neural plasma membrane (PM). Possible homophilic interactions of CAR are as follows: the D1–D1 self-association revealed by the U-shaped crystal structure most likely occurs between CAR polypeptides attached to the same plasma membrane. Additional binding and adhesion data suggest that homophilic interactions of CAR between two cells result from an antiparallel D1–D2 interaction. Heterophilic interactions to ECM glycoproteins are indicated by arrows. B , C , Proposed model for two mCAR-D1D2 monomers associated via two D1–D2 interfaces based on molecular docking simulations. Molecular contact surfaces corresponding to D1 and D2 are colored pink and green, respectively. Glycosylation sites (N106 and N201) and C termini are labeled. Normalized conservation score indicated by a color code. . C-term., C terminus; N-term., N terminus.
Figure Legend Snippet: Summary of molecular interactions of CAR. A , Scheme of putative molecular interactions of CAR on the neural plasma membrane (PM). Possible homophilic interactions of CAR are as follows: the D1–D1 self-association revealed by the U-shaped crystal structure most likely occurs between CAR polypeptides attached to the same plasma membrane. Additional binding and adhesion data suggest that homophilic interactions of CAR between two cells result from an antiparallel D1–D2 interaction. Heterophilic interactions to ECM glycoproteins are indicated by arrows. B , C , Proposed model for two mCAR-D1D2 monomers associated via two D1–D2 interfaces based on molecular docking simulations. Molecular contact surfaces corresponding to D1 and D2 are colored pink and green, respectively. Glycosylation sites (N106 and N201) and C termini are labeled. Normalized conservation score indicated by a color code. . C-term., C terminus; N-term., N terminus.

Techniques Used: Binding Assay, Labeling

Homophilic adhesion is mediated by D1 and D2. A–D , mCAR-D1 and mCAR-D2 are able to self-associate as revealed by analytical ultracentrifugation and represent a monomer–dimer equilibrium in solution. mCAR-D1 or mCAR-D2 binds to mCAR-D1D2. E–H , Chemical cross-linking of CAR polypeptides. Western blots of extracellular CAR domains probed with antibodies against chCAR or mCAR are shown. E , chCAR-D1D2-w/oFc migrates as a band at 30 kDa and a weaker band at 60 kDa, which represents a dimer. Cross-linking with BS 3 leads to an increase of dimers and to the occurrence of higher oligomers as well, and to a band at 40 kDa, which represents a heterodimer of chCAR-D1D2-w/oFc and mCAR-D2. F , Similar results are revealed when mCAR-D1D2 and chCAR-D2 are cross-linked. (mCAR-D1D2 migrates as a band of 25 kDa and a weak dimer band at 50 kDa.) G , chCAR-D2 and mCAR-D1 migrate as a monomer and dimer. (Note that the dimeric mCAR-D1 band at 30 kDa becomes less intense because of the binding chD2 that is not recognized by anti-mouse CAR.) H , mCAR domains are not cross-linked to the β1-LNS domain of rat neurexin. I , chCAR-expressing 3T3 cells adhered to immobilized mCAR-D1D2, chCAR-D1D2-w/oFc, mCAR-D1, or mCAR-D2. J , The attachment of CAR-expressing 3T3 cells was blocked by mCAR-D1 or mCAR-D2 in solution at a concentration of 0.5 mg/ml. K , Formation of aggregates of tectal cells was blocked by mCAR-D1 or mCAR-D2 in solution while the formation of neurites was promoted. Concentrations (Conc.) are indicated in milligrams per milliliters. Error bars indicate SEM. ** p
Figure Legend Snippet: Homophilic adhesion is mediated by D1 and D2. A–D , mCAR-D1 and mCAR-D2 are able to self-associate as revealed by analytical ultracentrifugation and represent a monomer–dimer equilibrium in solution. mCAR-D1 or mCAR-D2 binds to mCAR-D1D2. E–H , Chemical cross-linking of CAR polypeptides. Western blots of extracellular CAR domains probed with antibodies against chCAR or mCAR are shown. E , chCAR-D1D2-w/oFc migrates as a band at 30 kDa and a weaker band at 60 kDa, which represents a dimer. Cross-linking with BS 3 leads to an increase of dimers and to the occurrence of higher oligomers as well, and to a band at 40 kDa, which represents a heterodimer of chCAR-D1D2-w/oFc and mCAR-D2. F , Similar results are revealed when mCAR-D1D2 and chCAR-D2 are cross-linked. (mCAR-D1D2 migrates as a band of 25 kDa and a weak dimer band at 50 kDa.) G , chCAR-D2 and mCAR-D1 migrate as a monomer and dimer. (Note that the dimeric mCAR-D1 band at 30 kDa becomes less intense because of the binding chD2 that is not recognized by anti-mouse CAR.) H , mCAR domains are not cross-linked to the β1-LNS domain of rat neurexin. I , chCAR-expressing 3T3 cells adhered to immobilized mCAR-D1D2, chCAR-D1D2-w/oFc, mCAR-D1, or mCAR-D2. J , The attachment of CAR-expressing 3T3 cells was blocked by mCAR-D1 or mCAR-D2 in solution at a concentration of 0.5 mg/ml. K , Formation of aggregates of tectal cells was blocked by mCAR-D1 or mCAR-D2 in solution while the formation of neurites was promoted. Concentrations (Conc.) are indicated in milligrams per milliliters. Error bars indicate SEM. ** p

Techniques Used: Western Blot, Binding Assay, Expressing, Concentration Assay

Homophilic binding of CAR-D1D2 domains is enhanced by N -glycosylation, and CAR-expressing cells bind to immobilized mCAR-D1D2. A , Equilibrium sedimentation analysis of mCAR-D1D2. At concentrations up to 3.5 mg/ml, a monomer–dimer equilibrium is observed. B , mCAR-D1D2-w/oFc forms a monomer–dimer equilibrium. Note that in contrast to mCAR-D1D2, 50% of mCAR-D1D2-w/oFc are found in dimers at a concentration of 170 μg/ml. C , At concentrations up to 170 μg/ml, self-association of chCAR-D1D2-w/oFc is enhanced by N -glycosylation. chCAR-D1D2-w/oFc was deglycosylated by PNGaseF for 2 h at 37°C. Self-association was monitored at three different concentrations by equilibrium sedimentation. Underglycosylated chCAR-D1D2-w/oFc served as the control. D , Comparison of size exclusion chromatography profiles (Superdex 200 HR) of mCAR-D1D2 (black) and chCAR-D1D2-w/oFc (gray). Identical concentrations were applied (0.5 ml of 130 μg/ml at a flow rate of 0.5 ml/min in PBS). mCAR-D1D2 runs predominantly as a monomer, and chCAR-D1D2-w/oFc runs predominantly as a dimer. The positions of standard proteins are shown at the top. The calculated size difference between the peaks of mCAR-D1D2 and chCAR-D1D2-w/oFc is equivalent to the size of the mCAR-D1D2 monomer (25 kDa). The theoretical masses are 24378.5 and 24433.6 for chCAR-D1D2-w/oFc and mCAR-D1D2, respectively, and the measured mass of glycosylated chCAR-D1D2-w/oFc is 26081.5 as determined by mass spectrometry. E , F , chCAR-transfected NIH 3T3 cells attach to immobilized mCAR-D1D2 and spread while parental cells are unable to attach. Attachment is disturbed by species-specific antibodies to chCAR (Rb25 or mAb12–36). Culture dishes were precoated with 2 μl of mCAR-D1D2 (100 μg/ml) in their center. The border of the coated area is indicated by a broken line. Means ± SEM are normalized. * p
Figure Legend Snippet: Homophilic binding of CAR-D1D2 domains is enhanced by N -glycosylation, and CAR-expressing cells bind to immobilized mCAR-D1D2. A , Equilibrium sedimentation analysis of mCAR-D1D2. At concentrations up to 3.5 mg/ml, a monomer–dimer equilibrium is observed. B , mCAR-D1D2-w/oFc forms a monomer–dimer equilibrium. Note that in contrast to mCAR-D1D2, 50% of mCAR-D1D2-w/oFc are found in dimers at a concentration of 170 μg/ml. C , At concentrations up to 170 μg/ml, self-association of chCAR-D1D2-w/oFc is enhanced by N -glycosylation. chCAR-D1D2-w/oFc was deglycosylated by PNGaseF for 2 h at 37°C. Self-association was monitored at three different concentrations by equilibrium sedimentation. Underglycosylated chCAR-D1D2-w/oFc served as the control. D , Comparison of size exclusion chromatography profiles (Superdex 200 HR) of mCAR-D1D2 (black) and chCAR-D1D2-w/oFc (gray). Identical concentrations were applied (0.5 ml of 130 μg/ml at a flow rate of 0.5 ml/min in PBS). mCAR-D1D2 runs predominantly as a monomer, and chCAR-D1D2-w/oFc runs predominantly as a dimer. The positions of standard proteins are shown at the top. The calculated size difference between the peaks of mCAR-D1D2 and chCAR-D1D2-w/oFc is equivalent to the size of the mCAR-D1D2 monomer (25 kDa). The theoretical masses are 24378.5 and 24433.6 for chCAR-D1D2-w/oFc and mCAR-D1D2, respectively, and the measured mass of glycosylated chCAR-D1D2-w/oFc is 26081.5 as determined by mass spectrometry. E , F , chCAR-transfected NIH 3T3 cells attach to immobilized mCAR-D1D2 and spread while parental cells are unable to attach. Attachment is disturbed by species-specific antibodies to chCAR (Rb25 or mAb12–36). Culture dishes were precoated with 2 μl of mCAR-D1D2 (100 μg/ml) in their center. The border of the coated area is indicated by a broken line. Means ± SEM are normalized. * p

Techniques Used: Binding Assay, Expressing, Sedimentation, Concentration Assay, Size-exclusion Chromatography, Flow Cytometry, Mass Spectrometry, Transfection

29) Product Images from "Rab1 interacts with GOLPH3 and controls Golgi structure and contractile ring constriction during cytokinesis in Drosophila melanogaster"

Article Title: Rab1 interacts with GOLPH3 and controls Golgi structure and contractile ring constriction during cytokinesis in Drosophila melanogaster

Journal: Open Biology

doi: 10.1098/rsob.160257

GOLPH3 protein interacts with Rab1. ( a ) Protein extracts from wild-type testes were immunoprecipitated with antibodies against Drosophila GOLPH3 (rabbit G49139/77) and blotted with mouse anti-GOLPH3 S11047/1/56 or with mouse anti-Rab1 S12085a antibodies. Preimmune serum (G49139/1, from the same animal before the immunization) was used as control (ctrl). Two per cent of the total lysate and 1/3 of the immunoprecipitates were loaded and probed with the indicated antibody. Molecular masses are in kilodaltons. The Co-IP experiment was performed three times with identical results. ( b ) Yeast two-hybrid assay: yeast cells cotrasformed with GOLPH3 bait plasmid together with a prey plasmid containing the indicated coding sequence were grown in X-gal-containing plates. In the presence of the GOLPH3 bait, Rab1Q70L and wild-type Rab1 proteins induce LacZ expression (blue colour indicates positive interaction). Quantification of LacZ reporter expression (graph) induced with different combinations of bait and prey plasmids is shown. Error bars indicate s.e.m. Statistically significant differences are ** p
Figure Legend Snippet: GOLPH3 protein interacts with Rab1. ( a ) Protein extracts from wild-type testes were immunoprecipitated with antibodies against Drosophila GOLPH3 (rabbit G49139/77) and blotted with mouse anti-GOLPH3 S11047/1/56 or with mouse anti-Rab1 S12085a antibodies. Preimmune serum (G49139/1, from the same animal before the immunization) was used as control (ctrl). Two per cent of the total lysate and 1/3 of the immunoprecipitates were loaded and probed with the indicated antibody. Molecular masses are in kilodaltons. The Co-IP experiment was performed three times with identical results. ( b ) Yeast two-hybrid assay: yeast cells cotrasformed with GOLPH3 bait plasmid together with a prey plasmid containing the indicated coding sequence were grown in X-gal-containing plates. In the presence of the GOLPH3 bait, Rab1Q70L and wild-type Rab1 proteins induce LacZ expression (blue colour indicates positive interaction). Quantification of LacZ reporter expression (graph) induced with different combinations of bait and prey plasmids is shown. Error bars indicate s.e.m. Statistically significant differences are ** p

Techniques Used: Immunoprecipitation, Co-Immunoprecipitation Assay, Y2H Assay, Plasmid Preparation, Sequencing, Expressing

Relationship between Rab1, GOLPH3 and Cog7 proteins, at the Golgi stacks of interphase spermatocytes. ( a ) Interphase spermatocytes from wild-type, Cog7 z4495 /Df(3R)BSC861 ( Cog7 ) and sau z2217 / Df(2L)Exel7010 (GOLPH3) mutants were stained for Rab1, Lva and DNA. ( b ) Rab1 levels in the Golgi, quantified as mean fluorescence intensity of Rab1, in Lva-positive regions (Lva + ) (see Material and methods). In total, we examined N = 80 Golgi from Cog7 z4495 /Df(3R)BSC861 ( Cog7 ), N = 91 Golgi from sau z2217 / Df(2L)Exel7010 (GOLPH3) mutant interphase spermatocytes and N = 100 Golgi in wild-type interphase spermatocytes . The cells examined for Golgi analysis were randomly selected from three independent experiments. Error bars indicate s.e.m. values. *** p
Figure Legend Snippet: Relationship between Rab1, GOLPH3 and Cog7 proteins, at the Golgi stacks of interphase spermatocytes. ( a ) Interphase spermatocytes from wild-type, Cog7 z4495 /Df(3R)BSC861 ( Cog7 ) and sau z2217 / Df(2L)Exel7010 (GOLPH3) mutants were stained for Rab1, Lva and DNA. ( b ) Rab1 levels in the Golgi, quantified as mean fluorescence intensity of Rab1, in Lva-positive regions (Lva + ) (see Material and methods). In total, we examined N = 80 Golgi from Cog7 z4495 /Df(3R)BSC861 ( Cog7 ), N = 91 Golgi from sau z2217 / Df(2L)Exel7010 (GOLPH3) mutant interphase spermatocytes and N = 100 Golgi in wild-type interphase spermatocytes . The cells examined for Golgi analysis were randomly selected from three independent experiments. Error bars indicate s.e.m. values. *** p

