Structured Review

GE Healthcare wasp gbd peptides
Domain architecture of <t>WASP.</t> Structural domains and regions with assigned function of WASP are highlighted as follows: the Ena/VASP homology domain 1 ( EVH1, gray ); the basic region ( BR, blue ); the G protein-binding domain ( <t>GBD,</t> orange ); the central proline-rich domain ( PRD ); the verprolin homology ( V, red ); central ( C, red ); and acidic region ( A, yellow ). WASP exists in an autoinhibited conformation when not bound by effectors, and the BR and A regions and the CV and GBD regions form contacts that prevent the VCA region binding and activating Arp2/3. Only WASP residues 225–275, which include the BR and residues of the GBD mutated in this study, are expanded to show their sequence below , and the residues selected for mutagenesis are highlighted . Residues colored black are CRIB consensus residues, which were all subject to mutation in this study; residues outside the CRIB region mutated in this work are colored red. The CRIB consensus sequence is also included. Secondary structure elements in WASP when bound to Cdc42 are shown above the sequence. β-Strands are denoted by arrows and the helix by a cylinder . The limits of the secondary structure elements are taken from Ref. 14 with amendments included from Ref. 29 . The accession number for WASP is UniProt no. P42768.
Wasp Gbd Peptides, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 964 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wasp gbd peptides/product/GE Healthcare
Average 93 stars, based on 964 article reviews
Price from $9.99 to $1999.99
wasp gbd peptides - by Bioz Stars, 2020-04
93/100 stars

Images

1) Product Images from "Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region"

Article Title: Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA118.003290

Domain architecture of WASP. Structural domains and regions with assigned function of WASP are highlighted as follows: the Ena/VASP homology domain 1 ( EVH1, gray ); the basic region ( BR, blue ); the G protein-binding domain ( GBD, orange ); the central proline-rich domain ( PRD ); the verprolin homology ( V, red ); central ( C, red ); and acidic region ( A, yellow ). WASP exists in an autoinhibited conformation when not bound by effectors, and the BR and A regions and the CV and GBD regions form contacts that prevent the VCA region binding and activating Arp2/3. Only WASP residues 225–275, which include the BR and residues of the GBD mutated in this study, are expanded to show their sequence below , and the residues selected for mutagenesis are highlighted . Residues colored black are CRIB consensus residues, which were all subject to mutation in this study; residues outside the CRIB region mutated in this work are colored red. The CRIB consensus sequence is also included. Secondary structure elements in WASP when bound to Cdc42 are shown above the sequence. β-Strands are denoted by arrows and the helix by a cylinder . The limits of the secondary structure elements are taken from Ref. 14 with amendments included from Ref. 29 . The accession number for WASP is UniProt no. P42768.
Figure Legend Snippet: Domain architecture of WASP. Structural domains and regions with assigned function of WASP are highlighted as follows: the Ena/VASP homology domain 1 ( EVH1, gray ); the basic region ( BR, blue ); the G protein-binding domain ( GBD, orange ); the central proline-rich domain ( PRD ); the verprolin homology ( V, red ); central ( C, red ); and acidic region ( A, yellow ). WASP exists in an autoinhibited conformation when not bound by effectors, and the BR and A regions and the CV and GBD regions form contacts that prevent the VCA region binding and activating Arp2/3. Only WASP residues 225–275, which include the BR and residues of the GBD mutated in this study, are expanded to show their sequence below , and the residues selected for mutagenesis are highlighted . Residues colored black are CRIB consensus residues, which were all subject to mutation in this study; residues outside the CRIB region mutated in this work are colored red. The CRIB consensus sequence is also included. Secondary structure elements in WASP when bound to Cdc42 are shown above the sequence. β-Strands are denoted by arrows and the helix by a cylinder . The limits of the secondary structure elements are taken from Ref. 14 with amendments included from Ref. 29 . The accession number for WASP is UniProt no. P42768.

Techniques Used: Protein Binding, Binding Assay, Sequencing, Mutagenesis

Direct SPA-binding data for the WASP GBD and mutant BR variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD BR variants, as appropriate, in each SPA. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 3 .
Figure Legend Snippet: Direct SPA-binding data for the WASP GBD and mutant BR variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD BR variants, as appropriate, in each SPA. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 3 .

Techniques Used: Binding Assay, Mutagenesis, Concentration Assay, Labeling, Incubation, Variant Assay

Structural analysis of mutational effects. A, schematic representation of part of the Cdc42/WASP–GBD structure (Ref. 14 and PDB 1CEE ) showing the contacts made by Ile-233 and Ile-238 WASP . The van der Waals surfaces of relevant residues are shown either as a mesh or a semi-transparent surface (using the PyMOL default solvent radius of 1.4 Å). Cdc42 is colored green , and WASP is colored blue. B , schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Phe-244 WASP . Coloring is as in A. C, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Pro-241 WASP . Coloring is as in A. D , schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by His-246 WASP and His-249 WASP . Coloring is as in A. E, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Val-250 WASP . Coloring is as in A. F, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Ser-242 WASP . Coloring is as in A. G, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Lys-235 WASP . Coloring is as in A. H, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Trp-252 WASP . Coloring is as in A . Where highlighted, oxygen atoms are colored red and nitrogen in blue . Magnesium is shown as an orange sphere .
Figure Legend Snippet: Structural analysis of mutational effects. A, schematic representation of part of the Cdc42/WASP–GBD structure (Ref. 14 and PDB 1CEE ) showing the contacts made by Ile-233 and Ile-238 WASP . The van der Waals surfaces of relevant residues are shown either as a mesh or a semi-transparent surface (using the PyMOL default solvent radius of 1.4 Å). Cdc42 is colored green , and WASP is colored blue. B , schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Phe-244 WASP . Coloring is as in A. C, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Pro-241 WASP . Coloring is as in A. D , schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by His-246 WASP and His-249 WASP . Coloring is as in A. E, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Val-250 WASP . Coloring is as in A. F, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Ser-242 WASP . Coloring is as in A. G, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Lys-235 WASP . Coloring is as in A. H, schematic representation of part of the Cdc42/WASP–GBD structure showing the contacts made by Trp-252 WASP . Coloring is as in A . Where highlighted, oxygen atoms are colored red and nitrogen in blue . Magnesium is shown as an orange sphere .

Techniques Used:

Direct SPA-binding data for the WASP GBD and mutant variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD variants, as appropriate. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. A, binding of representative mutants in the WASP GBD to Cdc42. B, binding of WASP BR hexa-mutant and C-terminal deletion mutant to Cdc42. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 2 .
Figure Legend Snippet: Direct SPA-binding data for the WASP GBD and mutant variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD variants, as appropriate. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. A, binding of representative mutants in the WASP GBD to Cdc42. B, binding of WASP BR hexa-mutant and C-terminal deletion mutant to Cdc42. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 2 .

Techniques Used: Binding Assay, Mutagenesis, Concentration Assay, Labeling, Incubation, Variant Assay

Key differences in ACK and WASP binding to Cdc42. A, alignment of the ACK GBD and WASP BR–GBD sequences. The UniProt accession number for WASP is P42768 and for ACK is Q07912. Residues are colored according to their effect on equilibrium constant: gray, 0–5-fold increase; green, 5–10-fold increase; blue , 10–50-fold increase; orange , 50–100-fold increase; red , 100 or greater fold increase. The CRIB region, N- and C-terminal BR triads, and N- and C-terminal regions of the GBDs are labeled. B, schematic representation of part of the Cdc42–WASP GBD ( yellow/magenta , PDB code 1CEE ( 14 )) and Cdc42–ACK GBD ( green/cyan , respectively, PDB code 1CF4 ( 12 )) structures highlighting Pro-241 WASP and Pro-457 ACK . C, schematic representation of part of the Cdc42–WASP GBD ( yellow/magenta , PDB code 1CEE ( 14 )) and Cdc42–ACK GBD ( green/cyan , respectively, PDB code 1CF4 ( 12 )) structures highlighting the positions of the C-terminal regions of the WASP and ACK GBDs. Coloring is as in B . The nucleotide is shown as a stick representation, colored orange .
Figure Legend Snippet: Key differences in ACK and WASP binding to Cdc42. A, alignment of the ACK GBD and WASP BR–GBD sequences. The UniProt accession number for WASP is P42768 and for ACK is Q07912. Residues are colored according to their effect on equilibrium constant: gray, 0–5-fold increase; green, 5–10-fold increase; blue , 10–50-fold increase; orange , 50–100-fold increase; red , 100 or greater fold increase. The CRIB region, N- and C-terminal BR triads, and N- and C-terminal regions of the GBDs are labeled. B, schematic representation of part of the Cdc42–WASP GBD ( yellow/magenta , PDB code 1CEE ( 14 )) and Cdc42–ACK GBD ( green/cyan , respectively, PDB code 1CF4 ( 12 )) structures highlighting Pro-241 WASP and Pro-457 ACK . C, schematic representation of part of the Cdc42–WASP GBD ( yellow/magenta , PDB code 1CEE ( 14 )) and Cdc42–ACK GBD ( green/cyan , respectively, PDB code 1CF4 ( 12 )) structures highlighting the positions of the C-terminal regions of the WASP and ACK GBDs. Coloring is as in B . The nucleotide is shown as a stick representation, colored orange .

Techniques Used: Binding Assay, Labeling

2) Product Images from "Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts"

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts

Journal: Structure (London, England : 1993)

doi: 10.1016/j.str.2017.07.014

NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .
Figure Legend Snippet: NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .

Techniques Used: Nuclear Magnetic Resonance, Isolation, Construct, Labeling

Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .
Figure Legend Snippet: Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .

Techniques Used: Mutagenesis, Western Blot, Activity Assay

3) Product Images from "Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival"

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival

Journal: PLoS ONE

doi: 10.1371/journal.pone.0007254

HPV-16 E7 influences the balance between oxidized and reduced GSTP1. A: Western blots for GSTP1 after non-reducing SDS-PAGE in control and in HPV-16 E7-infected HaCaT cells under normal conditions (untreated) or after induction of oxidative stress by exposure to UV (UVB, 5 mJ/cm 2 for 1 min) or hydrogen peroxide (0.5 mM H 2 O 2 for 30 min). In the first case, detection was performed after a 90 min or 5 h recovery period, while in the second case detection was performed after a 6 h period. In all cases, HPV-16 E7 expression was accompanied by a drastic decrease in the GSTP1 oxidized multimeric form (GSTP1 multimer ox ) and of the lowest band, which represents the oxidized GSTP1 monomer (GSTP1 monomer ox ). GSTP1 monomer red denotes the reduced form. B: Western blots for GSTP1 after non-reducing SDS-PAGE in control, HPV-16 E7- and HPV-16 E7 Mut-infected HaCaT cells after exposure to UV (UVB, 5 mJ/cm 2 for 1 min) and 5 h recovery. The mutant oncoprotein appeared less efficient in protecting GSTP1 from oxidation. In both panels, blots were normalized against β-actin levels that were determined in matching gels run under reducing conditions.
Figure Legend Snippet: HPV-16 E7 influences the balance between oxidized and reduced GSTP1. A: Western blots for GSTP1 after non-reducing SDS-PAGE in control and in HPV-16 E7-infected HaCaT cells under normal conditions (untreated) or after induction of oxidative stress by exposure to UV (UVB, 5 mJ/cm 2 for 1 min) or hydrogen peroxide (0.5 mM H 2 O 2 for 30 min). In the first case, detection was performed after a 90 min or 5 h recovery period, while in the second case detection was performed after a 6 h period. In all cases, HPV-16 E7 expression was accompanied by a drastic decrease in the GSTP1 oxidized multimeric form (GSTP1 multimer ox ) and of the lowest band, which represents the oxidized GSTP1 monomer (GSTP1 monomer ox ). GSTP1 monomer red denotes the reduced form. B: Western blots for GSTP1 after non-reducing SDS-PAGE in control, HPV-16 E7- and HPV-16 E7 Mut-infected HaCaT cells after exposure to UV (UVB, 5 mJ/cm 2 for 1 min) and 5 h recovery. The mutant oncoprotein appeared less efficient in protecting GSTP1 from oxidation. In both panels, blots were normalized against β-actin levels that were determined in matching gels run under reducing conditions.