Techniques Used: Staining, Fluorescence, Mutagenesis

GOLPH3 protein interacts with Rab1 and requires Rab1 for localization to the cleavage furrow. ( a ) Localization of GOLPH3 protein in dividing spermatocytes. Representative images of wild-type and omt/Df mutant spermatocytes stained for GOLPH3, α-tubulin (Tubulin) and DNA during mid-telophase and late telophase. ( N = 48 wild-type mid-late telophases; N = 44 omt / Df mutant mid-late telophase cells; the cells examined were from three independent experiments). ( b ) Knockdown of GOLPH3 protein in dividing spermatocytes from males expressing UAS::GOLPH3RNAi under the control of Bam-GAL4 (GOLPH3RNAi). Dividing spermatocytes were stained for GOLPH3, α-tubulin (tubulin) and DNA during mid-telophase. Note the defective central spindle caused by depletion of GOLPH3. ( c–f ) Proximity ligation assay (PLA) to visualize Rab1/GOLPH3 interaction in fixed spermatocytes. PLA with antibodies against Rab1 (mouse anti-Rab1 S12085a) and GOLPH3 (rabbit anti-GOLPH3 G49139/77) was used to test the interaction in interphase and telophase spermatocytes stained for DNA. Negative control experiments were performed with antibodies against Rab1 (mouse anti-Rab1 S12085a) and GOLPH3 (rabbit anti-GOLPH3 G49139/77) in testes from males expressing UAS::GOLPH3RNAi under the control of Bam-GAL4 . Knockdown of GOLPH3 was confirmed by parallel staining for GOLPH3 and tubulin of one testis from the same individual, as shown in ( b ). Arrowhead points to PLA signals at the cleavage site. Centriole staining (white arrows) by anti-GOLPH3 is not specific [ 23 ]. Scale bars, 10 µm. ( d , f ) Average number (±s.e.m.) of PLA dots per cell (see Material and methods for details), in telophase ( d ) and interphase spermatocytes ( f ) from either wild-type or GOLPH3 RNAi males. Statistically significant differences are *** p
Figure Legend Snippet: GOLPH3 protein interacts with Rab1 and requires Rab1 for localization to the cleavage furrow. ( a ) Localization of GOLPH3 protein in dividing spermatocytes. Representative images of wild-type and omt/Df mutant spermatocytes stained for GOLPH3, α-tubulin (Tubulin) and DNA during mid-telophase and late telophase. ( N = 48 wild-type mid-late telophases; N = 44 omt / Df mutant mid-late telophase cells; the cells examined were from three independent experiments). ( b ) Knockdown of GOLPH3 protein in dividing spermatocytes from males expressing UAS::GOLPH3RNAi under the control of Bam-GAL4 (GOLPH3RNAi). Dividing spermatocytes were stained for GOLPH3, α-tubulin (tubulin) and DNA during mid-telophase. Note the defective central spindle caused by depletion of GOLPH3. ( c–f ) Proximity ligation assay (PLA) to visualize Rab1/GOLPH3 interaction in fixed spermatocytes. PLA with antibodies against Rab1 (mouse anti-Rab1 S12085a) and GOLPH3 (rabbit anti-GOLPH3 G49139/77) was used to test the interaction in interphase and telophase spermatocytes stained for DNA. Negative control experiments were performed with antibodies against Rab1 (mouse anti-Rab1 S12085a) and GOLPH3 (rabbit anti-GOLPH3 G49139/77) in testes from males expressing UAS::GOLPH3RNAi under the control of Bam-GAL4 . Knockdown of GOLPH3 was confirmed by parallel staining for GOLPH3 and tubulin of one testis from the same individual, as shown in ( b ). Arrowhead points to PLA signals at the cleavage site. Centriole staining (white arrows) by anti-GOLPH3 is not specific [ 23 ]. Scale bars, 10 µm. ( d , f ) Average number (±s.e.m.) of PLA dots per cell (see Material and methods for details), in telophase ( d ) and interphase spermatocytes ( f ) from either wild-type or GOLPH3 RNAi males. Statistically significant differences are *** p

Techniques Used: Mutagenesis, Staining, Expressing, Proximity Ligation Assay, Negative Control

Mutations in Rab1 disrupt Golgi architecture in premeiotic primary spermatocytes. ( a , c ) Interphase spermatocytes, stained for DNA and Lva. Scale bar, 10 µm. A total of N = 31 cells from wild-type and N = 29 cells from omt / Df were examined . Cells were imaged in six independent experiments. ( b ) Average size (relative to wild-type ± s.e.m.) and average number (±s.e.m.) of Lva-positive bodies quantified using the I mage J software, in wild-type and omt / Df (omt) mutant males. Statistically significant differences are *** p
Figure Legend Snippet: Mutations in Rab1 disrupt Golgi architecture in premeiotic primary spermatocytes. ( a , c ) Interphase spermatocytes, stained for DNA and Lva. Scale bar, 10 µm. A total of N = 31 cells from wild-type and N = 29 cells from omt / Df were examined . Cells were imaged in six independent experiments. ( b ) Average size (relative to wild-type ± s.e.m.) and average number (±s.e.m.) of Lva-positive bodies quantified using the I mage J software, in wild-type and omt / Df (omt) mutant males. Statistically significant differences are *** p

Techniques Used: Staining, Software, Mutagenesis

Rab1 is required for cytokinesis in meiotic and mitotic cells. ( a ) Rescue of omt cytokinesis defects by Rab1. Testes from 3–5 days old males carrying either omt z4144 /Df(3R)ED10338 (omt/Df) or omt z4144 / S147213 (omt/S147213) genotypes, viewed using phase-contrast microscopy, display irregular spermatids containing multiple nuclei (phase light, white arrow) associated with enlarged mitochondrial derivatives (nebenkern, phase dark, black arrow). Each wild-type spermatid displays a single nucleus (white arrow) associated with a nebenkern (black arrow) of similar size. A single copy of RFP-Rab1 transgene can rescue the cytokinesis defects associated with omt/Df mutation. A minimum of 500 spermatids, derived from at least 10 males, was examined for each genotype. Scale bar, 10 µm. ( b ) Frequencies of spermatids containing 1, 2 or 4 nuclei per mitochondrial derivative in testes from omt mutants ( omt z4144 /Df(3R)ED10338 (omt/Df) mutants, omt/S147213 , omt z4144 / Rab1 e01287 ( omt/e01287 )) in wild-type and in testes from males of genotype RFP-Rab1 ; omt/Df or YFP-Rab1 ; omt/Df. Error bars indicate s.e.m. values. ( c ) Wild-type and omt z4144 /Df(3R)ED10338 (omt/Df) mutant spermatocytes during early telophase and mid–late telophase stained for the myosin II heavy chain Zipper (Myo), tubulin and DNA. In total, N = 33 wild-type mid–late telophase cells and N = 28 omt / Df mutant mid–late telophase cells were analysed. The cells examined were from preparations of individual testes in three independent experiments. Scale bar, 10 µm. ( d ) Wild-type and omt/Df larval neuroblasts during anaphase/early telophase (anaphase) and late telophase (telophase) stained for Zipper, tubulin and DNA. In total, N = 176 wild-type mid–telophase cells and N = 180 omt/Df mutant mid-telophase cells were analysed. Mid–late telophase cells were examined from eight preparations of individual larval brains per each genotype; cells were examined in three independent experiments. Scale bar, 5 µm.
Figure Legend Snippet: Rab1 is required for cytokinesis in meiotic and mitotic cells. ( a ) Rescue of omt cytokinesis defects by Rab1. Testes from 3–5 days old males carrying either omt z4144 /Df(3R)ED10338 (omt/Df) or omt z4144 / S147213 (omt/S147213) genotypes, viewed using phase-contrast microscopy, display irregular spermatids containing multiple nuclei (phase light, white arrow) associated with enlarged mitochondrial derivatives (nebenkern, phase dark, black arrow). Each wild-type spermatid displays a single nucleus (white arrow) associated with a nebenkern (black arrow) of similar size. A single copy of RFP-Rab1 transgene can rescue the cytokinesis defects associated with omt/Df mutation. A minimum of 500 spermatids, derived from at least 10 males, was examined for each genotype. Scale bar, 10 µm. ( b ) Frequencies of spermatids containing 1, 2 or 4 nuclei per mitochondrial derivative in testes from omt mutants ( omt z4144 /Df(3R)ED10338 (omt/Df) mutants, omt/S147213 , omt z4144 / Rab1 e01287 ( omt/e01287 )) in wild-type and in testes from males of genotype RFP-Rab1 ; omt/Df or YFP-Rab1 ; omt/Df. Error bars indicate s.e.m. values. ( c ) Wild-type and omt z4144 /Df(3R)ED10338 (omt/Df) mutant spermatocytes during early telophase and mid–late telophase stained for the myosin II heavy chain Zipper (Myo), tubulin and DNA. In total, N = 33 wild-type mid–late telophase cells and N = 28 omt / Df mutant mid–late telophase cells were analysed. The cells examined were from preparations of individual testes in three independent experiments. Scale bar, 10 µm. ( d ) Wild-type and omt/Df larval neuroblasts during anaphase/early telophase (anaphase) and late telophase (telophase) stained for Zipper, tubulin and DNA. In total, N = 176 wild-type mid–telophase cells and N = 180 omt/Df mutant mid-telophase cells were analysed. Mid–late telophase cells were examined from eight preparations of individual larval brains per each genotype; cells were examined in three independent experiments. Scale bar, 5 µm.

Techniques Used: Microscopy, Mutagenesis, Derivative Assay, Staining

Rab1 is required for cytokinesis in larval neuroblasts and S2 cells. ( a ) Wild-type and omt/Df larval neuroblasts during anaphase/early telophase (upper panels) and mid–late telophase stained for anillin, α-tubulin and DNA. In 100% of wild-type cells, anillin rings appear constricted during mid–late telophase. By contrast, 31% of dividing neuroblasts from the omt/Df mutants displayed large and broken anillin rings. In total, N = 48 wild-type mid-telophases and N = 52 mid-telophases from omt/Df mutants were analysed from preparations of six individual larval brains per each genotype; cells were examined in three independent experiments. Scale bar, 5 µm. ( b ) Rab1 depletion impairs anillin localization in cytokinesis. Cells were treated with Rab1 dsRNA ( Rab1 RNAi) or with kanamycin dsRNA (control) for 72 h and then fixed and stained to reveal anillin, tubulin and DNA. ( c ) Quantification of defective anillin rings in S2 cells treated with Rab1 dsRNA ( Rab1 RNAi) or with kanamycin dsRNA (control) for 72 h. *** p
Figure Legend Snippet: Rab1 is required for cytokinesis in larval neuroblasts and S2 cells. ( a ) Wild-type and omt/Df larval neuroblasts during anaphase/early telophase (upper panels) and mid–late telophase stained for anillin, α-tubulin and DNA. In 100% of wild-type cells, anillin rings appear constricted during mid–late telophase. By contrast, 31% of dividing neuroblasts from the omt/Df mutants displayed large and broken anillin rings. In total, N = 48 wild-type mid-telophases and N = 52 mid-telophases from omt/Df mutants were analysed from preparations of six individual larval brains per each genotype; cells were examined in three independent experiments. Scale bar, 5 µm. ( b ) Rab1 depletion impairs anillin localization in cytokinesis. Cells were treated with Rab1 dsRNA ( Rab1 RNAi) or with kanamycin dsRNA (control) for 72 h and then fixed and stained to reveal anillin, tubulin and DNA. ( c ) Quantification of defective anillin rings in S2 cells treated with Rab1 dsRNA ( Rab1 RNAi) or with kanamycin dsRNA (control) for 72 h. *** p

Techniques Used: Staining

GST pull-down and yeast two-hybrid assay were used to test the interaction of Drosophila Cog5 and Cog7 with Rab1. ( a ) Bacterially expressed GST-Rab1, GST-Rab11 and GST were purified by Gluthatione-Sepharose beads and incubated with larval brain lysates from animals expressing GFP-Cog7. GST-Rab11 (Rab11) and GST-Rab1 (Rab1), but not GST, precipitated GFP-Cog7 from brain protein extracts. Note that a more robust interaction is obtained with GST-Rab1. Ponceau staining is shown as a loading control. Two per cent of the input and 25% of the pull-downs were loaded and probed with the indicated antibody. Molecular masses are in kilodaltons. The graph represents quantification of the amount of GFP-Cog7 that was pulled down from each form of Rab in western blotting analysis. The protein band intensities were obtained from three independent experiments. * p
Figure Legend Snippet: GST pull-down and yeast two-hybrid assay were used to test the interaction of Drosophila Cog5 and Cog7 with Rab1. ( a ) Bacterially expressed GST-Rab1, GST-Rab11 and GST were purified by Gluthatione-Sepharose beads and incubated with larval brain lysates from animals expressing GFP-Cog7. GST-Rab11 (Rab11) and GST-Rab1 (Rab1), but not GST, precipitated GFP-Cog7 from brain protein extracts. Note that a more robust interaction is obtained with GST-Rab1. Ponceau staining is shown as a loading control. Two per cent of the input and 25% of the pull-downs were loaded and probed with the indicated antibody. Molecular masses are in kilodaltons. The graph represents quantification of the amount of GFP-Cog7 that was pulled down from each form of Rab in western blotting analysis. The protein band intensities were obtained from three independent experiments. * p

Techniques Used: Y2H Assay, Purification, Incubation, Expressing, Staining, Western Blot

Rab1 localizes to Golgi organelles and concentrates at the cleavage site during telophase. ( a ) Western blot from adult testis (testes) or larval brains extracts (brains). Polyclonal mouse anti-Rab1 (S12085a) antibodies against Drosophila Rab1 recognized a band of 23 kDa that is strongly reduced in extracts from omt/Df and omt/S147213 mutants. α-Tubulin (Tub) was used as a loading control. Western blots were also probed with rabbit anti-GOLPH3 (G49139/77) antibodies to analyse GOLPH3 expression levels. ( b ) Quantification of the expression levels of Rab1 and GOLPH3 proteins in western blots from adult testis (testes) or larval brains extracts (brains). Band intensities from three independent experiments were quantified using I mage L ab software. The intensity of each band relative to the intensity of loading control (tubulin), was normalized to the wild-type control. Error bars indicate s.e.m. Statistically differences are * p
Figure Legend Snippet: Rab1 localizes to Golgi organelles and concentrates at the cleavage site during telophase. ( a ) Western blot from adult testis (testes) or larval brains extracts (brains). Polyclonal mouse anti-Rab1 (S12085a) antibodies against Drosophila Rab1 recognized a band of 23 kDa that is strongly reduced in extracts from omt/Df and omt/S147213 mutants. α-Tubulin (Tub) was used as a loading control. Western blots were also probed with rabbit anti-GOLPH3 (G49139/77) antibodies to analyse GOLPH3 expression levels. ( b ) Quantification of the expression levels of Rab1 and GOLPH3 proteins in western blots from adult testis (testes) or larval brains extracts (brains). Band intensities from three independent experiments were quantified using I mage L ab software. The intensity of each band relative to the intensity of loading control (tubulin), was normalized to the wild-type control. Error bars indicate s.e.m. Statistically differences are * p

Techniques Used: Western Blot, Expressing, Software

30) Product Images from "Solubility of recombinant Src homology 2 domains expressed in E. coli can be predicted by TANGO"

Article Title: Solubility of recombinant Src homology 2 domains expressed in E. coli can be predicted by TANGO

Journal: BMC Biotechnology

doi: 10.1186/1472-6750-14-3

Expression and solubility of GST-TSAd SH2 domains are influenced by flanking sequence and growth temperature. A . Schematic overview of the GST-fusion SH2 constructs (given in Table 1 ) used in this study. B . GST-fusion SH2 constructs of TSAd (1-TD, TSAd-67-207-IVTD) and Lck (Lck-SH2, Lck-124-228-RPHRD) were expressed in E.coli at room temperature (RT). Equal volumes of resuspended pellet (P), soluble fraction (S) and glutathione beads (B) were separated by 10% SDS-PAGE. Proteins were visualised by Coomassie Brilliant Blue staining. C . Quantitation of the amount of soluble GST-SH2 proteins shown in B , by immunoblotting with anti-GST and comparison to defined amounts of GST. 5 μl of 2 ml TSAd-SH2 soluble fraction and 0,06 μl of 2 ml Lck-SH2 soluble fraction from 100 ml bacterial cultures were applied on the gel. GST = 1 represents a total amount of 0,11 μg GST applied on the gel. D . Quantitation of soluble GST-SH2 proteins using Image J analysis based on C. E and F . Yield of expression of the six GST-TSAd SH2 domain constructs in E.coli at RT or 15°C, respectively. Gels processed as in B . Constructs are indicated by their short names as listed in Table 1 .
Figure Legend Snippet: Expression and solubility of GST-TSAd SH2 domains are influenced by flanking sequence and growth temperature. A . Schematic overview of the GST-fusion SH2 constructs (given in Table 1 ) used in this study. B . GST-fusion SH2 constructs of TSAd (1-TD, TSAd-67-207-IVTD) and Lck (Lck-SH2, Lck-124-228-RPHRD) were expressed in E.coli at room temperature (RT). Equal volumes of resuspended pellet (P), soluble fraction (S) and glutathione beads (B) were separated by 10% SDS-PAGE. Proteins were visualised by Coomassie Brilliant Blue staining. C . Quantitation of the amount of soluble GST-SH2 proteins shown in B , by immunoblotting with anti-GST and comparison to defined amounts of GST. 5 μl of 2 ml TSAd-SH2 soluble fraction and 0,06 μl of 2 ml Lck-SH2 soluble fraction from 100 ml bacterial cultures were applied on the gel. GST = 1 represents a total amount of 0,11 μg GST applied on the gel. D . Quantitation of soluble GST-SH2 proteins using Image J analysis based on C. E and F . Yield of expression of the six GST-TSAd SH2 domain constructs in E.coli at RT or 15°C, respectively. Gels processed as in B . Constructs are indicated by their short names as listed in Table 1 .

Techniques Used: Expressing, Solubility, Sequencing, Construct, SDS Page, Staining, Quantitation Assay

Beta-aggregation prediction of the SH2D2A SH2 domain. A . Amino acid positions of the indicated SH2 domains (X-axis) plotted against the corresponding beta-aggregating value (Y-axis). B . Beta-aggregation values of amino acids 122–135 in wild type (WT) and in silico mutated SH2D2A encoding TSAd. C . Ribbon diagrams and space filling models of the Lck SH2 domain (PDB ID: 1BHH) and the ALX SH2 domain (PDB ID: 2CS0) showing the location of Ser-Phe-Ser (Lck) and Gly-Tyr-Thr (ALX) corresponding to the TSAd TFV sequence. Models show that the side chains of Ser 161 and Ser 163 in Lck SH2 and Gly65, Tyr66 and Thr67 of ALX SH2 are solvent accessible. D .- F . WT and mutated SH2 domains expressed in E.coli at 15°C. D . Equal amount (5 μl) of soluble fraction from a 100 ml bacterial culture was separated by SDS-page and immunoblotted with anti-GST antibodies for quantification of soluble recombinant protein. GST = 1 equals 0,11 μg purified GST protein. One representative experiment out of three is shown. E . Quantitation of soluble GST-SH2 proteins by Image J analysis based on D. ND; not detected. F . Soluble protein captured on glutathione beads were processed as in Fig. 2 B. G . Solubility of WT and mutated TSAd SH2 (5-AS, TSAd-90-188-PAAS) (GYT) and ALX SH2 (TFV) expressed in E.coli. Uninduced E.coli (U), soluble (S) and pellet (P) fractions were processed as in Fig. 2 B. Amount of soluble and insoluble SH2 domain visualized by anti-GST immunoblotting (upper panel). Total protein content in samples was visualized by Coomassie Brilliant Blue Staining (lower panel). H . CD3 stimulated Jurkat cell lysates (S) and proteins pulled down with the indicated SH2 domains were separated by SDS-page and immunoblotted. I . Peptide array with VEGFR-2 and VCP phosphotyrosine peptides probed with the indicated SH2 domains. Bound SH2 domains detected using anti-GST antibody.
Figure Legend Snippet: Beta-aggregation prediction of the SH2D2A SH2 domain. A . Amino acid positions of the indicated SH2 domains (X-axis) plotted against the corresponding beta-aggregating value (Y-axis). B . Beta-aggregation values of amino acids 122–135 in wild type (WT) and in silico mutated SH2D2A encoding TSAd. C . Ribbon diagrams and space filling models of the Lck SH2 domain (PDB ID: 1BHH) and the ALX SH2 domain (PDB ID: 2CS0) showing the location of Ser-Phe-Ser (Lck) and Gly-Tyr-Thr (ALX) corresponding to the TSAd TFV sequence. Models show that the side chains of Ser 161 and Ser 163 in Lck SH2 and Gly65, Tyr66 and Thr67 of ALX SH2 are solvent accessible. D .- F . WT and mutated SH2 domains expressed in E.coli at 15°C. D . Equal amount (5 μl) of soluble fraction from a 100 ml bacterial culture was separated by SDS-page and immunoblotted with anti-GST antibodies for quantification of soluble recombinant protein. GST = 1 equals 0,11 μg purified GST protein. One representative experiment out of three is shown. E . Quantitation of soluble GST-SH2 proteins by Image J analysis based on D. ND; not detected. F . Soluble protein captured on glutathione beads were processed as in Fig. 2 B. G . Solubility of WT and mutated TSAd SH2 (5-AS, TSAd-90-188-PAAS) (GYT) and ALX SH2 (TFV) expressed in E.coli. Uninduced E.coli (U), soluble (S) and pellet (P) fractions were processed as in Fig. 2 B. Amount of soluble and insoluble SH2 domain visualized by anti-GST immunoblotting (upper panel). Total protein content in samples was visualized by Coomassie Brilliant Blue Staining (lower panel). H . CD3 stimulated Jurkat cell lysates (S) and proteins pulled down with the indicated SH2 domains were separated by SDS-page and immunoblotted. I . Peptide array with VEGFR-2 and VCP phosphotyrosine peptides probed with the indicated SH2 domains. Bound SH2 domains detected using anti-GST antibody.

Techniques Used: In Silico, Sequencing, SDS Page, Recombinant, Purification, Quantitation Assay, Solubility, Staining, Peptide Microarray

31) Product Images from "Japanese Encephalitis Virus Core Protein Inhibits Stress Granule Formation through an Interaction with Caprin-1 and Facilitates Viral Propagation"

Article Title: Japanese Encephalitis Virus Core Protein Inhibits Stress Granule Formation through an Interaction with Caprin-1 and Facilitates Viral Propagation

Journal: Journal of Virology

doi: 10.1128/JVI.02186-12

JEV core protein directly interacts with Caprin-1, an SG-associated cellular factor. (A) Identification of host cellular proteins associated with JEV core protein by FOS-tagged purification and LC-MS/MS analysis. Overview of the FOS-tagged purification
Figure Legend Snippet: JEV core protein directly interacts with Caprin-1, an SG-associated cellular factor. (A) Identification of host cellular proteins associated with JEV core protein by FOS-tagged purification and LC-MS/MS analysis. Overview of the FOS-tagged purification

Techniques Used: Purification, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

Subcellular localizations of the SG-associated proteins during DENV infection. Cellular localizations of G3BP, Caprin-1, and TIA-1 (green, AF488-conjugated secondary antibody) and viral components (core protein and dsRNA) (red, AF-594-conjugate secondary
Figure Legend Snippet: Subcellular localizations of the SG-associated proteins during DENV infection. Cellular localizations of G3BP, Caprin-1, and TIA-1 (green, AF488-conjugated secondary antibody) and viral components (core protein and dsRNA) (red, AF-594-conjugate secondary

Techniques Used: Infection

Interaction of JEV core protein with Caprin-1 plays crucial roles not only in viral replication in vitro but also in pathogenesis in mice through the suppression of SG formation. (A) Huh7/Caprin-1-AcGFP cells were infected with JEV (WT or 9798A mutant)
Figure Legend Snippet: Interaction of JEV core protein with Caprin-1 plays crucial roles not only in viral replication in vitro but also in pathogenesis in mice through the suppression of SG formation. (A) Huh7/Caprin-1-AcGFP cells were infected with JEV (WT or 9798A mutant)

Techniques Used: In Vitro, Mouse Assay, Infection, Mutagenesis

Lys 97 and Arg 98 in the JEV core protein are crucial residues for the interaction with Caprin-1. (A) Putative structural model of the core protein homodimer of JEV deduced from that of DENV obtained from the Protein Data Bank (accession number 1R6R ) by
Figure Legend Snippet: Lys 97 and Arg 98 in the JEV core protein are crucial residues for the interaction with Caprin-1. (A) Putative structural model of the core protein homodimer of JEV deduced from that of DENV obtained from the Protein Data Bank (accession number 1R6R ) by

Techniques Used:

Knockdown of Caprin-1 cancels SG inhibition during JEV infection and suppresses viral propagation. (A) (Upper) The levels of expression of Caprin-1 in cells transfected with either siCaprin-1 or siNC was determined by immunoblotting using anti-Caprin-1
Figure Legend Snippet: Knockdown of Caprin-1 cancels SG inhibition during JEV infection and suppresses viral propagation. (A) (Upper) The levels of expression of Caprin-1 in cells transfected with either siCaprin-1 or siNC was determined by immunoblotting using anti-Caprin-1

Techniques Used: Inhibition, Infection, Expressing, Transfection

Caprin-1 is colocalized with the JEV core protein in the perinuclear region. (A) Expression of Caprin-1 fused with AcGFP (Caprin-1-AcGFP), Caprin-1, actin, or AcGFP in lentivirally transduced Huh7 cells was determined by immunoblotting using the appropriate
Figure Legend Snippet: Caprin-1 is colocalized with the JEV core protein in the perinuclear region. (A) Expression of Caprin-1 fused with AcGFP (Caprin-1-AcGFP), Caprin-1, actin, or AcGFP in lentivirally transduced Huh7 cells was determined by immunoblotting using the appropriate

Techniques Used: Expressing

32) Product Images from "Evolutionary Insights into Premetazoan Functions of the Neuronal Protein Homer"

Article Title: Evolutionary Insights into Premetazoan Functions of the Neuronal Protein Homer