Techniques Used: Western Blot, SDS Page, Infection, Expressing, Mutagenesis

Roles of HPV-16 E7 and GSTP1 and their interaction in cell survival after UV exposure. A: After exposure to UV radiation (UVB, 5 mJ/cm 2 for 1 min), control and HPV-16 E7-expressing HaCaT cells showed a significant correlation between HPV-16 E7 expression and cell survival ( p = 0.000003, ***). Under the same conditions, GSTP1-deficient MCF-7 cells displayed no significant differences in survival, and thus no HPV-16 E7-related protection. Forced expression of GSTP1 in control and HPV-16 E7-infected MCF-7 cells restored the ability of HPV-16 E7 to protect against UV-induced cell death ( p = 0.0046, **). Values are the averages of three independent experiments performed in triplicate±SEM. B: Control, HPV-16 E7- and HPV-16 E7 Mut-infected HaCaT cells were transfected with non-targeting (NT) siRNA or with siRNA targeting GSTP1. After 72 h, GSTP1 siRNA-treated cells showed decreased GSTP1 protein expression. C: Cells, exposed to UV radiation as above, were collected and the number of Trypan blue-negative (live) cells was determined. The differential survival rate between cells unexposed and exposed to UV radiation was then calculated, and the results were expressed as percentages of dead cells after UV exposure. The results show a remarkable effect of HPV-16 E7 on cell survival (bars 1 vs. 3), a less effective protection by HPV-16 E7 Mut (bars 1 vs. 5), and the consequences of GSTP1 silencing in HPV-16 E7- (bars 3 vs. 4) and HPV-16 E7 Mut- expressing cells (bars 5 vs. 6). This panel indicates the role of GSTP1 in HPV-16 E7-induced cell survival and the importance of the binding ability of the oncoprotein in inducing the GSTP1-mediated increase in survival. Values are the average of three independent experiments performed in triplicate±SEM. Statistical significance of the reported values: bars 1 vs. 3 p = 0.00004, ***; bars 1 vs. 5 p = 0.0009, ***; bars 3 vs. 5 p = 0.000004, ***; bars 3 vs. 4 p = 0.0002, ***; bars 5 vs. 6 p = 0.0001, ***; bars 2 vs. 4 p = 0.0288, *; bars 4 vs. 6 p = 0.0007, ***.
Figure Legend Snippet: Roles of HPV-16 E7 and GSTP1 and their interaction in cell survival after UV exposure. A: After exposure to UV radiation (UVB, 5 mJ/cm 2 for 1 min), control and HPV-16 E7-expressing HaCaT cells showed a significant correlation between HPV-16 E7 expression and cell survival ( p = 0.000003, ***). Under the same conditions, GSTP1-deficient MCF-7 cells displayed no significant differences in survival, and thus no HPV-16 E7-related protection. Forced expression of GSTP1 in control and HPV-16 E7-infected MCF-7 cells restored the ability of HPV-16 E7 to protect against UV-induced cell death ( p = 0.0046, **). Values are the averages of three independent experiments performed in triplicate±SEM. B: Control, HPV-16 E7- and HPV-16 E7 Mut-infected HaCaT cells were transfected with non-targeting (NT) siRNA or with siRNA targeting GSTP1. After 72 h, GSTP1 siRNA-treated cells showed decreased GSTP1 protein expression. C: Cells, exposed to UV radiation as above, were collected and the number of Trypan blue-negative (live) cells was determined. The differential survival rate between cells unexposed and exposed to UV radiation was then calculated, and the results were expressed as percentages of dead cells after UV exposure. The results show a remarkable effect of HPV-16 E7 on cell survival (bars 1 vs. 3), a less effective protection by HPV-16 E7 Mut (bars 1 vs. 5), and the consequences of GSTP1 silencing in HPV-16 E7- (bars 3 vs. 4) and HPV-16 E7 Mut- expressing cells (bars 5 vs. 6). This panel indicates the role of GSTP1 in HPV-16 E7-induced cell survival and the importance of the binding ability of the oncoprotein in inducing the GSTP1-mediated increase in survival. Values are the average of three independent experiments performed in triplicate±SEM. Statistical significance of the reported values: bars 1 vs. 3 p = 0.00004, ***; bars 1 vs. 5 p = 0.0009, ***; bars 3 vs. 5 p = 0.000004, ***; bars 3 vs. 4 p = 0.0002, ***; bars 5 vs. 6 p = 0.0001, ***; bars 2 vs. 4 p = 0.0288, *; bars 4 vs. 6 p = 0.0007, ***.

Techniques Used: Expressing, Infection, Transfection, Binding Assay

HPV-16 E7 physically interacts with GSTP1. A: HaCaT cell lysate was incubated with the S. japonicum GST-HPV-16 E7 chimeric protein. Co-precipitated proteins were separated by SDS-PAGE and visualized after silver staining. The dotted arrow indicates the band that was cut out and identified by peptide mass fingerprinting as human GSTP1. B: In vitro interaction of radiolabeled IVT HPV-16 E7 with N-6His-GSTP1 recombinant protein and lack of interaction with control N-6His-RCC1 recombinant protein. C: Western blot for GSTP1 after immunoprecipitation with an anti-T7 Tag antibody (to precipitate tagged HPV-16 E7), in control and HPV-16 E7-transfected Phoenix cells shows co-precipitation of GSTP1 only in HPV-16 E7-expressing cells. D: Western blot for GSTP1 after immunoprecipitation with an anti-HPV-16 E7 antibody in control and HPV-16 E7-expressing HaCaT cells shows co-precipitation of GSTP1 only in HPV-16 E7-expressing cells. E: Western blot using an anti-HA antibody (to detect tagged HPV-16 E7) after immunoprecipitation with an anti-GSTP1 antibody in control and HPV-16 E7-expressing HaCaT cells shows co-precipitation of HPV-16 E7. F: Western blot for GSTP1 after immunoprecipitation with an anti-HPV-16 E7 antibody in control and HPV-16 E7-expressing HaCaT cells as well as in the CaSki and SiHa cell lines expressing endogenous HPV-16 E7. G: In vitro interaction of radiolabeled IVT HPV-33 E7 and HPV-18 E7 with N-6His-GSTP1 recombinant protein and lack of interaction with control N-6His-RCC1 recombinant protein.
Figure Legend Snippet: HPV-16 E7 physically interacts with GSTP1. A: HaCaT cell lysate was incubated with the S. japonicum GST-HPV-16 E7 chimeric protein. Co-precipitated proteins were separated by SDS-PAGE and visualized after silver staining. The dotted arrow indicates the band that was cut out and identified by peptide mass fingerprinting as human GSTP1. B: In vitro interaction of radiolabeled IVT HPV-16 E7 with N-6His-GSTP1 recombinant protein and lack of interaction with control N-6His-RCC1 recombinant protein. C: Western blot for GSTP1 after immunoprecipitation with an anti-T7 Tag antibody (to precipitate tagged HPV-16 E7), in control and HPV-16 E7-transfected Phoenix cells shows co-precipitation of GSTP1 only in HPV-16 E7-expressing cells. D: Western blot for GSTP1 after immunoprecipitation with an anti-HPV-16 E7 antibody in control and HPV-16 E7-expressing HaCaT cells shows co-precipitation of GSTP1 only in HPV-16 E7-expressing cells. E: Western blot using an anti-HA antibody (to detect tagged HPV-16 E7) after immunoprecipitation with an anti-GSTP1 antibody in control and HPV-16 E7-expressing HaCaT cells shows co-precipitation of HPV-16 E7. F: Western blot for GSTP1 after immunoprecipitation with an anti-HPV-16 E7 antibody in control and HPV-16 E7-expressing HaCaT cells as well as in the CaSki and SiHa cell lines expressing endogenous HPV-16 E7. G: In vitro interaction of radiolabeled IVT HPV-33 E7 and HPV-18 E7 with N-6His-GSTP1 recombinant protein and lack of interaction with control N-6His-RCC1 recombinant protein.

Techniques Used: Incubation, SDS Page, Silver Staining, Peptide Mass Fingerprinting, In Vitro, Recombinant, Western Blot, Immunoprecipitation, Transfection, Expressing

Docking of HPV-16 E7 to GSTP1. A: Docking of the GSTP1 monomer (from chain A of PDB entry 1AQW, represented as a protein surface) and the HPV-16 E7 CR3 dimer (modeled in this study and represented as a protein backbone with the two subunits distinguished by green and orange colors). The portions of the GSTP1 surface that contribute the Cys 47 and Cys 101 residues are highlighted in yellow. In the drawing, we have retained the structure of one glutathione molecule co-crystallized with GSTP1 in the PDB entry 1AQW to show its binding position (enzyme G-site). To show the enzymatic region that binds substrates (H-site of GSTP1), we have included the structure of the anticancer drug chlorambucil reproducing the same binding position as in its co-crystal with GSTP1 (PDB structure 21GS). B: In the docking model, the region of the GSTP1 monomer (surface representation) that is in contact with the HPV-16 E7 CR3 dimer (orange and green tube representation) is depicted in dark blue. C: The region of contact between one GSTP1 subunit (surface representation) and the other GSTP1 subunit (green tube representation) in the enzyme homodimer (PDB entry 1AQW) is depicted in dark blue. In panels B and C, regions of contact on the GSTP1 surfaces are identified as residues located within 5 Å of the ligand (HPV-16 E7 CR3 or the second GSTP1 unit) and appear to partially overlap.
Figure Legend Snippet: Docking of HPV-16 E7 to GSTP1. A: Docking of the GSTP1 monomer (from chain A of PDB entry 1AQW, represented as a protein surface) and the HPV-16 E7 CR3 dimer (modeled in this study and represented as a protein backbone with the two subunits distinguished by green and orange colors). The portions of the GSTP1 surface that contribute the Cys 47 and Cys 101 residues are highlighted in yellow. In the drawing, we have retained the structure of one glutathione molecule co-crystallized with GSTP1 in the PDB entry 1AQW to show its binding position (enzyme G-site). To show the enzymatic region that binds substrates (H-site of GSTP1), we have included the structure of the anticancer drug chlorambucil reproducing the same binding position as in its co-crystal with GSTP1 (PDB structure 21GS). B: In the docking model, the region of the GSTP1 monomer (surface representation) that is in contact with the HPV-16 E7 CR3 dimer (orange and green tube representation) is depicted in dark blue. C: The region of contact between one GSTP1 subunit (surface representation) and the other GSTP1 subunit (green tube representation) in the enzyme homodimer (PDB entry 1AQW) is depicted in dark blue. In panels B and C, regions of contact on the GSTP1 surfaces are identified as residues located within 5 Å of the ligand (HPV-16 E7 CR3 or the second GSTP1 unit) and appear to partially overlap.

Techniques Used: Binding Assay

Identification of HPV-16 E7 peptide sequences involved in the interaction with GSTP1. The entire HPV-16 E7 amino acid sequence, reproduced as 12-mers with a 9 amino acid overlap, was synthesized on 30 different polypropylene rods. The histogram represents the ability of each 12-mer oligopeptide to bind recombinant GSTP1. The histogram corresponding to the 30 th rod refers to amino acids 88–99 because a Gly has been added to the last C-terminal HPV-16 E7 amino acid in order to complete the 12-mer. Values are averages of three different experiments±SD.
Figure Legend Snippet: Identification of HPV-16 E7 peptide sequences involved in the interaction with GSTP1. The entire HPV-16 E7 amino acid sequence, reproduced as 12-mers with a 9 amino acid overlap, was synthesized on 30 different polypropylene rods. The histogram represents the ability of each 12-mer oligopeptide to bind recombinant GSTP1. The histogram corresponding to the 30 th rod refers to amino acids 88–99 because a Gly has been added to the last C-terminal HPV-16 E7 amino acid in order to complete the 12-mer. Values are averages of three different experiments±SD.

Techniques Used: Sequencing, Synthesized, Recombinant

GSTP1 activities in HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells. A: A representative Western blot for GSTP1 in control cells and HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells. Blots were normalized against β-actin levels. B: GSTP1 enzymatic activity in control, in HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells (see Materials and Methods ). Values are averages of three different experiments±SEM and their variations were not statistically significant. C: JNK protein levels in control and in HPV-16 E7- and in HPV-16 E7 Mut-expressing HaCaT cells that were untreated or cells that were sampled after induction of oxidative stress by exposure to UV (UVB, 5 mJ/cm 2 for 1 min) with a 5 h recovery period, evaluated using an antibody specific for the phosphorylated form of JNK (pJNK) and another antibody that detects total JNK levels (JNK, performed on a separate twin gel). Only after UV exposure did HPV-16 E7-expressing cells display a markedly reduced JNK phosphorylation, while a lower reduction in JNK phosphorylation was detectable in HPV-16 E7 Mut-expressing cells.
Figure Legend Snippet: GSTP1 activities in HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells. A: A representative Western blot for GSTP1 in control cells and HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells. Blots were normalized against β-actin levels. B: GSTP1 enzymatic activity in control, in HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells (see Materials and Methods ). Values are averages of three different experiments±SEM and their variations were not statistically significant. C: JNK protein levels in control and in HPV-16 E7- and in HPV-16 E7 Mut-expressing HaCaT cells that were untreated or cells that were sampled after induction of oxidative stress by exposure to UV (UVB, 5 mJ/cm 2 for 1 min) with a 5 h recovery period, evaluated using an antibody specific for the phosphorylated form of JNK (pJNK) and another antibody that detects total JNK levels (JNK, performed on a separate twin gel). Only after UV exposure did HPV-16 E7-expressing cells display a markedly reduced JNK phosphorylation, while a lower reduction in JNK phosphorylation was detectable in HPV-16 E7 Mut-expressing cells.

Techniques Used: Expressing, Western Blot, Activity Assay

Generation of HPV-16 E7 Mut and its in vitro interaction with GSTP1 and pRb. A. Legend as in Figure 3A . The red spheres shown on one HPV-16 E7 subunit (green tube representation) highlight the alpha-carbon atoms of amino acid residues 49–60, while the blue spheres highlight the alpha-carbons of amino acid residues 88–98 (see Figure 2 ). The residues Val 55, Phe 57 and Met 84, mutated in HPV-16 E7 Mut, are highlighted by the white clouds. B: In vitro interaction of radiolabeled IVT HPV-16 E7, but not of HPV-16 E7 Mut, with N-6His-GSTP1 recombinant protein. N-6His-RCC1 recombinant protein was used as a negative control. C: In vitro interaction of radiolabeled IVT HPV-16 E7 and HPV-16 E7 Mut with recombinant S. japonicum GST-pRb protein. S. japonicum GST was used as a negative control. D: Western blot for GSTP1 after immunoprecipitation with an anti-HA antibody (to precipitate tagged HPV-16 E7 and HPV-16 E7 Mut), in control, HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells shows a less efficient co-precipitation of GSTP1 in HPV-16 E7 Mut-expressing cells; the same membrane was probed using an anti-HA antibody to assess the efficiency of the immunoprecipitation procedure. Cell lysate was from HPV-16 E7-infected HaCaT cells. E: Reverse co-precipitation: Western blot for HA (to detect tagged HPV-16 E7 and HPV-16 E7 Mut) after immunoprecipitation with an anti-GSTP1 antibody in control, HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells shows a less efficient co-precipitation of HPV-16 E7 Mut with GSTP1 when compared to HPV-16 E7; the same membrane was probed using an anti-GSTP1 antibody to assess the efficiency of the immunoprecipitation procedure. Cell lysate was from HPV-16 E7-infected HaCaT cells.
Figure Legend Snippet: Generation of HPV-16 E7 Mut and its in vitro interaction with GSTP1 and pRb. A. Legend as in Figure 3A . The red spheres shown on one HPV-16 E7 subunit (green tube representation) highlight the alpha-carbon atoms of amino acid residues 49–60, while the blue spheres highlight the alpha-carbons of amino acid residues 88–98 (see Figure 2 ). The residues Val 55, Phe 57 and Met 84, mutated in HPV-16 E7 Mut, are highlighted by the white clouds. B: In vitro interaction of radiolabeled IVT HPV-16 E7, but not of HPV-16 E7 Mut, with N-6His-GSTP1 recombinant protein. N-6His-RCC1 recombinant protein was used as a negative control. C: In vitro interaction of radiolabeled IVT HPV-16 E7 and HPV-16 E7 Mut with recombinant S. japonicum GST-pRb protein. S. japonicum GST was used as a negative control. D: Western blot for GSTP1 after immunoprecipitation with an anti-HA antibody (to precipitate tagged HPV-16 E7 and HPV-16 E7 Mut), in control, HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells shows a less efficient co-precipitation of GSTP1 in HPV-16 E7 Mut-expressing cells; the same membrane was probed using an anti-HA antibody to assess the efficiency of the immunoprecipitation procedure. Cell lysate was from HPV-16 E7-infected HaCaT cells. E: Reverse co-precipitation: Western blot for HA (to detect tagged HPV-16 E7 and HPV-16 E7 Mut) after immunoprecipitation with an anti-GSTP1 antibody in control, HPV-16 E7- and HPV-16 E7 Mut-expressing HaCaT cells shows a less efficient co-precipitation of HPV-16 E7 Mut with GSTP1 when compared to HPV-16 E7; the same membrane was probed using an anti-GSTP1 antibody to assess the efficiency of the immunoprecipitation procedure. Cell lysate was from HPV-16 E7-infected HaCaT cells.

Techniques Used: In Vitro, Recombinant, Negative Control, Western Blot, Immunoprecipitation, Expressing, Infection

4) Product Images from "Direct cleavage of ROCK II by granzyme B induces target cell membrane blebbing in a caspase-independent manner"

Article Title: Direct cleavage of ROCK II by granzyme B induces target cell membrane blebbing in a caspase-independent manner

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20031877

Properties of cleaved ROCK II. (a) MCF-7 cells were either left untransfected (lanes A, B, and J) or transiently transfected with either wild-type (WT; lanes C, D, and K) or mutated D1131A (lanes E, F, and L) or truncated Δ1131 (lanes G, H, and M) ROCK II constructs tagged in NH 2 terminus with the AU1 peptide. 22 h after transfection, in vitro pull-down assay was performed: lysates were incubated with GDP-bound (A, C, E, and G) or GTP-bound (B, D, F, and H) GST-RhoA, and precipitated proteins were analyzed by Western blotting with anti-AU1 (top) or anti–ROCK II COOH terminus (bottom) antibody. Controls are Western blot analysis of GST Rho alone (I) and lysates of cells left untransfected (J) or transfected with either WT (K) or D1131A (L) or Δ1131 (M) AU-1–tagged constructs, indicating equal expression of the three transfected constructs in the tested cells. The blot was reprobed with the anti–ROCK II COOH terminus antibody to verify homogenous pull-down efficiency. (b) In vitro kinase assay. 293T cells were either left untransfected (lanes A and E) or transiently transfected with either WT (lanes B and F) or truncated Δ1131 (lanes C and G) AU1-tagged ROCK II constructs. 24 h later, cells were lysed, and exogenous ROCK II proteins were immunoprecipitated using the anti-AU1 antibody (IP AU1) and assayed for kinase activity in vitro with myelin basic protein as a substrate (bottom, IVK, in vitro kinase assay). Beads alone were used as a control (lane D, Ac beads). The efficiency of immunoprecipitation was determined by Western blotting using an anti-AU1 antibody (top, lanes A–D) with simultaneous analysis of constructs expression with an aliquot of cell lysates as controls (lanes E–G).
Figure Legend Snippet: Properties of cleaved ROCK II. (a) MCF-7 cells were either left untransfected (lanes A, B, and J) or transiently transfected with either wild-type (WT; lanes C, D, and K) or mutated D1131A (lanes E, F, and L) or truncated Δ1131 (lanes G, H, and M) ROCK II constructs tagged in NH 2 terminus with the AU1 peptide. 22 h after transfection, in vitro pull-down assay was performed: lysates were incubated with GDP-bound (A, C, E, and G) or GTP-bound (B, D, F, and H) GST-RhoA, and precipitated proteins were analyzed by Western blotting with anti-AU1 (top) or anti–ROCK II COOH terminus (bottom) antibody. Controls are Western blot analysis of GST Rho alone (I) and lysates of cells left untransfected (J) or transfected with either WT (K) or D1131A (L) or Δ1131 (M) AU-1–tagged constructs, indicating equal expression of the three transfected constructs in the tested cells. The blot was reprobed with the anti–ROCK II COOH terminus antibody to verify homogenous pull-down efficiency. (b) In vitro kinase assay. 293T cells were either left untransfected (lanes A and E) or transiently transfected with either WT (lanes B and F) or truncated Δ1131 (lanes C and G) AU1-tagged ROCK II constructs. 24 h later, cells were lysed, and exogenous ROCK II proteins were immunoprecipitated using the anti-AU1 antibody (IP AU1) and assayed for kinase activity in vitro with myelin basic protein as a substrate (bottom, IVK, in vitro kinase assay). Beads alone were used as a control (lane D, Ac beads). The efficiency of immunoprecipitation was determined by Western blotting using an anti-AU1 antibody (top, lanes A–D) with simultaneous analysis of constructs expression with an aliquot of cell lysates as controls (lanes E–G).

Techniques Used: Transfection, Construct, In Vitro, Pull Down Assay, Incubation, Western Blot, Expressing, Kinase Assay, Immunoprecipitation, Activity Assay

5) Product Images from "A set of ligation-independent in vitro translation vectors for eukaryotic protein production"

Article Title: A set of ligation-independent in vitro translation vectors for eukaryotic protein production

Journal: BMC Biotechnology

doi: 10.1186/1472-6750-8-32

SDS-PAGE analysis of in vitro translated proteins . A . CEFC translation reactions with pEU3-NII backbone vector constructs: Molecular weight marker (M), wheat germ extract control (C), 1 μl out of 50 μl in vitro translation reaction mixture with pEU3-NII-HLIC (H) or pEU3-NII-GLIC (G) vector. B . Bilayer translation reactions with pEU-E01 backbone vector constructs: Molecular weight marker (M), wheat germ extract (C), 5 μl out of 225 μl in vitro translation reaction mixture with pEU-E01-HLIC (H) or pEU-E01-GLIC (G) vector. Proteins present in the translation mixtures were separated on 12% SDS-PAGE gel and detected by Coomassie Blue staining. Vector encoded-kinases are indicated by asterisks.
Figure Legend Snippet: SDS-PAGE analysis of in vitro translated proteins . A . CEFC translation reactions with pEU3-NII backbone vector constructs: Molecular weight marker (M), wheat germ extract control (C), 1 μl out of 50 μl in vitro translation reaction mixture with pEU3-NII-HLIC (H) or pEU3-NII-GLIC (G) vector. B . Bilayer translation reactions with pEU-E01 backbone vector constructs: Molecular weight marker (M), wheat germ extract (C), 5 μl out of 225 μl in vitro translation reaction mixture with pEU-E01-HLIC (H) or pEU-E01-GLIC (G) vector. Proteins present in the translation mixtures were separated on 12% SDS-PAGE gel and detected by Coomassie Blue staining. Vector encoded-kinases are indicated by asterisks.

Techniques Used: SDS Page, In Vitro, Plasmid Preparation, Construct, Molecular Weight, Marker, Staining

6) Product Images from "Analysis of Polymorphic Membrane Protein Expression in Cultured Cells Identifies PmpA and PmpH of Chlamydia psittaci as Candidate Factors in Pathogenesis and Immunity to Infection"

Article Title: Analysis of Polymorphic Membrane Protein Expression in Cultured Cells Identifies PmpA and PmpH of Chlamydia psittaci as Candidate Factors in Pathogenesis and Immunity to Infection

Journal: PLoS ONE

doi: 10.1371/journal.pone.0162392

pmpE1-E2 and pmpH-G2 are organized in operons. Based on co-linearity, 6 putative operons were identified: pmpE2-E1 , pmpG8-G5-G2-H , pmpG3-G7 , pmpG1b-G1d pmpG4-G6-G1c , and pmpA-B . cDNAs generated at 24, 32 and 48 hpi were amplified by RT-PCR using specific primers spanning the intergenic regions ( Table 2 ). Only results for pmpE1-E2 and pmpH-G2 are presented as amplicons were not detected for all other intergenic regions. M: MassRuler Low Range DNA ladder (Thermo Scientific); +C: positive control C . psittaci Cal10 genomic DNA; -C HeLa: negative control cDNA from uninfected HeLa cells; RT/NRT: with or without reverse transcriptase.
Figure Legend Snippet: pmpE1-E2 and pmpH-G2 are organized in operons. Based on co-linearity, 6 putative operons were identified: pmpE2-E1 , pmpG8-G5-G2-H , pmpG3-G7 , pmpG1b-G1d pmpG4-G6-G1c , and pmpA-B . cDNAs generated at 24, 32 and 48 hpi were amplified by RT-PCR using specific primers spanning the intergenic regions ( Table 2 ). Only results for pmpE1-E2 and pmpH-G2 are presented as amplicons were not detected for all other intergenic regions. M: MassRuler Low Range DNA ladder (Thermo Scientific); +C: positive control C . psittaci Cal10 genomic DNA; -C HeLa: negative control cDNA from uninfected HeLa cells; RT/NRT: with or without reverse transcriptase.

Techniques Used: Generated, Amplification, Reverse Transcription Polymerase Chain Reaction, Positive Control, Negative Control

Guinea pig polyclonal antibodies against PmpA, B, D and H are specific for their respective immunizing antigens. (A) The specificity of polyclonal antibodies raised against rPmpA (anti-PmpA), rPmpB (anti-PmpB), rPmpD (anti-PmpD) and rPmpH (anti-PmpH) was verified by immunoblotting using (A) partially purified recombinant PmpA, B, D, E1, G3 and H as well as (B) density gradient purified EBs of C . psittaci Cal10. The calculated molecular masses of recombinant PmpA, PmpB, PmpD, PmpE1, PmpH and PmpG3 are 92 kDa, 74 kDa, 95 kDa, 74 kDa, 88 kDa and 60 kDa, respectively. The observed molecular masses were 75 kDa, 74 kDa, 95 kDa, 70 kDa, 75 kDa and 60 kDa, respectively. (B) The calculated and observed molecular masses of the protein bands detected in EBs are shown.
Figure Legend Snippet: Guinea pig polyclonal antibodies against PmpA, B, D and H are specific for their respective immunizing antigens. (A) The specificity of polyclonal antibodies raised against rPmpA (anti-PmpA), rPmpB (anti-PmpB), rPmpD (anti-PmpD) and rPmpH (anti-PmpH) was verified by immunoblotting using (A) partially purified recombinant PmpA, B, D, E1, G3 and H as well as (B) density gradient purified EBs of C . psittaci Cal10. The calculated molecular masses of recombinant PmpA, PmpB, PmpD, PmpE1, PmpH and PmpG3 are 92 kDa, 74 kDa, 95 kDa, 74 kDa, 88 kDa and 60 kDa, respectively. The observed molecular masses were 75 kDa, 74 kDa, 95 kDa, 70 kDa, 75 kDa and 60 kDa, respectively. (B) The calculated and observed molecular masses of the protein bands detected in EBs are shown.