Journal: Molecular Biology and Evolution

doi: 10.1093/molbev/msu178

Homer 1 and Flotillin 1 from vertebrates interact directly and colocalize in the nuclei of primary astrocytes. ( A ) Bacterially expressed His-HsHomer 1 binds to GST-HsFlotillin 1 (GST-HsFlot1) but not GST. To measure the binding affinity between HsHomer and HsFlotillin 1, increasing concentrations of His-HsHomer were incubated with 2 µM GST-HsFlotillin 1 (lanes 1–6) or with 2 µM GST (lanes 7–12) bound to glutathione-Sepharose beads for 1 h at RT, washed, and analyzed on SDS-PAGE (concentrations of His-HsHomer 1 used for the binding assays in lanes 1–6 and lanes 7–12 were 0.1 µM, 0.25 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM, respectively). Saturated binding of HsHomer 1 to HsFlotillin 1 was reached at approximately 2 µM SrHomer. ( B ) The Kd of the reaction was determined by fitting the data to a Hill function assuming 1:1 binding stoichiometry. The apparent binding Kd is approximately 0.83 µM. ( C–G ) Homer 1 and Flotillin 1 do not appear to colocalize in rat hippocampal neurons. Hippocampal neurons (12 days in vitro) were stained with DAPI ( C , blue), Flotillin 1 antibodies ( D , green), and Homer 1 antibodies ( E , red). Although Flotillin 1 and Homer 1 both form puncta throughout the dendrites and cytoplasm, both appear to be excluded from the nucleus. An overlay of Flotillin 1 and Homer 1 is shown in panel ( F ). ( G ) Segment of dendrite magnified from ( F ) shows little colocalization between Flotillin 1 and Homer 1. ( H–K ) Homer 1 localizes to the nucleus in rat astrocytes (4 days in vitro) as shown by staining with DAPI ( H , blue), antibodies to the astrocyte marker GFAP (I, green), and antibodies to Homer 1 ( J , red). ( K ) The overlay of DAPI, GFAP, and Homer 1 reveals that Homer 1 colocalizes with DNA in the nucleus. ( L–O ) Flotillin 1 and Homer 1 colocalize in rat astrocyte nuclei. Subcellular localization of DNA ( L , blue), Flotillin 1 ( M , green), and Homer 1 ( N , red) are shown. ( O ) The overlay of DAPI-stained DNA, Flotillin1, and Homer 1 shows colocalization in the nucleus. Scale bars: 10 µm in ( O ) and ( F ), 5 µm in ( G ). Hs , Homo sapiens .
Figure Legend Snippet: Homer 1 and Flotillin 1 from vertebrates interact directly and colocalize in the nuclei of primary astrocytes. ( A ) Bacterially expressed His-HsHomer 1 binds to GST-HsFlotillin 1 (GST-HsFlot1) but not GST. To measure the binding affinity between HsHomer and HsFlotillin 1, increasing concentrations of His-HsHomer were incubated with 2 µM GST-HsFlotillin 1 (lanes 1–6) or with 2 µM GST (lanes 7–12) bound to glutathione-Sepharose beads for 1 h at RT, washed, and analyzed on SDS-PAGE (concentrations of His-HsHomer 1 used for the binding assays in lanes 1–6 and lanes 7–12 were 0.1 µM, 0.25 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM, respectively). Saturated binding of HsHomer 1 to HsFlotillin 1 was reached at approximately 2 µM SrHomer. ( B ) The Kd of the reaction was determined by fitting the data to a Hill function assuming 1:1 binding stoichiometry. The apparent binding Kd is approximately 0.83 µM. ( C–G ) Homer 1 and Flotillin 1 do not appear to colocalize in rat hippocampal neurons. Hippocampal neurons (12 days in vitro) were stained with DAPI ( C , blue), Flotillin 1 antibodies ( D , green), and Homer 1 antibodies ( E , red). Although Flotillin 1 and Homer 1 both form puncta throughout the dendrites and cytoplasm, both appear to be excluded from the nucleus. An overlay of Flotillin 1 and Homer 1 is shown in panel ( F ). ( G ) Segment of dendrite magnified from ( F ) shows little colocalization between Flotillin 1 and Homer 1. ( H–K ) Homer 1 localizes to the nucleus in rat astrocytes (4 days in vitro) as shown by staining with DAPI ( H , blue), antibodies to the astrocyte marker GFAP (I, green), and antibodies to Homer 1 ( J , red). ( K ) The overlay of DAPI, GFAP, and Homer 1 reveals that Homer 1 colocalizes with DNA in the nucleus. ( L–O ) Flotillin 1 and Homer 1 colocalize in rat astrocyte nuclei. Subcellular localization of DNA ( L , blue), Flotillin 1 ( M , green), and Homer 1 ( N , red) are shown. ( O ) The overlay of DAPI-stained DNA, Flotillin1, and Homer 1 shows colocalization in the nucleus. Scale bars: 10 µm in ( O ) and ( F ), 5 µm in ( G ). Hs , Homo sapiens .

Techniques Used: Binding Assay, Incubation, SDS Page, In Vitro, Staining, Marker

33) Product Images from "Dissection of the regulatory role for the N-terminal domain in Candida albicans protein phosphatase Z1"

Article Title: Dissection of the regulatory role for the N-terminal domain in Candida albicans protein phosphatase Z1

Journal: PLoS ONE

doi: 10.1371/journal.pone.0211426

The rationale behind the in vitro mutagenesis of the CaPpz1 phosphatase. A. Bioinformatic analysis of the CaPpz1 protein. The IUPred (red line) and ANCHOR (blue line) software revealed the disordered regions (above 0.5 probability) and four main protein binding sites (blue boxes) in the N-terminal domain of CaPpz1. In the four CaPpz1 deletion mutants, these potential binding sites were eliminated. In addition, two point mutants (the not myristoylated G2A and the inactive R262L) were generated, and the two main domains of the protein (Nter and Cter) were expressed separately. B. Schematic representation of the bacterially expressed recombinant proteins. The yellow boxes show the residual part of the GST-tag that remains in the bacterially expressed proteins after Prescission protease cleavage, while the light brown boxes represent the 6xHis tag of the recombinant proteins (note that these features are not present in the proteins expressed in S . cerevisiae ). The N-terminal domain is violet and the C-terminal domain is green. Point mutations are labeled with a triangle, and five unintentional S to L exchanges due to the special codon usage of C . albicans are indicated by crosses.
Figure Legend Snippet: The rationale behind the in vitro mutagenesis of the CaPpz1 phosphatase. A. Bioinformatic analysis of the CaPpz1 protein. The IUPred (red line) and ANCHOR (blue line) software revealed the disordered regions (above 0.5 probability) and four main protein binding sites (blue boxes) in the N-terminal domain of CaPpz1. In the four CaPpz1 deletion mutants, these potential binding sites were eliminated. In addition, two point mutants (the not myristoylated G2A and the inactive R262L) were generated, and the two main domains of the protein (Nter and Cter) were expressed separately. B. Schematic representation of the bacterially expressed recombinant proteins. The yellow boxes show the residual part of the GST-tag that remains in the bacterially expressed proteins after Prescission protease cleavage, while the light brown boxes represent the 6xHis tag of the recombinant proteins (note that these features are not present in the proteins expressed in S . cerevisiae ). The N-terminal domain is violet and the C-terminal domain is green. Point mutations are labeled with a triangle, and five unintentional S to L exchanges due to the special codon usage of C . albicans are indicated by crosses.

Techniques Used: In Vitro, Mutagenesis, Software, Protein Binding, Binding Assay, Generated, Recombinant, Labeling

The role of the CaPpz1 N-terminal domain in phosphatase activity. The in vitro phosphatase activity of the bacterially expressed purified recombinant wild type and mutant CaPpz1 proteins was determined with 32 P-labelled myosin light chain substrate. The mean and standard deviation of 3–4 independent assays is shown, ** indicates p
Figure Legend Snippet: The role of the CaPpz1 N-terminal domain in phosphatase activity. The in vitro phosphatase activity of the bacterially expressed purified recombinant wild type and mutant CaPpz1 proteins was determined with 32 P-labelled myosin light chain substrate. The mean and standard deviation of 3–4 independent assays is shown, ** indicates p

Techniques Used: Activity Assay, In Vitro, Purification, Recombinant, Mutagenesis, Standard Deviation

Complementation of the salt tolerance of ppz1 S . cerevisiae cells by the expression of mutant CaPpz1 proteins. The phosphatase mutant ppz1 S . cerevisiae strain was transformed either with empty plasmids or with YCplac111 (A) or YEplac181 (B) carrying wild type or mutant CaPPZ1 inserts as in Fig 3 . After establishing optimal assay conditions the effect of 50 mM LiCl on the transformants was determined after 19 h of cultivation. The growth of the cells containing empty plasmids was taken as 100%. Mean and standard deviation of 3 independent experiments are shown.
Figure Legend Snippet: Complementation of the salt tolerance of ppz1 S . cerevisiae cells by the expression of mutant CaPpz1 proteins. The phosphatase mutant ppz1 S . cerevisiae strain was transformed either with empty plasmids or with YCplac111 (A) or YEplac181 (B) carrying wild type or mutant CaPPZ1 inserts as in Fig 3 . After establishing optimal assay conditions the effect of 50 mM LiCl on the transformants was determined after 19 h of cultivation. The growth of the cells containing empty plasmids was taken as 100%. Mean and standard deviation of 3 independent experiments are shown.

Techniques Used: Expressing, Mutagenesis, Transformation Assay, Standard Deviation

Complementation of the caffeine sensitivity of ppz1 S . cerevisiae cells by the expression of mutant CaPpz1 proteins. Wild type BY4741 S . cerevisiae strain or its isogenic ppz1 deletion mutant strain were transformed with empty plasmids as a negative control. The mutant strain was also transformed with YCplac111 (A) or YEplac181 (B) carrying wild type or mutant CaPPZ1 inserts (that are labeled by the names of the encoded proteins). Yeast cells were plated on YPD in the absence or in the presence of increasing concentrations of caffeine and the growth rate of the yeast cells was determined in spot tests. 3 x 10 3 and 3 x 10 2 cells were spotted on YPD plates, which were photographed after 72 h incubation. Representative results of 3 independent experiments are shown.
Figure Legend Snippet: Complementation of the caffeine sensitivity of ppz1 S . cerevisiae cells by the expression of mutant CaPpz1 proteins. Wild type BY4741 S . cerevisiae strain or its isogenic ppz1 deletion mutant strain were transformed with empty plasmids as a negative control. The mutant strain was also transformed with YCplac111 (A) or YEplac181 (B) carrying wild type or mutant CaPPZ1 inserts (that are labeled by the names of the encoded proteins). Yeast cells were plated on YPD in the absence or in the presence of increasing concentrations of caffeine and the growth rate of the yeast cells was determined in spot tests. 3 x 10 3 and 3 x 10 2 cells were spotted on YPD plates, which were photographed after 72 h incubation. Representative results of 3 independent experiments are shown.

Techniques Used: Expressing, Mutagenesis, Transformation Assay, Negative Control, Labeling, Incubation

34) Product Images from "Hsp70 and CHIP Selectively Mediate Ubiquitination and Degradation of Hypoxia-inducible Factor (HIF)-1? but Not HIF-2? *"

Article Title: Hsp70 and CHIP Selectively Mediate Ubiquitination and Degradation of Hypoxia-inducible Factor (HIF)-1? but Not HIF-2? *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.068577

Identification of Hsp70 and CHIP as HIF-1α-interacting proteins. A , proteomic screen was performed to identify HIF-1α-interacting proteins. B , mass spectrum of a tryptic peptide of Hsp70 identified by SILAC was determined. C , fragmentation
Figure Legend Snippet: Identification of Hsp70 and CHIP as HIF-1α-interacting proteins. A , proteomic screen was performed to identify HIF-1α-interacting proteins. B , mass spectrum of a tryptic peptide of Hsp70 identified by SILAC was determined. C , fragmentation

Techniques Used: Chromatin Immunoprecipitation

PHD/VHL/Elongin-C pathway is not required for Hsp70-mediated HIF-1α degradation. A , immunoblot assays were performed to determine double mutant ( DM ) FLAG-HIF-1α (P402A/P564A), wild-type ( WT ) FLAG-HIF-1α, HIF-1β, Hsp70-V5,
Figure Legend Snippet: PHD/VHL/Elongin-C pathway is not required for Hsp70-mediated HIF-1α degradation. A , immunoblot assays were performed to determine double mutant ( DM ) FLAG-HIF-1α (P402A/P564A), wild-type ( WT ) FLAG-HIF-1α, HIF-1β, Hsp70-V5,

Techniques Used: Mutagenesis

CHIP knockdown increases HIF-1α protein levels and HIF-1-dependent gene transcription during prolonged hypoxia. A , HEK293T cells were transfected with expression vector encoding shCHIP1172 or shSC and exposed to 20% or 1% O 2 for the indicated
Figure Legend Snippet: CHIP knockdown increases HIF-1α protein levels and HIF-1-dependent gene transcription during prolonged hypoxia. A , HEK293T cells were transfected with expression vector encoding shCHIP1172 or shSC and exposed to 20% or 1% O 2 for the indicated

Techniques Used: Chromatin Immunoprecipitation, Transfection, Expressing, Plasmid Preparation

Hsp70 knockdown increases HIF-1α protein levels and HIF-1-dependent gene transcription during prolonged hypoxia. A , HEK293T cells were transfected with expression vector encoding shRNA against Hsp70 ( shHsp70 ) or a scrambled control shRNA ( shSC
Figure Legend Snippet: Hsp70 knockdown increases HIF-1α protein levels and HIF-1-dependent gene transcription during prolonged hypoxia. A , HEK293T cells were transfected with expression vector encoding shRNA against Hsp70 ( shHsp70 ) or a scrambled control shRNA ( shSC

Techniques Used: Transfection, Expressing, Plasmid Preparation, shRNA

Hsp70-CHIP complex binds to HIF-1α in vitro and in human cells. A and B , co-immunoprecipitation ( IP ) of FLAG-HIF-1α and CHIP-V5 or Hsp70 from transfected HEK293T cells treated with 10 μ m MG132 for 8 h was performed. C , GST pulldown
Figure Legend Snippet: Hsp70-CHIP complex binds to HIF-1α in vitro and in human cells. A and B , co-immunoprecipitation ( IP ) of FLAG-HIF-1α and CHIP-V5 or Hsp70 from transfected HEK293T cells treated with 10 μ m MG132 for 8 h was performed. C , GST pulldown

Techniques Used: Chromatin Immunoprecipitation, In Vitro, Immunoprecipitation, Transfection

CHIP promotes ubiquitination and degradation of HIF-1α. A , immunoblot assays were performed to determine FLAG-HIF-1α, HIF-1β, CHIP-V5, and actin protein levels in co-transfected HEK293T cells exposed to 20% or 1% O 2 for 8 h. B
Figure Legend Snippet: CHIP promotes ubiquitination and degradation of HIF-1α. A , immunoblot assays were performed to determine FLAG-HIF-1α, HIF-1β, CHIP-V5, and actin protein levels in co-transfected HEK293T cells exposed to 20% or 1% O 2 for 8 h. B