Techniques Used: Purification, Recombinant

PmpA and PmpH localize to the chlamydial inner and outer membranes, to the inclusion membrane and to small putative outer membrane vesicles. C . psittaci infected HeLa cells were fixed at late times (24 and 48 hpi) and stained with primary PmpA- or PmpH-specific antibody and secondary gold conjugated goat anti-guinea pig antibody. Localization of PmpA and PmpH in the chlamydial inner (IM) and outer (OM) membranes (top row, long arrows), in the inclusion membrane (middle row, short arrows) and in putative OMVs (bottom row, arrowheads) is shown as indicated. Bars = 0.1 μm.
Figure Legend Snippet: PmpA and PmpH localize to the chlamydial inner and outer membranes, to the inclusion membrane and to small putative outer membrane vesicles. C . psittaci infected HeLa cells were fixed at late times (24 and 48 hpi) and stained with primary PmpA- or PmpH-specific antibody and secondary gold conjugated goat anti-guinea pig antibody. Localization of PmpA and PmpH in the chlamydial inner (IM) and outer (OM) membranes (top row, long arrows), in the inclusion membrane (middle row, short arrows) and in putative OMVs (bottom row, arrowheads) is shown as indicated. Bars = 0.1 μm.

Techniques Used: Infection, Staining

PmpA and PmpH stain more heavily in the chlamydial envelope than MOMP. (A) C . psittaci infected HeLa cells were fixed at 24 hpi and stained with primary Pmp-specific antibody and secondary gold conjugated goat anti-guinea pig antibody. Subcellular localization did not change at 48 hpi (not shown). Bars = 0.1 μm. (B) C . psittaci infected HeLa cells were fixed 24 hpi, labeled with MOMP-, PmpA- and PmpH- specific antibodies and secondary gold conjugated goat anti-rabbit or gold conjugated goat anti-guinea pig antibody and the number of immunogold particles was counted on 100 chlamydiae. Error bars are based on standard error of the mean. Different letters indicate statistically significant differences (P
Figure Legend Snippet: PmpA and PmpH stain more heavily in the chlamydial envelope than MOMP. (A) C . psittaci infected HeLa cells were fixed at 24 hpi and stained with primary Pmp-specific antibody and secondary gold conjugated goat anti-guinea pig antibody. Subcellular localization did not change at 48 hpi (not shown). Bars = 0.1 μm. (B) C . psittaci infected HeLa cells were fixed 24 hpi, labeled with MOMP-, PmpA- and PmpH- specific antibodies and secondary gold conjugated goat anti-rabbit or gold conjugated goat anti-guinea pig antibody and the number of immunogold particles was counted on 100 chlamydiae. Error bars are based on standard error of the mean. Different letters indicate statistically significant differences (P

Techniques Used: Staining, Infection, Labeling

7) Product Images from "Glutamate dependent NMDA receptor 2D is a novel angiogenic tumour endothelial marker in colorectal cancer"

Article Title: Glutamate dependent NMDA receptor 2D is a novel angiogenic tumour endothelial marker in colorectal cancer

Journal: Oncotarget

doi: 10.18632/oncotarget.7812

Loss of GRIN2D impairs endothelial function in in vitro angiogenesis assays GRIN2D was knocked down by transfection of two siRNA duplexes into 3 separate HUVEC isolates. A–C , the cells were plated on matrigel and endothelial tube formation and integrity observed over 16 hours. A, representative images of tube formation in each condition. B, the average number of nodes per field of view ± SEM. C, the average number of sprouts per node ± SEM (n=6 per condition [ 3 ] and isolate [ 3 ]). D–E. HUVEC were plated and allowed to grow to confluence. The monolayer was scratched and wound closure observed at nine scratch intersections over time. D, representative images of wound closure from initial scratch to end-stage. E, quantification of percentage wound closure over the time course of the experiment ± SEM (n=9 per condition [ 3 ] and isolate [ 3 ]). F–G. HUVEC were subjected to the transfilter (modified Boyden chamber) assay, the set up of which is shown in F. G, quantification of the average percentage of endothelial cells that have migrated through the filter, after 16 hours, per field of view ± SEM (n=6 per condition [ 3 ] and isolate [ 3 ]). Statistical analysis for all, Mann-Whitney U, *** p
Figure Legend Snippet: Loss of GRIN2D impairs endothelial function in in vitro angiogenesis assays GRIN2D was knocked down by transfection of two siRNA duplexes into 3 separate HUVEC isolates. A–C , the cells were plated on matrigel and endothelial tube formation and integrity observed over 16 hours. A, representative images of tube formation in each condition. B, the average number of nodes per field of view ± SEM. C, the average number of sprouts per node ± SEM (n=6 per condition [ 3 ] and isolate [ 3 ]). D–E. HUVEC were plated and allowed to grow to confluence. The monolayer was scratched and wound closure observed at nine scratch intersections over time. D, representative images of wound closure from initial scratch to end-stage. E, quantification of percentage wound closure over the time course of the experiment ± SEM (n=9 per condition [ 3 ] and isolate [ 3 ]). F–G. HUVEC were subjected to the transfilter (modified Boyden chamber) assay, the set up of which is shown in F. G, quantification of the average percentage of endothelial cells that have migrated through the filter, after 16 hours, per field of view ± SEM (n=6 per condition [ 3 ] and isolate [ 3 ]). Statistical analysis for all, Mann-Whitney U, *** p

Techniques Used: In Vitro, Transfection, Modification, Boyden Chamber Assay, MANN-WHITNEY

GRIN2D is a specific marker of tumour vasculature in colorectal cancer A. quantitative real-time analysis of relative candidate target gene levels in endothelium isolated from malignant and healthy tissue. Gene expression levels were normalised to flotillin-2. Average gene expression ± SEM (n=8, Mann-Whitney U, *** p
Figure Legend Snippet: GRIN2D is a specific marker of tumour vasculature in colorectal cancer A. quantitative real-time analysis of relative candidate target gene levels in endothelium isolated from malignant and healthy tissue. Gene expression levels were normalised to flotillin-2. Average gene expression ± SEM (n=8, Mann-Whitney U, *** p

Techniques Used: Marker, Isolation, Expressing, MANN-WHITNEY

The physiological effects of GRIN2D-Fc vaccination A-B. quantitation of immune response to vaccination with GRIN2D-Fc fusion protein by ELISA, showing A, overall response and B, IgG specific response. Vaccinated mice had sponges introduced into their flank and angiogenesis was stimulated into the sponge with FGF infusions. C. representative images of macroscopic vascular invasion into the sponge in the treated and untreated groups. A mask was generated in image J [54] for each sponge and the percentage sponge invasion quantified, D, E. representative H E images of subcutaneous sponge morphology. F. quantitation from the H E images of sponge vessel density. Statistical analysis for all, Mann-Whitney U, ***P
Figure Legend Snippet: The physiological effects of GRIN2D-Fc vaccination A-B. quantitation of immune response to vaccination with GRIN2D-Fc fusion protein by ELISA, showing A, overall response and B, IgG specific response. Vaccinated mice had sponges introduced into their flank and angiogenesis was stimulated into the sponge with FGF infusions. C. representative images of macroscopic vascular invasion into the sponge in the treated and untreated groups. A mask was generated in image J [54] for each sponge and the percentage sponge invasion quantified, D, E. representative H E images of subcutaneous sponge morphology. F. quantitation from the H E images of sponge vessel density. Statistical analysis for all, Mann-Whitney U, ***P

Techniques Used: Quantitation Assay, Enzyme-linked Immunosorbent Assay, Mouse Assay, Generated, MANN-WHITNEY

GRIN2D-Fc vaccination decreases subcutaneous CT26 tumour growth and vascularity CT26 tumour cells were inoculated into vaccinated and non-vaccinated Balb/c mice. A. tumour growth was monitored by caliper measurement. Tumours were excised at day 21, imaged, B. and weighed, C, D. representative H E images of subcutaneous tumour morphology. E. quantitation from the H E images of tumour vessel density. Statistical analysis for all, Mann-Whitney U, ***P
Figure Legend Snippet: GRIN2D-Fc vaccination decreases subcutaneous CT26 tumour growth and vascularity CT26 tumour cells were inoculated into vaccinated and non-vaccinated Balb/c mice. A. tumour growth was monitored by caliper measurement. Tumours were excised at day 21, imaged, B. and weighed, C, D. representative H E images of subcutaneous tumour morphology. E. quantitation from the H E images of tumour vessel density. Statistical analysis for all, Mann-Whitney U, ***P

Techniques Used: Mouse Assay, Quantitation Assay, MANN-WHITNEY

8) Product Images from "Structural Basis for Par-4 Recognition by the SPRY Domain- and SOCS Box-Containing Proteins SPSB1, SPSB2, and SPSB4"

Article Title: Structural Basis for Par-4 Recognition by the SPRY Domain- and SOCS Box-Containing Proteins SPSB1, SPSB2, and SPSB4

Journal: Journal of Molecular Biology

doi: 10.1016/j.jmb.2010.06.017

Identification of key interacting residues of mSPSB2. (a) Comparison of HSQC spectra of 0.1 mM uniformly N-labeled mSPSB2 (12–224) , free (red) and in a 1:1 complex with hPar-4 (59–77) (blue). Spectra were recorded in 95% H 2 O/5% 2 H 2 O, pH 6.7, 295 K, at 500 MHz. The red peaks are labeled with sequence-specific assignments for free mSPSB2 (12–224) using the one-letter code and sequence positions (black). Conserved residues of GUSTAVUS and three SPSB proteins that are important for GUSTAVUS/VASA 10 and mSPSB2/hPar-4 5 interactions are represented in cyan. Aliased resonances arising from Arg side chains of mSPSB2 are shown in red (free) and blue (complex) square boxes as these were due to different spectra widths used in the 15 N dimension. (b) Weighted average chemical shift variations of 15 N and 1 H between free and bound forms of 15 N-labeled mSPSB2 (12–224) . Cyan asterisks represent those residues that are conserved in GUSTAVUS, mSPSB1, mSPSB2, and mSPSB4 and have been shown to be involved in GUSTAVUS binding to VASA, 10 except for mSPSB2 E55, where L66 is found in GUSTAVUS, mSPSB1, and mSPSB4. Orange asterisks indicate those residues that are known to be involved in mSPSB2/hPar-4 interaction according to a previous study. 5 Horizontal lines show cutoffs for weighted average chemical shift differences of 0.02 and 0.04 ppm. The Trp207 peak is from the indole NH; the backbone amide resonance for this residue is close to the water resonance 5,21 and difficult to follow.
Figure Legend Snippet: Identification of key interacting residues of mSPSB2. (a) Comparison of HSQC spectra of 0.1 mM uniformly N-labeled mSPSB2 (12–224) , free (red) and in a 1:1 complex with hPar-4 (59–77) (blue). Spectra were recorded in 95% H 2 O/5% 2 H 2 O, pH 6.7, 295 K, at 500 MHz. The red peaks are labeled with sequence-specific assignments for free mSPSB2 (12–224) using the one-letter code and sequence positions (black). Conserved residues of GUSTAVUS and three SPSB proteins that are important for GUSTAVUS/VASA 10 and mSPSB2/hPar-4 5 interactions are represented in cyan. Aliased resonances arising from Arg side chains of mSPSB2 are shown in red (free) and blue (complex) square boxes as these were due to different spectra widths used in the 15 N dimension. (b) Weighted average chemical shift variations of 15 N and 1 H between free and bound forms of 15 N-labeled mSPSB2 (12–224) . Cyan asterisks represent those residues that are conserved in GUSTAVUS, mSPSB1, mSPSB2, and mSPSB4 and have been shown to be involved in GUSTAVUS binding to VASA, 10 except for mSPSB2 E55, where L66 is found in GUSTAVUS, mSPSB1, and mSPSB4. Orange asterisks indicate those residues that are known to be involved in mSPSB2/hPar-4 interaction according to a previous study. 5 Horizontal lines show cutoffs for weighted average chemical shift differences of 0.02 and 0.04 ppm. The Trp207 peak is from the indole NH; the backbone amide resonance for this residue is close to the water resonance 5,21 and difficult to follow.