Techniques Used: Chromatin Immunoprecipitation, Transfection

Hsp70 recruits CHIP and regulates HIF-1α degradation. A and B , immunoblot assays were performed to determine HIF-1α, Hsp70-V5, CHIP, and actin protein levels in transfected HEK293T cells exposed to 20% or 1% O 2 for 8 h ( A ). Band intensities
Figure Legend Snippet: Hsp70 recruits CHIP and regulates HIF-1α degradation. A and B , immunoblot assays were performed to determine HIF-1α, Hsp70-V5, CHIP, and actin protein levels in transfected HEK293T cells exposed to 20% or 1% O 2 for 8 h ( A ). Band intensities

Techniques Used: Chromatin Immunoprecipitation, Transfection

PHD/VHL pathway is not involved in CHIP-mediated HIF-1α degradation. A , immunoblot assays were performed to determine double mutant ( DM ) FLAG-HIF-1α(P402A/P564A), wild-type ( WT ) FLAG-HIF-1α, HIF-1β, CHIP-V5, and actin protein
Figure Legend Snippet: PHD/VHL pathway is not involved in CHIP-mediated HIF-1α degradation. A , immunoblot assays were performed to determine double mutant ( DM ) FLAG-HIF-1α(P402A/P564A), wild-type ( WT ) FLAG-HIF-1α, HIF-1β, CHIP-V5, and actin protein

Techniques Used: Chromatin Immunoprecipitation, Mutagenesis

Disruption of Hsp70-HIF-1α interaction prevents HIF-1α degradation. A , GST pulldown assays were performed with purified GST or GST-HIF-1α-(331–427) and WCLs from HEK293 cells expressing Hsp70-V5 in the presence or absence
Figure Legend Snippet: Disruption of Hsp70-HIF-1α interaction prevents HIF-1α degradation. A , GST pulldown assays were performed with purified GST or GST-HIF-1α-(331–427) and WCLs from HEK293 cells expressing Hsp70-V5 in the presence or absence

Techniques Used: Purification, Expressing

Hsp70 overexpression induces ubiquitination and proteasomal degradation of HIF-1α. A , immunoblot assays were performed to determine FLAG-HIF-1α, HIF-1β, Hsp70-V5, and actin protein levels in co-transfected HEK293T cells exposed
Figure Legend Snippet: Hsp70 overexpression induces ubiquitination and proteasomal degradation of HIF-1α. A , immunoblot assays were performed to determine FLAG-HIF-1α, HIF-1β, Hsp70-V5, and actin protein levels in co-transfected HEK293T cells exposed

Techniques Used: Over Expression, Transfection

35) Product Images from "Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1"

Article Title: Three-dimensional context rather than NLS amino acid sequence determines importin α subtype specificity for RCC1

Journal: Nature Communications

doi: 10.1038/s41467-017-01057-7

Differential recognition of NLS cargos by importin αs. Recognition of a human RCC1 ( green ) by importin α3 ( gray ), b yeast RCC1 ( yellow ) by Kap60 ( light cyan ), c CAP80 ( orange ) by importin α1 ( magenta ) (PDB ID 3FEY). For clarity, residues 385–790 of the CAP80 are not shown. NLSs and flanking residues that make contacts with importin αs are shown in black; residues at P 2 and P 2 ′ are shown as sticks
Figure Legend Snippet: Differential recognition of NLS cargos by importin αs. Recognition of a human RCC1 ( green ) by importin α3 ( gray ), b yeast RCC1 ( yellow ) by Kap60 ( light cyan ), c CAP80 ( orange ) by importin α1 ( magenta ) (PDB ID 3FEY). For clarity, residues 385–790 of the CAP80 are not shown. NLSs and flanking residues that make contacts with importin αs are shown in black; residues at P 2 and P 2 ′ are shown as sticks

Techniques Used:

The structure of yeast RCC1 in complex with Kap60. a Crystal structure of Kap60 ( light cyan ) bound to yRCC1 ( yellow ). b A representative F o − F c electron density difference map of yRCC1 N-terminal tail (in blue ) is displayed at 2 σ above background and is overlaid to the final refined model (residues 2–6 and 16–23) colored in yellow . c Average SEC-SAXS data calculated from frames 710 to 750 ( top panel ) and corresponding P ( r ) function ( bottom panel ) are shown in black. Scattering data and P ( r ) function calculated from the crystal structure of the Kap60:yRCC1 complex are shown in red . d Ab initio SAXS reconstructions of the Kap60:yRCC1 complex calculated from experimental scattering values obtained from SEC-SAXS (frames 710–750). The crystallographic structure of the complex is overlaid to the SAXS envelope
Figure Legend Snippet: The structure of yeast RCC1 in complex with Kap60. a Crystal structure of Kap60 ( light cyan ) bound to yRCC1 ( yellow ). b A representative F o − F c electron density difference map of yRCC1 N-terminal tail (in blue ) is displayed at 2 σ above background and is overlaid to the final refined model (residues 2–6 and 16–23) colored in yellow . c Average SEC-SAXS data calculated from frames 710 to 750 ( top panel ) and corresponding P ( r ) function ( bottom panel ) are shown in black. Scattering data and P ( r ) function calculated from the crystal structure of the Kap60:yRCC1 complex are shown in red . d Ab initio SAXS reconstructions of the Kap60:yRCC1 complex calculated from experimental scattering values obtained from SEC-SAXS (frames 710–750). The crystallographic structure of the complex is overlaid to the SAXS envelope

Techniques Used: Size-exclusion Chromatography

Kap60:yRCC1 binding interface. a Schematic diagram of the interactions between the yRCC1 N-terminal tail and Kap60. R4 and K20 at positions P 2 ′ and P 2 , respectively, are shown as red letters. b Superimposition of the bipartite NLSs and C-terminal regions of yeast and human RCC1 colored in yellow and green , respectively. c Crystal structure of Kap60 ( light cyan ) bound to yRCC1 ( yellow ) illustrating contacts between the C-terminal α-helix and Kap60 Arm 1. d Pull-down analysis of the interaction of GST-ΔIBB-Kap60 immobilized on glutathione beads with yRCC1. Loading controls are in Supplementary Fig. 3c . e Pull-downs are shown as mean ± SD for three independent experiments. No interaction was observed between free yRCC1 and glutathione beads (Supplementary Fig. 3d )
Figure Legend Snippet: Kap60:yRCC1 binding interface. a Schematic diagram of the interactions between the yRCC1 N-terminal tail and Kap60. R4 and K20 at positions P 2 ′ and P 2 , respectively, are shown as red letters. b Superimposition of the bipartite NLSs and C-terminal regions of yeast and human RCC1 colored in yellow and green , respectively. c Crystal structure of Kap60 ( light cyan ) bound to yRCC1 ( yellow ) illustrating contacts between the C-terminal α-helix and Kap60 Arm 1. d Pull-down analysis of the interaction of GST-ΔIBB-Kap60 immobilized on glutathione beads with yRCC1. Loading controls are in Supplementary Fig. 3c . e Pull-downs are shown as mean ± SD for three independent experiments. No interaction was observed between free yRCC1 and glutathione beads (Supplementary Fig. 3d )

Techniques Used: Binding Assay

36) Product Images from "Arginine methylation of the C-terminus RGG motif promotes TOP3B topoisomerase activity and stress granule localization"

Article Title: Arginine methylation of the C-terminus RGG motif promotes TOP3B topoisomerase activity and stress granule localization

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky103

TOP3B is methylated in vitro . ( A ) The locations of the TOP3B topoisomerase domain, zinc-binding domain (Zn) and C-terminal low complexity domain (LCD). Regions of arginine-glycine-rich and proline-arginine-rich motifs are highlighted in red and blue, respectively. A summary of the in vitro methylation observed in B and C is shown. ( B ) TOP3B is methylated in vitro. In vitro methylation assays were performed by incubating recombinant PRMTs (PRMT1, 3, CARM1, PRMT6 and PRMT8) with purified GST-TOP3B protein. ( C ) C-terminal domain of TOP3B is methylated. Both N-terminus and C-terminus truncations of TOP3B were subjected to in vitro methylation assay as described in (B). ( D ) Arginine 833 and 835 are the major methylation sites. The in vitro methylation assays were performed by incubating recombinant PRMT1, PRMT3 and PRMT6 with a series of R to K mutants of GST-TOP3B C-terminus truncation (708-862). In panels B–D, the loading of the proteins was visualized by coomassie staining the same PVDF membrane for fluorography. Arrows indicate the positions of the substrates and the solid dots indicate the positions of the recombinant enzymes.
Figure Legend Snippet: TOP3B is methylated in vitro . ( A ) The locations of the TOP3B topoisomerase domain, zinc-binding domain (Zn) and C-terminal low complexity domain (LCD). Regions of arginine-glycine-rich and proline-arginine-rich motifs are highlighted in red and blue, respectively. A summary of the in vitro methylation observed in B and C is shown. ( B ) TOP3B is methylated in vitro. In vitro methylation assays were performed by incubating recombinant PRMTs (PRMT1, 3, CARM1, PRMT6 and PRMT8) with purified GST-TOP3B protein. ( C ) C-terminal domain of TOP3B is methylated. Both N-terminus and C-terminus truncations of TOP3B were subjected to in vitro methylation assay as described in (B). ( D ) Arginine 833 and 835 are the major methylation sites. The in vitro methylation assays were performed by incubating recombinant PRMT1, PRMT3 and PRMT6 with a series of R to K mutants of GST-TOP3B C-terminus truncation (708-862). In panels B–D, the loading of the proteins was visualized by coomassie staining the same PVDF membrane for fluorography. Arrows indicate the positions of the substrates and the solid dots indicate the positions of the recombinant enzymes.

Techniques Used: Methylation, In Vitro, Binding Assay, Recombinant, Purification, Staining

37) Product Images from "Rv0004 is a new essential member of the mycobacterial DNA replication machinery"

Article Title: Rv0004 is a new essential member of the mycobacterial DNA replication machinery

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1007115

The C-terminus of DciA contains a structurally predicted D na A N TD- L ike (DANL) domain. (A) Alignment generated by Phyre2 of the DciA Mtb DANL domain with B . subtilis DnaA NTD from PDB:4TPSD. Red boxes indicate identical residues, while structural predictions above the alignment refer to the predicted structure of DciA Mtb (arrows for beta sheets, loops for alpha helices, and TT for the turn between the two beta sheets). (B) Structural model of DciA Mtb DANL domain generated by Phyre2. DciA Mtb DANL (residues 92–142, magenta) and the B . subtilis DnaA NTD (residues 29–80, gold, PDB:4TPSD) were aligned using PyMol. (C) The structural alignment is shown in the context of the SirA-DnaA complex (PDB:4TPS) with SirA in blue and the inter-facial locations of F49 of DnaA and W113 of DciA Mtb highlighted. (D) Zoomed in image of (C). (E) Consurf analysis based on 150 non-redundant homologs of DciA Mtb protein. Highly conserved residues are in magenta and variable residues are teal. The W113 residue is underlined. Due to a probable misannotation of the start codon, the beginning of actinobacterial DciA proteins share poor homology ( Fig 1C ). Therefore, Consurf analysis of DciA begins at the glycine that marks the beginning of homology across mycobacterial DciA proteins (at residue 21 in Fig 1C ).
Figure Legend Snippet: The C-terminus of DciA contains a structurally predicted D na A N TD- L ike (DANL) domain. (A) Alignment generated by Phyre2 of the DciA Mtb DANL domain with B . subtilis DnaA NTD from PDB:4TPSD. Red boxes indicate identical residues, while structural predictions above the alignment refer to the predicted structure of DciA Mtb (arrows for beta sheets, loops for alpha helices, and TT for the turn between the two beta sheets). (B) Structural model of DciA Mtb DANL domain generated by Phyre2. DciA Mtb DANL (residues 92–142, magenta) and the B . subtilis DnaA NTD (residues 29–80, gold, PDB:4TPSD) were aligned using PyMol. (C) The structural alignment is shown in the context of the SirA-DnaA complex (PDB:4TPS) with SirA in blue and the inter-facial locations of F49 of DnaA and W113 of DciA Mtb highlighted. (D) Zoomed in image of (C). (E) Consurf analysis based on 150 non-redundant homologs of DciA Mtb protein. Highly conserved residues are in magenta and variable residues are teal. The W113 residue is underlined. Due to a probable misannotation of the start codon, the beginning of actinobacterial DciA proteins share poor homology ( Fig 1C ). Therefore, Consurf analysis of DciA begins at the glycine that marks the beginning of homology across mycobacterial DciA proteins (at residue 21 in Fig 1C ).