Techniques Used: Labeling, Sequencing, Binding Assay

9) Product Images from "Osteopontin Fragments with Intact Thrombin-Sensitive Site Circulate in Cervical Cancer Patients"

Article Title: Osteopontin Fragments with Intact Thrombin-Sensitive Site Circulate in Cervical Cancer Patients

Journal: PLoS ONE

doi: 10.1371/journal.pone.0160412

Types of OPN antigens and their characterization. A) Map of human OPN protein showing the various fragments (OPN-O, OPN-P) produced as GST fusion proteins in bacteria and as V5-tagged fusion proteins in insect cells. Numericals denote amino-acid numbering of protein. Shown are the cleavage sites of caspase-8 and various metalloproteinases (MMP-3, -7, -9), the integrin binding sites (αvβ1, αvβ3, αvβ5, α9β1 and α4β1) and the CD44-binding site. Binding sites of the pair of antibodies used in the OPN detection kit marketed by IBL, Gunma, Japan, are indicated by dashed lines. The sequence surrounding the thrombin-sensitive site is also shown. B) Demonstration of the purity of the bacterially-derived recombinant fusion proteins (OPN-O-GST and OPN-P-GST) isolated by affinity chromatography, separated on 12.5% SDS-PAGE gel and stained by Coomassie Blue. The starting material (crude lysate), the OPN-O-GST antigen (*), the OPN-P-GST antigen (#), and mol. wt. markers, are shown. C) WB results identifying the fusion proteins (OPN-O-V5 [*], OPN-P-V5 [#]) derived from insect cells. Cell lysates were separated on 12.5% SDS-PAGE gel and probed with anti-V5 antibody. Lysate of un-infected insect cells (Sf9) included as negative control.
Figure Legend Snippet: Types of OPN antigens and their characterization. A) Map of human OPN protein showing the various fragments (OPN-O, OPN-P) produced as GST fusion proteins in bacteria and as V5-tagged fusion proteins in insect cells. Numericals denote amino-acid numbering of protein. Shown are the cleavage sites of caspase-8 and various metalloproteinases (MMP-3, -7, -9), the integrin binding sites (αvβ1, αvβ3, αvβ5, α9β1 and α4β1) and the CD44-binding site. Binding sites of the pair of antibodies used in the OPN detection kit marketed by IBL, Gunma, Japan, are indicated by dashed lines. The sequence surrounding the thrombin-sensitive site is also shown. B) Demonstration of the purity of the bacterially-derived recombinant fusion proteins (OPN-O-GST and OPN-P-GST) isolated by affinity chromatography, separated on 12.5% SDS-PAGE gel and stained by Coomassie Blue. The starting material (crude lysate), the OPN-O-GST antigen (*), the OPN-P-GST antigen (#), and mol. wt. markers, are shown. C) WB results identifying the fusion proteins (OPN-O-V5 [*], OPN-P-V5 [#]) derived from insect cells. Cell lysates were separated on 12.5% SDS-PAGE gel and probed with anti-V5 antibody. Lysate of un-infected insect cells (Sf9) included as negative control.

Techniques Used: Produced, Binding Assay, Sequencing, Derivative Assay, Recombinant, Isolation, Affinity Chromatography, SDS Page, Staining, Western Blot, Infection, Negative Control

Characterization of the OPN-specific mouse mAbs. A) ELISA results showing binding specificity of the various mAbs (mAb 659, 446, and 492) to various OPN antigens (OPN-O-GST, OPN-P-GST, OPN-O-V5, OPN-P-V5, and full-length OPN), including TCA-GST (control negative containing human telomerase segment). Anti-V5 antibody (V5) and BSA are included as positive and negative control, respectively. B) ELISA results showing titration curves of individual mAbs (mAb 659, 446, and 492) against OPN-O-GST, OPN-P-GST or full-length OPN. C) Inhibition ELISA results showing mAb 659 and 446 do not cross-inhibit each other. Left panel shows the inability of mAb 659 to inhibit binding of biotin-labeled mAb 446 and the converse for right panel. D) Western blot results showing specific detection of the various insect cells-derived OPN antigens (OPN-O-V5, OPN-P-V5) by the various mAbs; 15% gel used; Sf9 is control insect-cell lysate. E) IFA results showing specific binding by various mAbs to insect cells expressing the appropriate OPN-O-V5 or OPN-P-V5 protein (magnification: 400 x). Anti-V5 antibody (V5) and normal mouse serum (N) used as positive and negative control, respectively.
Figure Legend Snippet: Characterization of the OPN-specific mouse mAbs. A) ELISA results showing binding specificity of the various mAbs (mAb 659, 446, and 492) to various OPN antigens (OPN-O-GST, OPN-P-GST, OPN-O-V5, OPN-P-V5, and full-length OPN), including TCA-GST (control negative containing human telomerase segment). Anti-V5 antibody (V5) and BSA are included as positive and negative control, respectively. B) ELISA results showing titration curves of individual mAbs (mAb 659, 446, and 492) against OPN-O-GST, OPN-P-GST or full-length OPN. C) Inhibition ELISA results showing mAb 659 and 446 do not cross-inhibit each other. Left panel shows the inability of mAb 659 to inhibit binding of biotin-labeled mAb 446 and the converse for right panel. D) Western blot results showing specific detection of the various insect cells-derived OPN antigens (OPN-O-V5, OPN-P-V5) by the various mAbs; 15% gel used; Sf9 is control insect-cell lysate. E) IFA results showing specific binding by various mAbs to insect cells expressing the appropriate OPN-O-V5 or OPN-P-V5 protein (magnification: 400 x). Anti-V5 antibody (V5) and normal mouse serum (N) used as positive and negative control, respectively.

Techniques Used: Enzyme-linked Immunosorbent Assay, Binding Assay, Negative Control, Titration, Inhibition, Labeling, Western Blot, Derivative Assay, Immunofluorescence, Expressing

Detection of OPN in buffer solutions by various inhibition ELISAs. A) Dose-dependent inhibition of binding of various mAbs to target OPN (immobilized) by full-length OPN. Data represent mean +/- SD of three samples. B) Results showing specificity of the mAb 659 and mAb 446 inhibition ELISAs. OPN proteins (OPN, OPN-O-GST, OPN-O-V5, OPN-P-GST, and OPN-P-V5) and non-OPN proteins [TCA-GST and Sb-V5 (SARS-CoV spike protein)] were used as inhibitors. C) Comparison between the mAb 659 and mAb 446 inhibition ELISA on the detection of full-length OPN produced by HL60 cells [following stimulation or absence of stimulation with phorbol myristate acetate (PMA)]. NS0-derived recombinant human full-length OPN was used as positive control. Data represent mean +/- SD of three samples.
Figure Legend Snippet: Detection of OPN in buffer solutions by various inhibition ELISAs. A) Dose-dependent inhibition of binding of various mAbs to target OPN (immobilized) by full-length OPN. Data represent mean +/- SD of three samples. B) Results showing specificity of the mAb 659 and mAb 446 inhibition ELISAs. OPN proteins (OPN, OPN-O-GST, OPN-O-V5, OPN-P-GST, and OPN-P-V5) and non-OPN proteins [TCA-GST and Sb-V5 (SARS-CoV spike protein)] were used as inhibitors. C) Comparison between the mAb 659 and mAb 446 inhibition ELISA on the detection of full-length OPN produced by HL60 cells [following stimulation or absence of stimulation with phorbol myristate acetate (PMA)]. NS0-derived recombinant human full-length OPN was used as positive control. Data represent mean +/- SD of three samples.

Techniques Used: Inhibition, Binding Assay, Enzyme-linked Immunosorbent Assay, Produced, Derivative Assay, Recombinant, Positive Control

10) Product Images from "Evidence that Lin28 stimulates translation by recruiting RNA helicase A to polysomes"

Article Title: Evidence that Lin28 stimulates translation by recruiting RNA helicase A to polysomes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq1350

The N- and C-terminal regions of RHA interact with Lin28. ( A ) Domain organization of human RHA protein. Double-stranded RNA binding domain I and II (dsRBD I and II), C-terminal domain rich in arginine-glycine-glycine (RGG) repeats and the Walker helicase motifs of the conserved DEAD-box RNA helicases are depicted. Numbers indicate corresponding amino acid residue. ( B ) GST pulldown results. HEK293 cell lysate containing Flag-Lin28 was incubated with bacterial lysate containing the indicated recombinant RHA domains or GST alone in the presence of RNase A, followed by GST pulldown assays. Left panel, anti-Flag and anti-PABP antibodies were used in the upper and lower blots, respectively. Input was 0.5% of the total amount of proteins used for each GST pulldown. Right panel, Coomassie staining determined comparable amounts of the recombinant proteins used in the GST pulldown assays. 1% of the input was loaded in each lane. Molecular size markers are on the right. ( C ) Flag-Lin28 and Flag-N300 were co-transfected into HEK293 cells. Co-IP was carried out in the presence of RNase A 24 h later using anti-Lin28 antibody to bring down Flag-Lin28 together with its associated proteins, followed by western blot analysis. Antibodies used in the western blot were anti-RHA (top two blots, note, this antibody recognizes both full-length RHA and Flag-N300), anti-NXF1 (third blot from top), and anti-Flag M2 (bottom blot). Total proteins (2%) used for each immunoprecipitation was loaded as input.
Figure Legend Snippet: The N- and C-terminal regions of RHA interact with Lin28. ( A ) Domain organization of human RHA protein. Double-stranded RNA binding domain I and II (dsRBD I and II), C-terminal domain rich in arginine-glycine-glycine (RGG) repeats and the Walker helicase motifs of the conserved DEAD-box RNA helicases are depicted. Numbers indicate corresponding amino acid residue. ( B ) GST pulldown results. HEK293 cell lysate containing Flag-Lin28 was incubated with bacterial lysate containing the indicated recombinant RHA domains or GST alone in the presence of RNase A, followed by GST pulldown assays. Left panel, anti-Flag and anti-PABP antibodies were used in the upper and lower blots, respectively. Input was 0.5% of the total amount of proteins used for each GST pulldown. Right panel, Coomassie staining determined comparable amounts of the recombinant proteins used in the GST pulldown assays. 1% of the input was loaded in each lane. Molecular size markers are on the right. ( C ) Flag-Lin28 and Flag-N300 were co-transfected into HEK293 cells. Co-IP was carried out in the presence of RNase A 24 h later using anti-Lin28 antibody to bring down Flag-Lin28 together with its associated proteins, followed by western blot analysis. Antibodies used in the western blot were anti-RHA (top two blots, note, this antibody recognizes both full-length RHA and Flag-N300), anti-NXF1 (third blot from top), and anti-Flag M2 (bottom blot). Total proteins (2%) used for each immunoprecipitation was loaded as input.

Techniques Used: RNA Binding Assay, Incubation, Recombinant, Staining, Transfection, Co-Immunoprecipitation Assay, Western Blot, Immunoprecipitation

11) Product Images from "Vimentin Mediates Uptake of C3 Exoenzyme"

Article Title: Vimentin Mediates Uptake of C3 Exoenzyme

Journal: PLoS ONE

doi: 10.1371/journal.pone.0101071

Binding of C3 to HT22 cells after pronase treatment. A) Pronase pre-incubated HT22 cells were exposed to 100 or 500 nM of C3 for 1 h at 4°C. Subsequently, β-actin and bound C3 were detected by Western blot. NC = negative control without C3, PC = positive control lysate with 10 ng C3. One representative experiment is shown (n = 3 independent experiments). B) Pronase-treated HT22 cells were exposed to 500 nM of C3-E174Q-FITC for 1 h at 4°C and bound C3- E174Q-FITC was analyzed by FACS.
Figure Legend Snippet: Binding of C3 to HT22 cells after pronase treatment. A) Pronase pre-incubated HT22 cells were exposed to 100 or 500 nM of C3 for 1 h at 4°C. Subsequently, β-actin and bound C3 were detected by Western blot. NC = negative control without C3, PC = positive control lysate with 10 ng C3. One representative experiment is shown (n = 3 independent experiments). B) Pronase-treated HT22 cells were exposed to 500 nM of C3-E174Q-FITC for 1 h at 4°C and bound C3- E174Q-FITC was analyzed by FACS.

Techniques Used: Binding Assay, Incubation, Western Blot, Negative Control, Positive Control, FACS

Knock down of vimentin in hippocampal HT22 cells and J774A.1 macrophages. A) HT22 cells were transfected with siRNA for 48 h (scr = scrambled, Vim = vimentin). Vimentin and β-actin were detected by Western blot analysis of cell lysates. B) After siRNA transfection for 48 h, HT22 cells were exposed to C3 (100 nM) for 1 h at 4°C. Bound C3 was detected in Western blot with anti-C3. β-actin was used as internal control. C) Densitometric evaluation of bound C3 (from B) and adjustment to the corresponding actin band are shown; the bars give the relative C3 binding. D) HT22 cells transfected with siRNA for 48 h were incubated with C3-E174Q-FITC (500 nM) for 1 h at 4°C and bound C3-E174Q-FITC was analyzed by FACS cytometry. E – G) Same experiments for J774A.1 macrophages. E) Knock down of vimentin. F) Binding of C3 to cells with vimentin knock down. G) Densitometric evaluation of F. H) Binding of C3-E174Q-FITC to cells with vimentin knock down and FACS analysis.
Figure Legend Snippet: Knock down of vimentin in hippocampal HT22 cells and J774A.1 macrophages. A) HT22 cells were transfected with siRNA for 48 h (scr = scrambled, Vim = vimentin). Vimentin and β-actin were detected by Western blot analysis of cell lysates. B) After siRNA transfection for 48 h, HT22 cells were exposed to C3 (100 nM) for 1 h at 4°C. Bound C3 was detected in Western blot with anti-C3. β-actin was used as internal control. C) Densitometric evaluation of bound C3 (from B) and adjustment to the corresponding actin band are shown; the bars give the relative C3 binding. D) HT22 cells transfected with siRNA for 48 h were incubated with C3-E174Q-FITC (500 nM) for 1 h at 4°C and bound C3-E174Q-FITC was analyzed by FACS cytometry. E – G) Same experiments for J774A.1 macrophages. E) Knock down of vimentin. F) Binding of C3 to cells with vimentin knock down. G) Densitometric evaluation of F. H) Binding of C3-E174Q-FITC to cells with vimentin knock down and FACS analysis.