Techniques Used: Generated

DciA Mtb binds DNA, interacts directly with DnaB, and affects the DnaB-DnaA interaction. (A) Autoradiograph of EMSA with DciA Mtb protein and 4.8ng oriC Mtb dsDNA separated by native PAGE. All lanes contain 32 P-labeled oriC Mtb DNA. Amount of DciA Mtb in each lane is indicated. (B) Proteins involved in DNA replication or repair that were identified by MS analysis as co-immunoprecipitating with HA-DciA Mtb . (C) GelCode Blue-stained SDS-PAGE of pull-down experiments using HA-DciA Mtb , DnaB, and DnaA. Lanes 1–3 after ladder contain purified proteins used in pull-downs. Lanes 4–7 contain eluates from pull downs with immobilized HA-DciA Mtb incubated with DnaA (lanes 4–5) or DnaB (lanes 6–7). Proteins used were purified in the absence (lanes 4,6) or presence (lanes 5,7) of Benzonase (Benz.). Top arrow indicates the size of DnaA and DnaB. Bottom arrow indicates the size of HA-DciA Mtb . (D) Western blot analysis of pull-downs with DnaB-FLAG as bait and DciA Mtb as prey. (E) Representative curves from BLI showing the association and dissociation of DciA Mtb at the indicated concentrations with immobilized biotinylated-DnaB. (F,G) Representative western blot of pull-downs with (F) DnaA-HA as bait and DnaB-FLAG as prey or (G) DnaB-FLAG as bait and DnaA-HA as prey and either no (lanes 1,6), 0.5x (lanes 2,7), 1x (lanes 3,8), 2x (lanes 4,9), or 4x (lanes 5,10) molar DciA Mtb relative to the bait. (H) Quantification of the ratio of prey-to-bait for triplicate western blots like those shown in (F) and (G) where the ratio for lanes with no DciA Mtb is set to 1 and the ratio for all other samples is relative to the lane with no DciA Mtb . Symbols represent each replicate, center values and error bars represent mean ± SEM. (I) Fold enrichment in levels of DNA fragments containing oriC ( oriC1-3 , see S8A Fig ), the promoter of the rplN operon ( rplN ), or the sigA coding sequence ( sigAIN ) in samples immunoprecipitated with an anti-HA antibody (αHA-IP) or input samples (input) from strains expressing untagged DciA Mtb (No tag, black bars) and HA-DciA Mtb (grey bars) strains. Data is represented as fold enrichment relative to No tag levels. Bars represent mean ± SEM (n = 5 except No tag sigAIN , which is n = 4). **** p
Figure Legend Snippet: DciA Mtb binds DNA, interacts directly with DnaB, and affects the DnaB-DnaA interaction. (A) Autoradiograph of EMSA with DciA Mtb protein and 4.8ng oriC Mtb dsDNA separated by native PAGE. All lanes contain 32 P-labeled oriC Mtb DNA. Amount of DciA Mtb in each lane is indicated. (B) Proteins involved in DNA replication or repair that were identified by MS analysis as co-immunoprecipitating with HA-DciA Mtb . (C) GelCode Blue-stained SDS-PAGE of pull-down experiments using HA-DciA Mtb , DnaB, and DnaA. Lanes 1–3 after ladder contain purified proteins used in pull-downs. Lanes 4–7 contain eluates from pull downs with immobilized HA-DciA Mtb incubated with DnaA (lanes 4–5) or DnaB (lanes 6–7). Proteins used were purified in the absence (lanes 4,6) or presence (lanes 5,7) of Benzonase (Benz.). Top arrow indicates the size of DnaA and DnaB. Bottom arrow indicates the size of HA-DciA Mtb . (D) Western blot analysis of pull-downs with DnaB-FLAG as bait and DciA Mtb as prey. (E) Representative curves from BLI showing the association and dissociation of DciA Mtb at the indicated concentrations with immobilized biotinylated-DnaB. (F,G) Representative western blot of pull-downs with (F) DnaA-HA as bait and DnaB-FLAG as prey or (G) DnaB-FLAG as bait and DnaA-HA as prey and either no (lanes 1,6), 0.5x (lanes 2,7), 1x (lanes 3,8), 2x (lanes 4,9), or 4x (lanes 5,10) molar DciA Mtb relative to the bait. (H) Quantification of the ratio of prey-to-bait for triplicate western blots like those shown in (F) and (G) where the ratio for lanes with no DciA Mtb is set to 1 and the ratio for all other samples is relative to the lane with no DciA Mtb . Symbols represent each replicate, center values and error bars represent mean ± SEM. (I) Fold enrichment in levels of DNA fragments containing oriC ( oriC1-3 , see S8A Fig ), the promoter of the rplN operon ( rplN ), or the sigA coding sequence ( sigAIN ) in samples immunoprecipitated with an anti-HA antibody (αHA-IP) or input samples (input) from strains expressing untagged DciA Mtb (No tag, black bars) and HA-DciA Mtb (grey bars) strains. Data is represented as fold enrichment relative to No tag levels. Bars represent mean ± SEM (n = 5 except No tag sigAIN , which is n = 4). **** p

Techniques Used: Autoradiography, Clear Native PAGE, Labeling, Mass Spectrometry, Staining, SDS Page, Purification, Incubation, Western Blot, Sequencing, Immunoprecipitation, Expressing

dciA Mtb depletion phenocopies dnaA depletion and not ftsZ depletion in M . smegmatis . (A) Fluorescence microscopy of rgm36, an acetamide-inducible dnaA depletion M . smegmatis strain [ 25 ], grown in the presence (top row) or absence (bottom two rows) of the acetamide (acet.) inducer pictured in brightfield, stained with DAPI for DNA, and stained with FM1-43FX for membrane. Blue arrows indicate areas free of DNA staining, while white chevrons indicate anucleate cells. Scale bars are 10 μm. (B) Cell length and (C) DNA occupation histograms of rgm36 cells after 24 hours of growth in depleting (-acet.) or replete (+acet.) conditions. (D) Table displays averages ± standard deviations from data depicted in histograms (B,C), along with p-values determined by Student’s t -test. (E) Fluorescence microscopy of csm362, a TetOn FtsZ depletion M . smegmatis strain, in the presence (top row) or absence (bottom two rows) of ATc pictured in brightfield, stained with DAPI for DNA, and stained with FM1-43FX for membrane. Scale bars are 10 μm. (F) Cell length and (G) % DNA occupation histograms of csm362 cells after 24 hours of growth in depleting (-ATc) or replete (+ATc) conditions. (H) Table displays averages ± standard deviations from data depicted in histograms (F,G), along with p-values determined by Student’s t -test.
Figure Legend Snippet: dciA Mtb depletion phenocopies dnaA depletion and not ftsZ depletion in M . smegmatis . (A) Fluorescence microscopy of rgm36, an acetamide-inducible dnaA depletion M . smegmatis strain [ 25 ], grown in the presence (top row) or absence (bottom two rows) of the acetamide (acet.) inducer pictured in brightfield, stained with DAPI for DNA, and stained with FM1-43FX for membrane. Blue arrows indicate areas free of DNA staining, while white chevrons indicate anucleate cells. Scale bars are 10 μm. (B) Cell length and (C) DNA occupation histograms of rgm36 cells after 24 hours of growth in depleting (-acet.) or replete (+acet.) conditions. (D) Table displays averages ± standard deviations from data depicted in histograms (B,C), along with p-values determined by Student’s t -test. (E) Fluorescence microscopy of csm362, a TetOn FtsZ depletion M . smegmatis strain, in the presence (top row) or absence (bottom two rows) of ATc pictured in brightfield, stained with DAPI for DNA, and stained with FM1-43FX for membrane. Scale bars are 10 μm. (F) Cell length and (G) % DNA occupation histograms of csm362 cells after 24 hours of growth in depleting (-ATc) or replete (+ATc) conditions. (H) Table displays averages ± standard deviations from data depicted in histograms (F,G), along with p-values determined by Student’s t -test.

Techniques Used: Fluorescence, Microscopy, Staining

38) Product Images from "Rational Design and Evaluation of an Artificial Escherichia coli K1 Protein Vaccine Candidate Based on the Structure of OmpA"

Article Title: Rational Design and Evaluation of an Artificial Escherichia coli K1 Protein Vaccine Candidate Based on the Structure of OmpA

Journal: Frontiers in Cellular and Infection Microbiology

doi: 10.3389/fcimb.2018.00172

Anti-OmpAVac antibodies contribute to OmpAVac-mediated protection. (A) Survival rates of mice challenged with a lethal dose of E. coli K1 RS218. Ten mice each in each groups were administered 3, 1, and 0.3 mg of anti-OmpAVac antibodies, respectively. Twenty-four hours later, the mice were challenged with a lethal dose of E. coli K1 RS218. The number of survivors was recorded daily for 14 days. Three mg of IgG purified from unimmunized mice was used as a negative control. The Kaplan-Meier test was employed for analysis of the survival rate. * indicates significant difference between vs PBS control group and non-specific mouse Ig group ( P
Figure Legend Snippet: Anti-OmpAVac antibodies contribute to OmpAVac-mediated protection. (A) Survival rates of mice challenged with a lethal dose of E. coli K1 RS218. Ten mice each in each groups were administered 3, 1, and 0.3 mg of anti-OmpAVac antibodies, respectively. Twenty-four hours later, the mice were challenged with a lethal dose of E. coli K1 RS218. The number of survivors was recorded daily for 14 days. Three mg of IgG purified from unimmunized mice was used as a negative control. The Kaplan-Meier test was employed for analysis of the survival rate. * indicates significant difference between vs PBS control group and non-specific mouse Ig group ( P

Techniques Used: Mouse Assay, Purification, Negative Control

Characterization of purified OmpAVac. (A) SDS-PAGE analysis of OmpAVac. The purity of OmpAVac was ~93.2%, as determined based on the density of the corresponding band in an SDS-PAGE gel. (B) Cross-linking assay of OmpAVac. The concentrations of glutaraldehyde in lanes 1–8 were 0, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5%, respectively. No oligomers or aggregates were observed. (C) Chromatography analysis of OmpAVac. OmpAVac produces a symmetrical peak at 14.0 mL, and the elution volumes of the protein standards CA (carbonic anhydrase) and R (ribonuclease A) were 12.2 and 13.7 mL, respectively. (D) Dynamic light-scattering analysis of OmpAVac resulted in a symmetrical peak with a diameter of 3.8 nm.
Figure Legend Snippet: Characterization of purified OmpAVac. (A) SDS-PAGE analysis of OmpAVac. The purity of OmpAVac was ~93.2%, as determined based on the density of the corresponding band in an SDS-PAGE gel. (B) Cross-linking assay of OmpAVac. The concentrations of glutaraldehyde in lanes 1–8 were 0, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5%, respectively. No oligomers or aggregates were observed. (C) Chromatography analysis of OmpAVac. OmpAVac produces a symmetrical peak at 14.0 mL, and the elution volumes of the protein standards CA (carbonic anhydrase) and R (ribonuclease A) were 12.2 and 13.7 mL, respectively. (D) Dynamic light-scattering analysis of OmpAVac resulted in a symmetrical peak with a diameter of 3.8 nm.

Techniques Used: Purification, SDS Page, Chromatography

OmpAVac induces a multifactorial immune response in mice. (A) The bar represents the titer of anti-loop1, anti-loop2, anti-loop3, anti-loop4, and anti-OmpAVac IgGs from OmpAVac-immunized mice. * indicates a significant difference ( P
Figure Legend Snippet: OmpAVac induces a multifactorial immune response in mice. (A) The bar represents the titer of anti-loop1, anti-loop2, anti-loop3, anti-loop4, and anti-OmpAVac IgGs from OmpAVac-immunized mice. * indicates a significant difference ( P

Techniques Used: Mouse Assay

OmpAVac vaccination confers protection against E. coli K1 infection. (A) Survival rates of mice challenged with a lethal dose of E. coli K1 RS218. Ten mice in each group were immunized with loop1, loop2, loop3, loop4, and OmpAVac 10 days prior to challenge. The number of survivors was recorded daily for 14 days. The Kaplan-Meier test was employed for analysis of the survival rate. * indicates a significant difference between the OmpVac-immunized group and the other groups. “ns” indicates no difference among loop1-, loop2-, loop3-, and loop4-immunized groups. (B) Change in the weights of immunized mice challenged with a sublethal dose of E. col i K1 RS218. The weight of each mouse was recorded daily for 14 days. The percentage of their initial weight is shown. * indicates a significant difference between the OmpAVac group and the remaining groups. (C) The bacterial load in the blood and spleen of immunized mice at 24 h after challenge with a sublethal dose of E. coli K1 RS218. The log values of the number of bacteria per mL of blood or gram of spleen are shown. The significance of the differences of bacteria load was determined by unpaired nonparametric tests (Mann Whitney test). * indicates a significant difference ( P
Figure Legend Snippet: OmpAVac vaccination confers protection against E. coli K1 infection. (A) Survival rates of mice challenged with a lethal dose of E. coli K1 RS218. Ten mice in each group were immunized with loop1, loop2, loop3, loop4, and OmpAVac 10 days prior to challenge. The number of survivors was recorded daily for 14 days. The Kaplan-Meier test was employed for analysis of the survival rate. * indicates a significant difference between the OmpVac-immunized group and the other groups. “ns” indicates no difference among loop1-, loop2-, loop3-, and loop4-immunized groups. (B) Change in the weights of immunized mice challenged with a sublethal dose of E. col i K1 RS218. The weight of each mouse was recorded daily for 14 days. The percentage of their initial weight is shown. * indicates a significant difference between the OmpAVac group and the remaining groups. (C) The bacterial load in the blood and spleen of immunized mice at 24 h after challenge with a sublethal dose of E. coli K1 RS218. The log values of the number of bacteria per mL of blood or gram of spleen are shown. The significance of the differences of bacteria load was determined by unpaired nonparametric tests (Mann Whitney test). * indicates a significant difference ( P

Techniques Used: Infection, Mouse Assay, MANN-WHITNEY

Anti-OmpAVac antibodies mediate opsonophagocytosis and inhibit bacterial attachment and invasion. (A) Opsonophagocytic assay of anti-OmpAVac antibodies. Sera from immunized mice were diluted and incubated with E. coli K1. The bar represents the percentage of killed bacteria in a series of dilutions. The data are presented as the means ± SE. Anti-OmpAVac antibodies showed marked bactericidal activity. * indicates a significant difference between anti-OmpAVac group and the unimmunized group ( P
Figure Legend Snippet: Anti-OmpAVac antibodies mediate opsonophagocytosis and inhibit bacterial attachment and invasion. (A) Opsonophagocytic assay of anti-OmpAVac antibodies. Sera from immunized mice were diluted and incubated with E. coli K1. The bar represents the percentage of killed bacteria in a series of dilutions. The data are presented as the means ± SE. Anti-OmpAVac antibodies showed marked bactericidal activity. * indicates a significant difference between anti-OmpAVac group and the unimmunized group ( P