Techniques Used: Transfection, Western Blot, Binding Assay, Incubation, FACS, Cytometry

12) Product Images from "A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells"

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

Journal: Oncotarget

doi: 10.18632/oncotarget.9179

Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
Figure Legend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

Techniques Used: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

13) Product Images from "Human Papillomavirus Type 8 Interferes with a Novel C/EBP?-Mediated Mechanism of Keratinocyte CCL20 Chemokine Expression and Langerhans Cell Migration"

Article Title: Human Papillomavirus Type 8 Interferes with a Novel C/EBP?-Mediated Mechanism of Keratinocyte CCL20 Chemokine Expression and Langerhans Cell Migration

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1002833

C/EBPβ binds to the enhancer region of CCL20 in vivo. (A) Nucleotide sequence of the human CCL20 promoter region with twelve putative C/EBP binding sites (underlined). Numbers below the underlined C/EBP binding sites mark the sequences, which display C/EBP DNA binding activity in EMSA. In bold is the DNA sequence tested for C/EBP binding in ChIP assay. (B) 32 P-labeled oligonucleotides containing the respective C/EBP binding sites (nt 294–308, nt 574–584, nt 652–667, nt 716–724, nt 734–748) of the CCL20 promoter were incubated with 5 µg GST, GST-C/EBPα or GST-C/EBPβ fusion proteins and analyzed by EMSA. The arrow indicates complexes corresponding to C/EBP DNA binding activity. (C) Chromatin immunoprecipitation assay was performed using RTS3b cells transfected with the C/EBPβ expression vector. For precipitation anti-C/EBPβ (H-7) antibody was used. Genomic DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter (in bold). The amplicon was quantified (left panel) and visualized on an agarose gel (right panel). The amount of target DNA precipitated with the control antibody was set at 1. Shown are mean values ± SD from four experiments. The asterisk represents statistical significance, p = 0.02.
Figure Legend Snippet: C/EBPβ binds to the enhancer region of CCL20 in vivo. (A) Nucleotide sequence of the human CCL20 promoter region with twelve putative C/EBP binding sites (underlined). Numbers below the underlined C/EBP binding sites mark the sequences, which display C/EBP DNA binding activity in EMSA. In bold is the DNA sequence tested for C/EBP binding in ChIP assay. (B) 32 P-labeled oligonucleotides containing the respective C/EBP binding sites (nt 294–308, nt 574–584, nt 652–667, nt 716–724, nt 734–748) of the CCL20 promoter were incubated with 5 µg GST, GST-C/EBPα or GST-C/EBPβ fusion proteins and analyzed by EMSA. The arrow indicates complexes corresponding to C/EBP DNA binding activity. (C) Chromatin immunoprecipitation assay was performed using RTS3b cells transfected with the C/EBPβ expression vector. For precipitation anti-C/EBPβ (H-7) antibody was used. Genomic DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter (in bold). The amplicon was quantified (left panel) and visualized on an agarose gel (right panel). The amount of target DNA precipitated with the control antibody was set at 1. Shown are mean values ± SD from four experiments. The asterisk represents statistical significance, p = 0.02.

Techniques Used: In Vivo, Sequencing, Binding Assay, Activity Assay, Chromatin Immunoprecipitation, Labeling, Incubation, Transfection, Expressing, Plasmid Preparation, Isolation, Amplification, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis

14) Product Images from "Characterization of a sterol carrier protein 2/3-oxoacyl-CoA thiolase from the cotton leafworm (Spodoptera littoralis): a lepidopteran mechanism closer to that in mammals than that in dipterans"

Article Title: Characterization of a sterol carrier protein 2/3-oxoacyl-CoA thiolase from the cotton leafworm (Spodoptera littoralis): a lepidopteran mechanism closer to that in mammals than that in dipterans

Journal: Biochemical Journal

doi: 10.1042/BJ20040717

Western-blot analysis of the SCP2 domain Left panel: proteins from various tissues within the last larval instar were used. Lane 1, midgut; lane 2, fat body; lane 3, Malpighian tubules; lane 4, recombinant protein corresponding to the SCP2 domain of SCPx. The antibody against the SCP2 domain of S. littoralis SCPx protein was used. Right panel: Western-blot analysis of the recombinant S. littoralis SCPx protein using anti-(SCP2 domain) antibody. Lane 1, proteins from E. coli carrying the pGEX-2T vector without the SCPx cDNA; lane 2, proteins from E. coli carrying the pGEX-2T vector containing SCPx cDNA with induction of expression.
Figure Legend Snippet: Western-blot analysis of the SCP2 domain Left panel: proteins from various tissues within the last larval instar were used. Lane 1, midgut; lane 2, fat body; lane 3, Malpighian tubules; lane 4, recombinant protein corresponding to the SCP2 domain of SCPx. The antibody against the SCP2 domain of S. littoralis SCPx protein was used. Right panel: Western-blot analysis of the recombinant S. littoralis SCPx protein using anti-(SCP2 domain) antibody. Lane 1, proteins from E. coli carrying the pGEX-2T vector without the SCPx cDNA; lane 2, proteins from E. coli carrying the pGEX-2T vector containing SCPx cDNA with induction of expression.

Techniques Used: Western Blot, Recombinant, Plasmid Preparation, Expressing

The developmental profile of SCPx during the sixth instar ( A ) A 10 #x3BC;g portion of total RNA from midgut at various time points within the sixth larval instar, as indicated, was used. The blot was hybridized with a 32 P-labelled SCPx cDNA probe corresponding to the open reading frame. The same blot was stripped and reprobed with 18S rRNA probe. G, W and PP refer to the stages ‘gut purge’, ‘wandering’and ‘prepupa’ respectively that occur before pupation. ( B ) Western-blot analysis of SCPx protein. Top panel: 100 #x3BC;g of protein from midgut at various time points within the sixth larval instar, as indicated, was used. Bottom panel: Western-blot analysis of the recombinant S. littoralis SCPx protein. Lane 1, proteins from E. coli carrying the pGEX-2T vector without the SCPx cDNA; lane 2, proteins from E. coli carrying the pGEX-2T vector containing the SCPx cDNA without induction of expression; lane 3, proteins from E. coli carrying the pGEX-2T vector containing SCPx cDNA with induction of expression; lane 4, whole extract from C. elegans . The antibody against C. elegans P-44 was used to detect the SCPx protein.
Figure Legend Snippet: The developmental profile of SCPx during the sixth instar ( A ) A 10 #x3BC;g portion of total RNA from midgut at various time points within the sixth larval instar, as indicated, was used. The blot was hybridized with a 32 P-labelled SCPx cDNA probe corresponding to the open reading frame. The same blot was stripped and reprobed with 18S rRNA probe. G, W and PP refer to the stages ‘gut purge’, ‘wandering’and ‘prepupa’ respectively that occur before pupation. ( B ) Western-blot analysis of SCPx protein. Top panel: 100 #x3BC;g of protein from midgut at various time points within the sixth larval instar, as indicated, was used. Bottom panel: Western-blot analysis of the recombinant S. littoralis SCPx protein. Lane 1, proteins from E. coli carrying the pGEX-2T vector without the SCPx cDNA; lane 2, proteins from E. coli carrying the pGEX-2T vector containing the SCPx cDNA without induction of expression; lane 3, proteins from E. coli carrying the pGEX-2T vector containing SCPx cDNA with induction of expression; lane 4, whole extract from C. elegans . The antibody against C. elegans P-44 was used to detect the SCPx protein.

Techniques Used: Western Blot, Recombinant, Plasmid Preparation, Expressing

15) Product Images from "Functional Characterization of an IgE-Class Monoclonal Antibody Specific for the Bullous Pemphigoid Autoantigen, BP180"

Article Title: Functional Characterization of an IgE-Class Monoclonal Antibody Specific for the Bullous Pemphigoid Autoantigen, BP180

Journal: Hybridoma

doi: 10.1089/hyb.2011.0102

Mapping of the bullous pemphigoid (BP) IgE MAb reactive sites by immunoblot. ( A ) Supernatants of our 395 hybridoma, Clones A5 and D2, were screened for IgE reactivity to either affinity-purified NC16A protein or lysates of bacteria expressing one of five
Figure Legend Snippet: Mapping of the bullous pemphigoid (BP) IgE MAb reactive sites by immunoblot. ( A ) Supernatants of our 395 hybridoma, Clones A5 and D2, were screened for IgE reactivity to either affinity-purified NC16A protein or lysates of bacteria expressing one of five

Techniques Used: Clone Assay, Affinity Purification, Expressing

395A5 and 395D2 MAbs mediate NC16A-specific histamine release. RBL-SX-38 basophils were coated with 395A5, 395D2, or IgELB4 MAbs or IgE purified from two BP patients (BP IgE1 or BP IgE2) or normal control serum (NH IgE) for 30 min and washed,
Figure Legend Snippet: 395A5 and 395D2 MAbs mediate NC16A-specific histamine release. RBL-SX-38 basophils were coated with 395A5, 395D2, or IgELB4 MAbs or IgE purified from two BP patients (BP IgE1 or BP IgE2) or normal control serum (NH IgE) for 30 min and washed,

Techniques Used: Purification

16) Product Images from "Direct interaction between Fc?RI (CD64) and periplakin controls receptor endocytosis and ligand binding capacity"

Article Title: Direct interaction between Fc?RI (CD64) and periplakin controls receptor endocytosis and ligand binding capacity

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0401217101

PPL binds the FcγRI cytosolic tail in yeast two-hybrid screens. ( A ) Protein sequences of the cytosolic tails of FcγRI, FcγRIIa, FcγRIIIa, FcαRI, FcεRI, and mFcγRI are depicted; putative PKC (dotted
Figure Legend Snippet: PPL binds the FcγRI cytosolic tail in yeast two-hybrid screens. ( A ) Protein sequences of the cytosolic tails of FcγRI, FcγRIIa, FcγRIIIa, FcαRI, FcεRI, and mFcγRI are depicted; putative PKC (dotted

Techniques Used:

17) Product Images from "Crystallization of a ZRANB2-RNA complex"

Article Title: Crystallization of a ZRANB2-RNA complex

Journal: Acta Crystallographica Section F: Structural Biology and Crystallization Communications

doi: 10.1107/S1744309108036993

UV absorption spectra, recorded on a Nanospec, of ZRANB2-F2–RNA crystals dissolved in water (solid line) and of the original solution used for crystallization (dashed line).
Figure Legend Snippet: UV absorption spectra, recorded on a Nanospec, of ZRANB2-F2–RNA crystals dissolved in water (solid line) and of the original solution used for crystallization (dashed line).

Techniques Used: Crystallization Assay

Hexagonal crystal of the ZRANB2-F2–RNA complex of 120 × 300 µm in size.
Figure Legend Snippet: Hexagonal crystal of the ZRANB2-F2–RNA complex of 120 × 300 µm in size.

Techniques Used:

Diffraction image of a ZRANB2-F2–RNA complex crystal taken on a laboratory source.
Figure Legend Snippet: Diffraction image of a ZRANB2-F2–RNA complex crystal taken on a laboratory source.

Techniques Used:

18) Product Images from "The Kinesin-associated Protein UNC-76 Is Required for Axonal Transport in the Drosophila Nervous System"

Article Title: The Kinesin-associated Protein UNC-76 Is Required for Axonal Transport in the Drosophila Nervous System

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E02-12-0800

UNC-76 and SYT do not colocalize in segmental nerves. (A) Shows the accumulation of UNC-76 in a nine-section optical projection (each section is 2 μm) of a segmental nerve from a Khc 16 /+; Df(3L)34ex5/ + individual that exhibits locomotion defects and SYT axon clogs (B). Note that UNC-76 accumulation is fairly uniform, whereas SYT is found in axon clogs (B). (C) Overlay of images in A and B shows that UNC-76 and SYT are largely nonoverlapping; upon viewing a single 2-μm optical section (D), it is apparent that UNC-76 is not detected in axon clogs. Bar, 25 μm.
Figure Legend Snippet: UNC-76 and SYT do not colocalize in segmental nerves. (A) Shows the accumulation of UNC-76 in a nine-section optical projection (each section is 2 μm) of a segmental nerve from a Khc 16 /+; Df(3L)34ex5/ + individual that exhibits locomotion defects and SYT axon clogs (B). Note that UNC-76 accumulation is fairly uniform, whereas SYT is found in axon clogs (B). (C) Overlay of images in A and B shows that UNC-76 and SYT are largely nonoverlapping; upon viewing a single 2-μm optical section (D), it is apparent that UNC-76 is not detected in axon clogs. Bar, 25 μm.

Techniques Used:

Unc-76 mutations cause axonal transport defects in the Drosophila nervous system. Larvae heterozygous (A) or homozygous (B) for Unc-76 null allele l(1)G0310 were incubated with antisera specific for the synaptic vesicle precursor marker SYT to compare the accumulation pattern of fast anterograde transports in wild-type and Unc-76 mutant backgrounds. Note that large aggregates of SYT immunoreactivity are found in the segmental nerves of Unc-76 mutants (B), but SYT accumulation is diffuse in heterozygotes (A). Bar, 25 μm. (C) UNC-76 protein concentration is reduced in Unc-76 heterozygous adults. Whole cell extracts of wild-type (ORE-R, lanes 1 and 2) and Unc-76 heterozygote ( l[1]G0310/ +, lane 3) were electrophoresed, blotted, and incubated with UNC-76 antisera. The equivalent of one adult female is present in lanes 1 and 3, whereas 0.5 fly equivalent is present in lane 2 as a control. The numbers below each lane represent the ratio of the pixel volume of each lane divided by the pixel volume of lane 1 (wild-type). (D and E) UNC-76 antisera staining of wild-type (D) and Unc-76 – (E) second instar CNS. Note that UNC-76 staining is more intense in ventral nerve cord of wild-type larva, whereas staining is at background levels in Unc-76 – ventral nerve cord. Epifluorescence images were captured at 60× magnification. Anterior is to the left.
Figure Legend Snippet: Unc-76 mutations cause axonal transport defects in the Drosophila nervous system. Larvae heterozygous (A) or homozygous (B) for Unc-76 null allele l(1)G0310 were incubated with antisera specific for the synaptic vesicle precursor marker SYT to compare the accumulation pattern of fast anterograde transports in wild-type and Unc-76 mutant backgrounds. Note that large aggregates of SYT immunoreactivity are found in the segmental nerves of Unc-76 mutants (B), but SYT accumulation is diffuse in heterozygotes (A). Bar, 25 μm. (C) UNC-76 protein concentration is reduced in Unc-76 heterozygous adults. Whole cell extracts of wild-type (ORE-R, lanes 1 and 2) and Unc-76 heterozygote ( l[1]G0310/ +, lane 3) were electrophoresed, blotted, and incubated with UNC-76 antisera. The equivalent of one adult female is present in lanes 1 and 3, whereas 0.5 fly equivalent is present in lane 2 as a control. The numbers below each lane represent the ratio of the pixel volume of each lane divided by the pixel volume of lane 1 (wild-type). (D and E) UNC-76 antisera staining of wild-type (D) and Unc-76 – (E) second instar CNS. Note that UNC-76 staining is more intense in ventral nerve cord of wild-type larva, whereas staining is at background levels in Unc-76 – ventral nerve cord. Epifluorescence images were captured at 60× magnification. Anterior is to the left.

Techniques Used: Incubation, Marker, Mutagenesis, Protein Concentration, Staining

Immunolocalization of UNC-76 in the embryonic and larval nervous system. (A–D) UNC-76 is found in axons of the embryonic CNS. Anterior is to the left. (A and B) Lateral (A) and horizontal (B) views of a stage 14 embryo. (A) Shows that UNC-76 protein is restricted to the CNS (arrows) at this stage of development, whereas (B) shows that UNC-76 accumulation is detectable in both longitudinal (arrows) and commissural (asterisks) axons. (C and D) Lateral and horizontal views of UNC-76 staining at stage 17. UNC-76 is found within longitudinal axons of CNS (arrows) late in embryogenesis, but commissural axon staining is greatly reduced (D) compared with earlier in development (B). (E and F) UNC-76 staining in segmental nerves of wild-type third instars. (E) A projection of 29 optical sections, each 2 μm in thickness, whereas F is one optical section from the projection. Note that UNC-76 accumulation is diffuse within segmental nerves. Bar (E and F), 25 μm.
Figure Legend Snippet: Immunolocalization of UNC-76 in the embryonic and larval nervous system. (A–D) UNC-76 is found in axons of the embryonic CNS. Anterior is to the left. (A and B) Lateral (A) and horizontal (B) views of a stage 14 embryo. (A) Shows that UNC-76 protein is restricted to the CNS (arrows) at this stage of development, whereas (B) shows that UNC-76 accumulation is detectable in both longitudinal (arrows) and commissural (asterisks) axons. (C and D) Lateral and horizontal views of UNC-76 staining at stage 17. UNC-76 is found within longitudinal axons of CNS (arrows) late in embryogenesis, but commissural axon staining is greatly reduced (D) compared with earlier in development (B). (E and F) UNC-76 staining in segmental nerves of wild-type third instars. (E) A projection of 29 optical sections, each 2 μm in thickness, whereas F is one optical section from the projection. Note that UNC-76 accumulation is diffuse within segmental nerves. Bar (E and F), 25 μm.

Techniques Used: Staining

UNC-76 interacts with the KHC tail domain in the yeast two-hybrid assay and in copurification assays. (A) Yeast cells containing a lacZ reporter gene and various combinations of LexA DNA binding domain (baits, left column) and B42 activation domain (preys, right column) fusion proteins were grown on CM Gal/Raff Xgal plates. Colonies in which reporter gene activation is enhanced by specific bait-prey interactions are blue, whereas colonies in which a bait-prey interaction do not occur are white. Colonies that contain the KHC stalk and tail domains (aa 675-976) or the KHC tail domain (aa 850-975) bait fusions and the UNC-76 prey fusion enhance reporter gene transcription, but colonies containing the KHC stalk domain (aa 675-850) and UNC-76 do not. Control, LexA DNA binding domain bait or B42 activation domain prey. (B) Western analysis of protein fractions from UNC-76 copurification assay. 6xHIS-tagged full-length UNC-76 was bound to Ni 2 + -NTA agarose beads and incubated with detergent-soluble extracts of adult flies containing a transgenic copy of myc epitope-tagged KLC. KHC and KLC copurify with UNC-76 beads (lane U), but not with Ni 2 + -NTA agarose beads alone (lane B). KHC, blot probed with anti-KHC antibody; KLC, blot probed with anti-myc antibody to detect transgenic KLC; L, detergent-soluble lysate; B, proteins that copurify with Ni 2 + -NTA beads; S, supernatant from UNC-76 copurification assay; U, proteins that copurify with 6xHIS-UNC-76 beads.
Figure Legend Snippet: UNC-76 interacts with the KHC tail domain in the yeast two-hybrid assay and in copurification assays. (A) Yeast cells containing a lacZ reporter gene and various combinations of LexA DNA binding domain (baits, left column) and B42 activation domain (preys, right column) fusion proteins were grown on CM Gal/Raff Xgal plates. Colonies in which reporter gene activation is enhanced by specific bait-prey interactions are blue, whereas colonies in which a bait-prey interaction do not occur are white. Colonies that contain the KHC stalk and tail domains (aa 675-976) or the KHC tail domain (aa 850-975) bait fusions and the UNC-76 prey fusion enhance reporter gene transcription, but colonies containing the KHC stalk domain (aa 675-850) and UNC-76 do not. Control, LexA DNA binding domain bait or B42 activation domain prey. (B) Western analysis of protein fractions from UNC-76 copurification assay. 6xHIS-tagged full-length UNC-76 was bound to Ni 2 + -NTA agarose beads and incubated with detergent-soluble extracts of adult flies containing a transgenic copy of myc epitope-tagged KLC. KHC and KLC copurify with UNC-76 beads (lane U), but not with Ni 2 + -NTA agarose beads alone (lane B). KHC, blot probed with anti-KHC antibody; KLC, blot probed with anti-myc antibody to detect transgenic KLC; L, detergent-soluble lysate; B, proteins that copurify with Ni 2 + -NTA beads; S, supernatant from UNC-76 copurification assay; U, proteins that copurify with 6xHIS-UNC-76 beads.

Techniques Used: Y2H Assay, Copurification, Binding Assay, Activation Assay, Western Blot, Incubation, Transgenic Assay

Increasing the genetic dosage of Unc-76 enhances Klc and Khc mutant phenotypes. SYT accumulation in segmental nerves of larvae of the following genotypes: (A) Dp(1;2;Y)w + / + ; (Unc-76 duplication); (B) Df(34ex5 )/+ ( Klc deletion); (C) l(1)G0310/ + ( Unc-76 null allele); Df(34ex5 )/+; (D) Dp(1;2;Y)w + / +; Df(34ex5 )/+; (E) Khc 16 /+ ( Khc null allele); and (F) Df(1;2;Y)w + /+; Khc 16 /+. Bar, 25 μm.
Figure Legend Snippet: Increasing the genetic dosage of Unc-76 enhances Klc and Khc mutant phenotypes. SYT accumulation in segmental nerves of larvae of the following genotypes: (A) Dp(1;2;Y)w + / + ; (Unc-76 duplication); (B) Df(34ex5 )/+ ( Klc deletion); (C) l(1)G0310/ + ( Unc-76 null allele); Df(34ex5 )/+; (D) Dp(1;2;Y)w + / +; Df(34ex5 )/+; (E) Khc 16 /+ ( Khc null allele); and (F) Df(1;2;Y)w + /+; Khc 16 /+. Bar, 25 μm.

Techniques Used: Mutagenesis

19) Product Images from "Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities"

Article Title: Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

Journal: Virology

doi: 10.1016/j.virol.2009.03.027

EBNA3C represses p53 mediated transcriptional activity. (A–B) Approximately 0.4 × 10 6 SAOS-2 (p53 −/− ) cells were cotransfected with 0.25 µg of the promoter construct containing p53 responsive element and 0.5 µg
Figure Legend Snippet: EBNA3C represses p53 mediated transcriptional activity. (A–B) Approximately 0.4 × 10 6 SAOS-2 (p53 −/− ) cells were cotransfected with 0.25 µg of the promoter construct containing p53 responsive element and 0.5 µg

Techniques Used: Activity Assay, Construct

EBNA3C blocks p53 induced apoptosis in p53 null cell line SAOS-2. (A–B) SAOS-2 (p53 −/− ) cells were transiently transfected either with vector control, or constructs expressing untagged wild-type EBNA3C and p53 alone, or p53 and
Figure Legend Snippet: EBNA3C blocks p53 induced apoptosis in p53 null cell line SAOS-2. (A–B) SAOS-2 (p53 −/− ) cells were transiently transfected either with vector control, or constructs expressing untagged wild-type EBNA3C and p53 alone, or p53 and

Techniques Used: Transfection, Plasmid Preparation, Construct, Expressing

EBNA3C interacts with p53 in vivo . (A–B) Either 10 million HEK 293 cells or (C–D) 20 million DG75 cells were co-transfected with flag-tagged EBNA3C and myc-tagged p53. Cells were harvested at 36h post-transfection and approximately 5%
Figure Legend Snippet: EBNA3C interacts with p53 in vivo . (A–B) Either 10 million HEK 293 cells or (C–D) 20 million DG75 cells were co-transfected with flag-tagged EBNA3C and myc-tagged p53. Cells were harvested at 36h post-transfection and approximately 5%

Techniques Used: In Vivo, Transfection

N-terminal domain of EBNA3C binds to C-terminal domain of p53. (A–C) 35 S-radiolabeled either full-length (C) or different EBNA3C truncated fragments (A) or full-length p53 (B) was in vitro translated using a T7 TNT translation kit. All 35 S-radiolabeled
Figure Legend Snippet: N-terminal domain of EBNA3C binds to C-terminal domain of p53. (A–C) 35 S-radiolabeled either full-length (C) or different EBNA3C truncated fragments (A) or full-length p53 (B) was in vitro translated using a T7 TNT translation kit. All 35 S-radiolabeled

Techniques Used: In Vitro

EBNA3C colocalizes with p53 in EBV positive cell lines. A) EBV negative burkitt lymphoma cell line, BJAB, and two EBV transformed cell lines - LCL1 and LCL2 were air-dried onto slides and fixed using a 1:1 mixture of acetone and methanol. Endogenously
Figure Legend Snippet: EBNA3C colocalizes with p53 in EBV positive cell lines. A) EBV negative burkitt lymphoma cell line, BJAB, and two EBV transformed cell lines - LCL1 and LCL2 were air-dried onto slides and fixed using a 1:1 mixture of acetone and methanol. Endogenously

Techniques Used: Transformation Assay

EBNA3C reduces DNA-binding ability of p53. A probe containing the p53 binding sequence (5’-AGGAAGAAGACTGGGCATGTCTGGGCA-3’) was labeled by Klenow fill-in reaction with [α- 32 P]dCTP and used for EMSA in presence and absence of EBNA3C.
Figure Legend Snippet: EBNA3C reduces DNA-binding ability of p53. A probe containing the p53 binding sequence (5’-AGGAAGAAGACTGGGCATGTCTGGGCA-3’) was labeled by Klenow fill-in reaction with [α- 32 P]dCTP and used for EMSA in presence and absence of EBNA3C.