Techniques Used: Opsonophagocytic Assay, Mouse Assay, Incubation, Activity Assay

Rational design of OmpAVac. (A) Schematic representation of OmpA (upper) and OmpAVac (lower). (B) Reactions of loop1, loop2, loop3 and loop4 of OmpA with sera from E. coli K1-infected patients. The optical density (OD) from ELISAs of each patient donor and the average of 10 health donors was shown. (C) Evaluation of the immunogenicity of loop1, loop2, loop3, and loop4 in the form of OmpA TM (transmembrane domain of OmpA) fused with MBP (maltose binding protein) tag. The titers of anti-loop1, anti-loop2, anti-loop3, and anti-loop4 antibodies from MBP-OmpA TM -immunized mice are shown. (D) Evaluation of the immunogenicity of loop1, loop2, loop3, and loop4 in the form of synthesized peptides. Mice were immunized with synthesized peptides encoding loop1, loop2, loop3, or loop4 of OmpA. The titers of the anti-loop1, anti-loop2, anti-loop3, and anti-loop4 antibodies are shown. The significance of the differences was determined by unpaired parametric tests (Student's t -test for two groups or one-way ANOVA for three or more groups). * indicates a significant difference when P- value is below 0.05, while “n.s.” indicates no significant difference.
Figure Legend Snippet: Rational design of OmpAVac. (A) Schematic representation of OmpA (upper) and OmpAVac (lower). (B) Reactions of loop1, loop2, loop3 and loop4 of OmpA with sera from E. coli K1-infected patients. The optical density (OD) from ELISAs of each patient donor and the average of 10 health donors was shown. (C) Evaluation of the immunogenicity of loop1, loop2, loop3, and loop4 in the form of OmpA TM (transmembrane domain of OmpA) fused with MBP (maltose binding protein) tag. The titers of anti-loop1, anti-loop2, anti-loop3, and anti-loop4 antibodies from MBP-OmpA TM -immunized mice are shown. (D) Evaluation of the immunogenicity of loop1, loop2, loop3, and loop4 in the form of synthesized peptides. Mice were immunized with synthesized peptides encoding loop1, loop2, loop3, or loop4 of OmpA. The titers of the anti-loop1, anti-loop2, anti-loop3, and anti-loop4 antibodies are shown. The significance of the differences was determined by unpaired parametric tests (Student's t -test for two groups or one-way ANOVA for three or more groups). * indicates a significant difference when P- value is below 0.05, while “n.s.” indicates no significant difference.

Techniques Used: Infection, Binding Assay, Mouse Assay, Synthesized

39) Product Images from "Blastocystis Legumain Is Localized on the Cell Surface, and Specific Inhibition of Its Activity Implicates a Pro-survival Role for the Enzyme *"

Article Title: Blastocystis Legumain Is Localized on the Cell Surface, and Specific Inhibition of Its Activity Implicates a Pro-survival Role for the Enzyme *

Journal:

doi: 10.1074/jbc.M109.049064

Expression, purification, and verification of Blastocystis legumain. The Blastocystis legumain gene was inserted into pGEX-6p-1 and expressed in E. coli BL21(DE3) with induction of 0.5 m m isopropyl 1-thio-β- d -galactopyranoside at 16 °C
Figure Legend Snippet: Expression, purification, and verification of Blastocystis legumain. The Blastocystis legumain gene was inserted into pGEX-6p-1 and expressed in E. coli BL21(DE3) with induction of 0.5 m m isopropyl 1-thio-β- d -galactopyranoside at 16 °C

Techniques Used: Expressing, Purification

40) Product Images from "Surface Exposure of the HIV-1 Env Cytoplasmic Tail LLP2 Domain during the Membrane Fusion Process"

Article Title: Surface Exposure of the HIV-1 Env Cytoplasmic Tail LLP2 Domain during the Membrane Fusion Process

Journal:

doi: 10.1074/jbc.M801083200

Binding specificity of antibodies directed against various anti-gp41 CT fragments. A, binding of LLP1–2- and LLP2-specific IgG to recombinant proteins LLP1–2, GST-LLP1, and GST-LLP2 in ELISA. B, binding of LLP1–2- and LLP2-specific
Figure Legend Snippet: Binding specificity of antibodies directed against various anti-gp41 CT fragments. A, binding of LLP1–2- and LLP2-specific IgG to recombinant proteins LLP1–2, GST-LLP1, and GST-LLP2 in ELISA. B, binding of LLP1–2- and LLP2-specific

Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay

Interaction of LLP1–2 or LLP2 with HIV-1 gp41 6-HB core. A, ELISA was performed to determine the binding activity of the recombinant protein LLP1–2, synthetic peptide LLP2, and mAb NC-1 to the peptides N36 and C34 and the 6-HB formed by
Figure Legend Snippet: Interaction of LLP1–2 or LLP2 with HIV-1 gp41 6-HB core. A, ELISA was performed to determine the binding activity of the recombinant protein LLP1–2, synthetic peptide LLP2, and mAb NC-1 to the peptides N36 and C34 and the 6-HB formed by

Techniques Used: Enzyme-linked Immunosorbent Assay, Binding Assay, Activity Assay, Recombinant

Inhibition of anti-gp41 CT antibodies on HIV-1 Env-mediated cell-cell fusion at suboptimal temperature. CHO-WT cells and 3T3-T4-CXCR4 cells were cocultured for 6 h in the presence of LLP1–2-, LLP1-, LLP2-specific IgG, anti-LLP1–2 IgG/LLP2,
Figure Legend Snippet: Inhibition of anti-gp41 CT antibodies on HIV-1 Env-mediated cell-cell fusion at suboptimal temperature. CHO-WT cells and 3T3-T4-CXCR4 cells were cocultured for 6 h in the presence of LLP1–2-, LLP1-, LLP2-specific IgG, anti-LLP1–2 IgG/LLP2,

Techniques Used: Inhibition

Inhibition of the recombinant protein LLP1–2 and synthetic peptide LLP2, respectively, on gp41 6-HB formation as measured by ELISA. ), was used as a control. The data represent triplicate determinations
Figure Legend Snippet: Inhibition of the recombinant protein LLP1–2 and synthetic peptide LLP2, respectively, on gp41 6-HB formation as measured by ELISA. ), was used as a control. The data represent triplicate determinations

Techniques Used: Inhibition, Recombinant, Enzyme-linked Immunosorbent Assay

Related Articles

Clone Assay:

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Article Title: Structural basis for recruitment of RILP by small GTPase Rab7
Article Snippet: .. Both full-length human Rab7 and the Rab7 binding domain of RILP (RILPe; residues 241–320) were cloned into pGEX-6p-1 (Amersham) and expressed as GST fusion protein in E. coli BL-21 cells. .. The GTP-restricted Rab7Q67L was constructed using the site-directed mutagenesis kit (Stratagene).

Article Title: NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane
Article Snippet: .. Expression and Purification of Recombinant Proteins The cDNA fragment corresponding to residues 487–523 of AAT-6 was cloned between BamHI and XhoI sites of pGEX-6P-1 (GE Healthcare). .. The plasmid was transformed into E. coli strain BL21 (DE3).

Amplification:

Article Title: Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production
Article Snippet: .. The full length cDNAs of human NEDD4 (900 amino acids, NP_006145) and human PTEN (403 amino acids, NP_000305) were prepared by PCR amplification and inserted into pGEX-6P-3 vector (GE Healthcare Bio-sciences, Piscataway, NJ). .. The recombinant NEDD4 or PTEN that was fused with glutathione S-transferase (GST) tag at N-terminus was expressed in Escherichia coli , BL21 codon plus (Stratagene, La Jolla, CA), and purified with Glutathione Sepharose 4B and PreScission protease (GE Healthcare Bio-sciences) under native condition according to supplier’s protocol.

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Binding Assay:

Article Title: Structural basis for recruitment of RILP by small GTPase Rab7
Article Snippet: .. Both full-length human Rab7 and the Rab7 binding domain of RILP (RILPe; residues 241–320) were cloned into pGEX-6p-1 (Amersham) and expressed as GST fusion protein in E. coli BL-21 cells. .. The GTP-restricted Rab7Q67L was constructed using the site-directed mutagenesis kit (Stratagene).

Mutagenesis:

Article Title: Aprataxin, causative gene product for EAOH/AOA1, repairs DNA single-strand breaks with damaged 3?-phosphate and 3?-phosphoglycolate ends
Article Snippet: .. Wild-type long-form aprataxin (LA) cDNA, the forkhead-associated (FHA) domain of aprataxin (1–114 amino acids; FHA), the splicing variant of aprataxin (175–343 amino acids, GenBank accession number NP_7782411; SA) and the mutant forms of aprataxin cDNA fragments were inserted into the BamHI/XhoI site of pGEX-6P-3 (GE Healthcare Bio-Science Corp.). .. Glutathione S-transferase (GST) fusion proteins were overexpressed in Rosetta 2 (DE3) pLysS (Novagen) bacterial cells containing these plasmids.

Purification:

Article Title: NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane
Article Snippet: .. Expression and Purification of Recombinant Proteins The cDNA fragment corresponding to residues 487–523 of AAT-6 was cloned between BamHI and XhoI sites of pGEX-6P-1 (GE Healthcare). .. The plasmid was transformed into E. coli strain BL21 (DE3).

Generated:

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Expressing:

Article Title: Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile
Article Snippet: .. To clone the cwp84 gene into the pGEX-6P-1 expression vector (Amersham Biosciences), two oligonucleotide primers, pGEXcwp84- Eco RI (5′GGGTA GAATTC AGAAAGTATAAATCA3′) and pGEXcwp84- Xho I (5′TCT CTCGAG TCACTATTTTCCTAAAAG3′), incorporating an Eco RI and Xho I site, respectively (underlined), were used to amplify by PCR the full-length coding region of the cwp84 gene of the 79685 strain. .. The resulting 2.4-kb DNA fragment was digested with the two enzymes and ligated (1 U of T4 ligase; Invitrogen) between the Eco RI and Xho I sites of pGEX-6P-1.

Article Title: NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane
Article Snippet: .. Expression and Purification of Recombinant Proteins The cDNA fragment corresponding to residues 487–523 of AAT-6 was cloned between BamHI and XhoI sites of pGEX-6P-1 (GE Healthcare). .. The plasmid was transformed into E. coli strain BL21 (DE3).

Polymerase Chain Reaction:

Article Title: Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile
Article Snippet: .. To clone the cwp84 gene into the pGEX-6P-1 expression vector (Amersham Biosciences), two oligonucleotide primers, pGEXcwp84- Eco RI (5′GGGTA GAATTC AGAAAGTATAAATCA3′) and pGEXcwp84- Xho I (5′TCT CTCGAG TCACTATTTTCCTAAAAG3′), incorporating an Eco RI and Xho I site, respectively (underlined), were used to amplify by PCR the full-length coding region of the cwp84 gene of the 79685 strain. .. The resulting 2.4-kb DNA fragment was digested with the two enzymes and ligated (1 U of T4 ligase; Invitrogen) between the Eco RI and Xho I sites of pGEX-6P-1.

Article Title: Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production
Article Snippet: .. The full length cDNAs of human NEDD4 (900 amino acids, NP_006145) and human PTEN (403 amino acids, NP_000305) were prepared by PCR amplification and inserted into pGEX-6P-3 vector (GE Healthcare Bio-sciences, Piscataway, NJ). .. The recombinant NEDD4 or PTEN that was fused with glutathione S-transferase (GST) tag at N-terminus was expressed in Escherichia coli , BL21 codon plus (Stratagene, La Jolla, CA), and purified with Glutathione Sepharose 4B and PreScission protease (GE Healthcare Bio-sciences) under native condition according to supplier’s protocol.

Article Title: Direct association of the reticulon protein RTN1A with the ryanodine receptor 2 in neurons
Article Snippet: .. GST-RTN1523 (aa 1–523; 5′-CT GGGATCC ATGGCCGCA CCGCCGGATCTGCAAG-3′ forward and 5′-CAG CCCGGG TCAATGATGATGATGATGAT GACCACGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse and GST-HHD (aa 376–523; 5′-AAT GGATCC CCAGTGGGCCAGGCGGCCGAC-3′ forward) and 5′-CAG CCCGGG TC AATGATGATGATGATGATGACCACCGCTGAGTATCGGGTCAGGTTCCACAG-3′ reverse) were generated by PCR amplification using rat full length RTN1A as a template , and cloned into pGEX-6P (Amersham Pharmacia). .. GST-LNT1 (aa 1–375, 5′-CTG GGATCC ATGG CCGCACCGCCGGATCTGCAAG-3′ forward and 5′-TCAATGATGATGATGATGATGCACT GGCCTT GGACTCTCGGTTG-3′ reverse) was generated by PCR amplification using GST-RTN1523 as a template and cloned into pGEX-6P.

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex
Article Snippet: .. To generate GST-tagged GLI1 deletion proteins, GLI1 cDNA fragments were subcloned by PCR and inserted into the pGEX-6P-1 vector (GE Healthcare). .. GST-GLI1 amino acid substitutions were generated by PCR using pGEX6P-1-GST-GLI1 deletion mutant plasmids as a template.

Recombinant:

Article Title: NRFL-1, the C. elegans NHERF Orthologue, Interacts with Amino Acid Transporter 6 (AAT-6) for Age-Dependent Maintenance of AAT-6 on the Membrane
Article Snippet: .. Expression and Purification of Recombinant Proteins The cDNA fragment corresponding to residues 487–523 of AAT-6 was cloned between BamHI and XhoI sites of pGEX-6P-1 (GE Healthcare). .. The plasmid was transformed into E. coli strain BL21 (DE3).

Variant Assay:

Article Title: Aprataxin, causative gene product for EAOH/AOA1, repairs DNA single-strand breaks with damaged 3?-phosphate and 3?-phosphoglycolate ends
Article Snippet: .. Wild-type long-form aprataxin (LA) cDNA, the forkhead-associated (FHA) domain of aprataxin (1–114 amino acids; FHA), the splicing variant of aprataxin (175–343 amino acids, GenBank accession number NP_7782411; SA) and the mutant forms of aprataxin cDNA fragments were inserted into the BamHI/XhoI site of pGEX-6P-3 (GE Healthcare Bio-Science Corp.). .. Glutathione S-transferase (GST) fusion proteins were overexpressed in Rosetta 2 (DE3) pLysS (Novagen) bacterial cells containing these plasmids.

Plasmid Preparation:

Article Title: Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile
Article Snippet: .. To clone the cwp84 gene into the pGEX-6P-1 expression vector (Amersham Biosciences), two oligonucleotide primers, pGEXcwp84- Eco RI (5′GGGTA GAATTC AGAAAGTATAAATCA3′) and pGEXcwp84- Xho I (5′TCT CTCGAG TCACTATTTTCCTAAAAG3′), incorporating an Eco RI and Xho I site, respectively (underlined), were used to amplify by PCR the full-length coding region of the cwp84 gene of the 79685 strain. .. The resulting 2.4-kb DNA fragment was digested with the two enzymes and ligated (1 U of T4 ligase; Invitrogen) between the Eco RI and Xho I sites of pGEX-6P-1.

Article Title: Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production
Article Snippet: .. The full length cDNAs of human NEDD4 (900 amino acids, NP_006145) and human PTEN (403 amino acids, NP_000305) were prepared by PCR amplification and inserted into pGEX-6P-3 vector (GE Healthcare Bio-sciences, Piscataway, NJ). .. The recombinant NEDD4 or PTEN that was fused with glutathione S-transferase (GST) tag at N-terminus was expressed in Escherichia coli , BL21 codon plus (Stratagene, La Jolla, CA), and purified with Glutathione Sepharose 4B and PreScission protease (GE Healthcare Bio-sciences) under native condition according to supplier’s protocol.

Article Title: MEP50/PRMT5-mediated methylation activates GLI1 in Hedgehog signalling through inhibition of ubiquitination by the ITCH/NUMB complex
Article Snippet: .. To generate GST-tagged GLI1 deletion proteins, GLI1 cDNA fragments were subcloned by PCR and inserted into the pGEX-6P-1 vector (GE Healthcare). .. GST-GLI1 amino acid substitutions were generated by PCR using pGEX6P-1-GST-GLI1 deletion mutant plasmids as a template.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    GE Healthcare e coli expression vector pgex 6p 1
    Expression, purification, and verification of Blastocystis legumain. The Blastocystis legumain gene was inserted into <t>pGEX-6p-1</t> and expressed in E. coli BL21(DE3) with induction of 0.5 m m isopropyl 1-thio-β- d -galactopyranoside at 16 °C
    E Coli Expression Vector Pgex 6p 1, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli expression vector pgex 6p 1/product/GE Healthcare
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli expression vector pgex 6p 1 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    90
    GE Healthcare pgex 6p 1 gst vector
    The metabolic enzyme PFKL is an A20-interacting protein. a LC-MS/MS identified an interaction between PFKL and A20. b , c PFKL binds with A20 directly. The interaction between endogenous A20 and PFKL was determined by co-IP and western blotting ( b ). Exogenous VC155-A20 and VN173-PFKL plasmids were transfected into Huh7 cells. Representative confocal pictures of BiFC signals (green) in Huh7 cells are shown ( c ). d <t>GST-PFKL</t> can readily pull-down A20. BL21 E. Coli were transformed with <t>pGEX-6P-1-GST-PFKL</t> plasmid and induced by isopropyl-b-D-thiogalactoside. Protein was purified by GST antibody-conjugated columns and incubated with Huh7 cell lysates and then repurified through immunoprecipitation and subjected to western blotting. e , f LPS enhances the interaction between A20 and PFKL. Huh7 cells were cultured with or without LPS for 4 h as indicated and then processed for double immunofluorescence with antibodies against PFKL (green) and A20 (red). Merged images of both channels are shown on the right. Bar: 10 mm ( e ). LPS promotes endogenous PFKL binding with A20 in Huh7 cells. Huh7 cells were pretreated with MG132 for 6 h, then with or without LPS for 4 h as indicated, followed by proximity ligation (Duolink®) assay. Confocal images of the PLA reaction between A20 and PFKL in Huh7 cells. The PLA signal is in red, and DAPI is in blue. Representative data from 3 independent biological experiments ( f ).
    Pgex 6p 1 Gst Vector, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst vector/product/GE Healthcare
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgex 6p 1 gst vector - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    85
    GE Healthcare pgex 6p 1 lhbsag 274 389
    Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to <t>389</t> were cloned into <t>pGEX-6p-1</t> for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.
    Pgex 6p 1 Lhbsag 274 389, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 lhbsag 274 389/product/GE Healthcare
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgex 6p 1 lhbsag 274 389 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    89
    GE Healthcare plasmid pgex 6p 1
    Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to 389 were cloned into <t>pGEX-6p-1</t> for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.
    Plasmid Pgex 6p 1, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 89/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pgex 6p 1/product/GE Healthcare
    Average 89 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    plasmid pgex 6p 1 - by Bioz Stars, 2020-05
    89/100 stars
      Buy from Supplier

    Image Search Results


    Expression, purification, and verification of Blastocystis legumain. The Blastocystis legumain gene was inserted into pGEX-6p-1 and expressed in E. coli BL21(DE3) with induction of 0.5 m m isopropyl 1-thio-β- d -galactopyranoside at 16 °C

    Journal:

    Article Title: Blastocystis Legumain Is Localized on the Cell Surface, and Specific Inhibition of Its Activity Implicates a Pro-survival Role for the Enzyme *

    doi: 10.1074/jbc.M109.049064

    Figure Lengend Snippet: Expression, purification, and verification of Blastocystis legumain. The Blastocystis legumain gene was inserted into pGEX-6p-1 and expressed in E. coli BL21(DE3) with induction of 0.5 m m isopropyl 1-thio-β- d -galactopyranoside at 16 °C

    Article Snippet: These primers contained BamHI and XhoI restriction sites to allow directional cloning into E. coli expression vector pGEX-6p-1 (GE Healthcare). pGEX-6p-1 containing the Blastocystis legumain gene was transformed into E. coli BL21(DE3) and amplified in 500 ml of LB containing 100 μg ml−1 ampicillin at 37 °C and 200 rpm.

    Techniques: Expressing, Purification

    The metabolic enzyme PFKL is an A20-interacting protein. a LC-MS/MS identified an interaction between PFKL and A20. b , c PFKL binds with A20 directly. The interaction between endogenous A20 and PFKL was determined by co-IP and western blotting ( b ). Exogenous VC155-A20 and VN173-PFKL plasmids were transfected into Huh7 cells. Representative confocal pictures of BiFC signals (green) in Huh7 cells are shown ( c ). d GST-PFKL can readily pull-down A20. BL21 E. Coli were transformed with pGEX-6P-1-GST-PFKL plasmid and induced by isopropyl-b-D-thiogalactoside. Protein was purified by GST antibody-conjugated columns and incubated with Huh7 cell lysates and then repurified through immunoprecipitation and subjected to western blotting. e , f LPS enhances the interaction between A20 and PFKL. Huh7 cells were cultured with or without LPS for 4 h as indicated and then processed for double immunofluorescence with antibodies against PFKL (green) and A20 (red). Merged images of both channels are shown on the right. Bar: 10 mm ( e ). LPS promotes endogenous PFKL binding with A20 in Huh7 cells. Huh7 cells were pretreated with MG132 for 6 h, then with or without LPS for 4 h as indicated, followed by proximity ligation (Duolink®) assay. Confocal images of the PLA reaction between A20 and PFKL in Huh7 cells. The PLA signal is in red, and DAPI is in blue. Representative data from 3 independent biological experiments ( f ).

    Journal: Cell Death & Disease

    Article Title: A20 targets PFKL and glycolysis to inhibit the progression of hepatocellular carcinoma

    doi: 10.1038/s41419-020-2278-6

    Figure Lengend Snippet: The metabolic enzyme PFKL is an A20-interacting protein. a LC-MS/MS identified an interaction between PFKL and A20. b , c PFKL binds with A20 directly. The interaction between endogenous A20 and PFKL was determined by co-IP and western blotting ( b ). Exogenous VC155-A20 and VN173-PFKL plasmids were transfected into Huh7 cells. Representative confocal pictures of BiFC signals (green) in Huh7 cells are shown ( c ). d GST-PFKL can readily pull-down A20. BL21 E. Coli were transformed with pGEX-6P-1-GST-PFKL plasmid and induced by isopropyl-b-D-thiogalactoside. Protein was purified by GST antibody-conjugated columns and incubated with Huh7 cell lysates and then repurified through immunoprecipitation and subjected to western blotting. e , f LPS enhances the interaction between A20 and PFKL. Huh7 cells were cultured with or without LPS for 4 h as indicated and then processed for double immunofluorescence with antibodies against PFKL (green) and A20 (red). Merged images of both channels are shown on the right. Bar: 10 mm ( e ). LPS promotes endogenous PFKL binding with A20 in Huh7 cells. Huh7 cells were pretreated with MG132 for 6 h, then with or without LPS for 4 h as indicated, followed by proximity ligation (Duolink®) assay. Confocal images of the PLA reaction between A20 and PFKL in Huh7 cells. The PLA signal is in red, and DAPI is in blue. Representative data from 3 independent biological experiments ( f ).

    Article Snippet: Briefly, Rosetta (DE3) Escherichia coli cells were transformed with the pGEX-6P-1-GST vector or pGEX-6P-1-GST-PFKL, and then, expression was induced using 0.5 mM IPTG at 16 °C for 16 h. The E. coli were lysed, and the extracts were incubated with glutathione–Sepharose 4B beads (17075601; GE Healthcare Biosciences AB) at 4 °C for 1 h. The beads were then incubated with purified GFP-tagged A20, which were prepared through IP, for an additional 4 h. Proteins that had interacted were eluted in elution buffer (50 mM Tris-HCl pH 8.0 and 20 mM reduced glutathione) and were subjected to immunoblotting using anti-GFP antibody.

    Techniques: Liquid Chromatography with Mass Spectroscopy, Co-Immunoprecipitation Assay, Western Blot, Transfection, Bimolecular Fluorescence Complementation Assay, Transformation Assay, Plasmid Preparation, Purification, Incubation, Immunoprecipitation, Cell Culture, Immunofluorescence, Binding Assay, Ligation, Proximity Ligation Assay

    Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to 389 were cloned into pGEX-6p-1 for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.

    Journal: Journal of Virology

    Article Title: Entry of Hepatitis B Virus into Immortalized Human Primary Hepatocytes by Clathrin-Dependent Endocytosis

    doi: 10.1128/JVI.00873-12

    Figure Lengend Snippet: Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to 389 were cloned into pGEX-6p-1 for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.

    Article Snippet: To generate plasmids pGEX-6p-1-LHBsAg(1-111), pGEX-6p-1-LHBsAg(111-274), and pGEX-6p-1-LHBsAg(274-389), coding for glutathione S -transferase (GST)–LHBsAg1-111 , GST–LHBsAg111-274 , and GST–LHBsAg274-389 , respectively, a KpnI/EcoRI fragment (394 bp), EcoRI/BamHI fragment (489 bp), or BamHI/ApaI fragment (323 bp) was obtained from pcDNA3.0-HA-LHBsAg and subcloned, respectively, into the SmaI, SalI, or BamHI/SmaI site of plasmid pGEX-6P-1 (GE Healthcare Biosciences) following a blunt-end reaction.

    Techniques: Western Blot, Clone Assay, Expressing, Purification, GST Pulldown Assay, Incubation, Transfection, Plasmid Preparation, Immunoprecipitation

    Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to 389 were cloned into pGEX-6p-1 for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.

    Journal: Journal of Virology

    Article Title: Entry of Hepatitis B Virus into Immortalized Human Primary Hepatocytes by Clathrin-Dependent Endocytosis

    doi: 10.1128/JVI.00873-12

    Figure Lengend Snippet: Interaction between LHBsAg and CHC or AP-2. (A) (Top) Schematic representation of the amino acid (a.a.) residues within the LHBsAg subdomains, designated pre-S1, pre-S2, and S; (bottom) Western blot results when LHBsAg cDNA fragments coding for amino acids 1 to 111, 111 to 274, or 274 to 389 were cloned into pGEX-6p-1 for expression in E. coli and purification as GST fusion proteins and antibodies against GST were used to detect the expression of the GST fusion proteins. Arrowheads, leaky expression of proteins. (B) GST pulldown assay. GST-LHBsAg fusion proteins or GST bound to glutathione-Sepharose 4B beads were incubated with lysates of HuS-E/2 cells, and then, after GST pulldown, Western blot analysis was performed using antibodies against CHC, AP-1, AP-2, or GST. The positions of molecular mass markers are shown on the left. (C and D) Coimmunoprecipitation and Western blot analysis. HuS-E/2 cells were transfected with plasmid pcDNA3.0-HA-LHBsAg, pcDNA3.0-HA-MHBsAg, or pcDNA3.0-HA-SHBsAg coding, respectively, for HA-tagged LHBsAg, MHBsAg, or SHBsAg, and then, at 2 days posttransfection, the cells were harvested and subjected to immunoprecipitation (IP) with antibodies specific for HA (C) or CHC (D), followed by Western blot analysis with antibodies against HA, AP-2, or CHC, as indicated. NT, nontransfected cells. The molecular mass markers are indicated on the left. Asterisks, proteins coimmunoprecipitated with CHC; arrowheads, nonspecific bands.

    Article Snippet: To determine whether clathrin, AP-1, and AP-2 were involved in HBV infection of human primary hepatocytes, a GST pulldown assay was performed on lysates of HuS-E/2 cells. cDNAs coding for amino acids 1 to 111, 111 to 274, and 274 to 389 of LHBsAg fused to GST were generated ( ) and cloned into plasmid pGEX-6p-1, and their expression in E. coli was examined by Western blot analysis.

    Techniques: Western Blot, Clone Assay, Expressing, Purification, GST Pulldown Assay, Incubation, Transfection, Plasmid Preparation, Immunoprecipitation