Techniques Used: Binding Assay, Sequencing, Labeling

EBNA3C forms a stable complex with p53 in vitro . (A) GST-p53 fusion protein was expressed in E. coli and purified with glutathione Sepharose beads. Full-length EBNA3C was labeled with 35 S methionine by in vitro translation and incubated with either GST
Figure Legend Snippet: EBNA3C forms a stable complex with p53 in vitro . (A) GST-p53 fusion protein was expressed in E. coli and purified with glutathione Sepharose beads. Full-length EBNA3C was labeled with 35 S methionine by in vitro translation and incubated with either GST

Techniques Used: In Vitro, Purification, Labeling, Incubation

20) Product Images from "Plk4 is required for cytokinesis and maintenance of chromosomal stability"

Article Title: Plk4 is required for cytokinesis and maintenance of chromosomal stability

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0910941107

Plk4 +/− MEFs show multinucleation, increased centrosome number, and aneuploidy. ( A ) Increased incidence of multinucleation in P3 Plk4 +/− interphase MEFs ( n = 400 cells per genotype; * P = 0.007). Representative photomicrographs of MEFs
Figure Legend Snippet: Plk4 +/− MEFs show multinucleation, increased centrosome number, and aneuploidy. ( A ) Increased incidence of multinucleation in P3 Plk4 +/− interphase MEFs ( n = 400 cells per genotype; * P = 0.007). Representative photomicrographs of MEFs

Techniques Used:

Haploid levels of Plk4 are common in human hepatoma and drive cancer formation by murine cells. ( A ) Schematic representation of a region of the q arm of human chromosome 4, showing high rates of LOH at microsatellite markers closest to Plk4 in microdissected
Figure Legend Snippet: Haploid levels of Plk4 are common in human hepatoma and drive cancer formation by murine cells. ( A ) Schematic representation of a region of the q arm of human chromosome 4, showing high rates of LOH at microsatellite markers closest to Plk4 in microdissected

Techniques Used:

Plk4 is required for myosin II localization and completion of cytokinesis. ( A ) Time-lapse DIC microscopy of mitotic P3 MEFs, showing failure of cytokinesis in a bipolar Plk4 +/− cell, resulting in multinucleation (arrows indicate nuclei, time points
Figure Legend Snippet: Plk4 is required for myosin II localization and completion of cytokinesis. ( A ) Time-lapse DIC microscopy of mitotic P3 MEFs, showing failure of cytokinesis in a bipolar Plk4 +/− cell, resulting in multinucleation (arrows indicate nuclei, time points

Techniques Used: Microscopy

Plk4 is required for RhoA activation and Ect2 localization in cytokinesis. ( A ) Reduced levels of activated RhoA in Plk4 +/− MEFs after release from nocodazole (mean ± SEM, n = 3, * P
Figure Legend Snippet: Plk4 is required for RhoA activation and Ect2 localization in cytokinesis. ( A ) Reduced levels of activated RhoA in Plk4 +/− MEFs after release from nocodazole (mean ± SEM, n = 3, * P

Techniques Used: Activation Assay

21) Product Images from "COLD-INDUCIBLE RNA BINDING PROTEIN CONTRIBUTES TO HUMAN ANTIGEN R AND CYCLIN E1 DEREGULATION IN BREAST CANCER"

Article Title: COLD-INDUCIBLE RNA BINDING PROTEIN CONTRIBUTES TO HUMAN ANTIGEN R AND CYCLIN E1 DEREGULATION IN BREAST CANCER

Journal: Molecular carcinogenesis

doi: 10.1002/mc.20582

CIRP and HuR bind the cyclin E1 mRNA. A , UV-crosslink competition analysis. An equal amount of GST-CIRP or GST-HuR was incubated with 32 P-labeled cyclin E1 mRNA 3’UTR (E13’UTR) in the presence of 0 (lanes 1 and 6) or 100 molar excess unlabeled
Figure Legend Snippet: CIRP and HuR bind the cyclin E1 mRNA. A , UV-crosslink competition analysis. An equal amount of GST-CIRP or GST-HuR was incubated with 32 P-labeled cyclin E1 mRNA 3’UTR (E13’UTR) in the presence of 0 (lanes 1 and 6) or 100 molar excess unlabeled

Techniques Used: Incubation, Labeling

CIRP co-precipitates with HuR. A , GST pull-down assay: GST or GST-CIRP was incubated with MCF-7 cell extract. GST-CIRP was pulled down with Glutathione-Sepharose and eluted proteins immunoblotted for HuR. B , MCF-7 cell extract treated with or without
Figure Legend Snippet: CIRP co-precipitates with HuR. A , GST pull-down assay: GST or GST-CIRP was incubated with MCF-7 cell extract. GST-CIRP was pulled down with Glutathione-Sepharose and eluted proteins immunoblotted for HuR. B , MCF-7 cell extract treated with or without

Techniques Used: Pull Down Assay, Incubation

22) Product Images from "Increased Glycan Chain Length Distribution and Decreased Susceptibility to Moenomycin in a Vancomycin-Resistant Staphylococcus aureus Mutant"

Article Title: Increased Glycan Chain Length Distribution and Decreased Susceptibility to Moenomycin in a Vancomycin-Resistant Staphylococcus aureus Mutant

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.46.1.75-81.2002

Western blotting and zymographic analyses of  S. aureus . (a) Membrane fractions of COL and COL-VR1 were analyzed by immunoblotting with serum with anti-PBP 1, anti-PBP 2, anti-PBP 3, anti-PBP 4, and anti-PBP 2′ antibodies. (b) Lysates of whole COL and COL-VR1 cells were subjected to zymography with a gel with  M. luteus  (b1) or a gel with  S. aureus  (b2). Protein marker bands are indicated at the left of the panel.
Figure Legend Snippet: Western blotting and zymographic analyses of S. aureus . (a) Membrane fractions of COL and COL-VR1 were analyzed by immunoblotting with serum with anti-PBP 1, anti-PBP 2, anti-PBP 3, anti-PBP 4, and anti-PBP 2′ antibodies. (b) Lysates of whole COL and COL-VR1 cells were subjected to zymography with a gel with M. luteus (b1) or a gel with S. aureus (b2). Protein marker bands are indicated at the left of the panel.

Techniques Used: Western Blot, Zymography, Marker

23) Product Images from "A protein complex containing Epo1p anchors the cortical endoplasmic reticulum to the yeast bud tip"

Article Title: A protein complex containing Epo1p anchors the cortical endoplasmic reticulum to the yeast bud tip

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201407126

Epo1p binds to two different sites in Scs2p. (A, top) Domain structure of Scs2p. The major sperm domain (MSP) is separated from the C-terminal transmembrane segment (TMD) by a stretch of 93 residues. (bottom) Split-Ub interaction assay as in Fig. 1 B but between Epo1CRU and N ub -Scs2 1–225 and two N ub fusions that should not interact with Epo1CRU. (B) Eluates of Sepharose bead-coupled GST-Scs2 1–225 (lanes 1, 3, and 5) or GST (lanes 2, 4, and 6) incubated with yeast extracts containing GFP-tagged Epo1p (lanes 1 and 2) or bacterial extracts containing MBP-Epo1p (lanes 3 and 4) or MBP-Epo1 1–760 (lanes 5 and 6) were separated by SDS-PAGE. Western blots were probed with anti-GFP (lanes 1 and 2) or anti-MBP antibodies (lanes 3–6). Arrows indicate from top to bottom: MBP-Epo1p, Epo1-GFP, and MBP-Epo1 1–760 . Fragments of Epo1-GFP and MBP-Epo1p running
Figure Legend Snippet: Epo1p binds to two different sites in Scs2p. (A, top) Domain structure of Scs2p. The major sperm domain (MSP) is separated from the C-terminal transmembrane segment (TMD) by a stretch of 93 residues. (bottom) Split-Ub interaction assay as in Fig. 1 B but between Epo1CRU and N ub -Scs2 1–225 and two N ub fusions that should not interact with Epo1CRU. (B) Eluates of Sepharose bead-coupled GST-Scs2 1–225 (lanes 1, 3, and 5) or GST (lanes 2, 4, and 6) incubated with yeast extracts containing GFP-tagged Epo1p (lanes 1 and 2) or bacterial extracts containing MBP-Epo1p (lanes 3 and 4) or MBP-Epo1 1–760 (lanes 5 and 6) were separated by SDS-PAGE. Western blots were probed with anti-GFP (lanes 1 and 2) or anti-MBP antibodies (lanes 3–6). Arrows indicate from top to bottom: MBP-Epo1p, Epo1-GFP, and MBP-Epo1 1–760 . Fragments of Epo1-GFP and MBP-Epo1p running

Techniques Used: Incubation, SDS Page, Western Blot

Epo1p interacts with members of the polarisome and Scs2p. (A) Split-Ub interaction assay of 48 yeast strains each coexpressing Epo1CRU with a different N ub fusion. Shown are quadruplets of each strain after 3 d of growth on medium containing 5-FOA. White boxes indicate the fusions that induce the growth of the strain reflecting the interaction between N ub and C ub fusion. The identities of all Nub fusions are revealed in Table S2 . (B) Split-Ub interaction assay between Epo1CRU and selected N ub fusion proteins in WT, Δpea2 , Δspa2 , Δkel1 , and Δbem3 cells. Cells were grown to OD 600 of 1 and 4 µl of this, and 10-fold serial dilutions were spotted on 5-FOA plates. N ub without a C-terminally attached ORF (N ub −) serves as a control for the specificity of the Split-Ub assays. (C) As in B, but selected interactions of Pea2CRU were compared between WT and Δepo1 cells. (D) Domain structure of Epo1p. Shown as blue rectangles are the three predicted coiled-coil (CC) regions. Numbers indicate amino acid positions of the putative start and end points of each domain. (E) As in A, but with fragments of Epo1p as CRU fusions and 16 independently generated diploids for each experiment shown after 4 d of growth. (F) Protein extracts of bacterial cells expressing his 6 -Pea2 (lanes 1–4) or yeast cells expressing MYC-tagged Kel1p (lanes 5–8) were incubated with glutathione-coupled Sepharose beads exposing bacterially expressed GST (lanes 1 and 5), GST-Epo1 761–943 (lanes 2 and 6), GST-Epo1 761–867 (lanes 3 and 7), or GST-Epo1 852–943 (lanes 4 and 8). Glutathione eluates were separated by SDS-PAGE and probed with anti-His (lanes 1–4) or anti-MYC (lanes 5–8) antibodies after Western blotting. (G) As in F, except bacterially expressed MBP-Epo1 (lanes 1 and 2) or MBP-Epo1 1–760 (lanes 3 and 4) were precipitated with bacterially expressed and Sepharose bead immobilized GST (lanes 2 and 4) or GST-Pea2p (lanes 1 and 3). The inputs for the experiments in F and G are shown in Fig. S1 . (H) Pea2p mediates the interaction between Epo1p and Spa2p. As in F, except bacterially expressed his 6 -Spa2 1–535 -SNAP (lanes 1, 2, 7, and 8) or his 6 -Spa2 1–488 -SNAP (lanes 4, 5, 9, and 10) were first incubated with his 6 -Pea2 (lanes 1 and 4) or left untreated (lanes 7 and 9) before being incubated with bacterially expressed and immobilized GST-Epo1 761–943 . The glutathione eluates are shown in lanes 1, 4, 7, and 9. The inputs for the experiment in lane 1 are shown in lanes 2 and 3. The inputs for the experiment in lane 4 are shown in lanes 5 and 6. The inputs for the experiment in lanes 7 and 9 are shown in lanes 8 and 10, respectively. The asterisk indicates a degradation product. Lanes 1–6 show cutouts of the same gel with the vertical line indicating the removal of an empty lane. (I) Architecture of the ER–cell tip tethering complex. Edges connecting nodes indicate direct (black) or potentially indirect (green) interactions. Blue rectangles indicate coiled-coil regions shown in D.
Figure Legend Snippet: Epo1p interacts with members of the polarisome and Scs2p. (A) Split-Ub interaction assay of 48 yeast strains each coexpressing Epo1CRU with a different N ub fusion. Shown are quadruplets of each strain after 3 d of growth on medium containing 5-FOA. White boxes indicate the fusions that induce the growth of the strain reflecting the interaction between N ub and C ub fusion. The identities of all Nub fusions are revealed in Table S2 . (B) Split-Ub interaction assay between Epo1CRU and selected N ub fusion proteins in WT, Δpea2 , Δspa2 , Δkel1 , and Δbem3 cells. Cells were grown to OD 600 of 1 and 4 µl of this, and 10-fold serial dilutions were spotted on 5-FOA plates. N ub without a C-terminally attached ORF (N ub −) serves as a control for the specificity of the Split-Ub assays. (C) As in B, but selected interactions of Pea2CRU were compared between WT and Δepo1 cells. (D) Domain structure of Epo1p. Shown as blue rectangles are the three predicted coiled-coil (CC) regions. Numbers indicate amino acid positions of the putative start and end points of each domain. (E) As in A, but with fragments of Epo1p as CRU fusions and 16 independently generated diploids for each experiment shown after 4 d of growth. (F) Protein extracts of bacterial cells expressing his 6 -Pea2 (lanes 1–4) or yeast cells expressing MYC-tagged Kel1p (lanes 5–8) were incubated with glutathione-coupled Sepharose beads exposing bacterially expressed GST (lanes 1 and 5), GST-Epo1 761–943 (lanes 2 and 6), GST-Epo1 761–867 (lanes 3 and 7), or GST-Epo1 852–943 (lanes 4 and 8). Glutathione eluates were separated by SDS-PAGE and probed with anti-His (lanes 1–4) or anti-MYC (lanes 5–8) antibodies after Western blotting. (G) As in F, except bacterially expressed MBP-Epo1 (lanes 1 and 2) or MBP-Epo1 1–760 (lanes 3 and 4) were precipitated with bacterially expressed and Sepharose bead immobilized GST (lanes 2 and 4) or GST-Pea2p (lanes 1 and 3). The inputs for the experiments in F and G are shown in Fig. S1 . (H) Pea2p mediates the interaction between Epo1p and Spa2p. As in F, except bacterially expressed his 6 -Spa2 1–535 -SNAP (lanes 1, 2, 7, and 8) or his 6 -Spa2 1–488 -SNAP (lanes 4, 5, 9, and 10) were first incubated with his 6 -Pea2 (lanes 1 and 4) or left untreated (lanes 7 and 9) before being incubated with bacterially expressed and immobilized GST-Epo1 761–943 . The glutathione eluates are shown in lanes 1, 4, 7, and 9. The inputs for the experiment in lane 1 are shown in lanes 2 and 3. The inputs for the experiment in lane 4 are shown in lanes 5 and 6. The inputs for the experiment in lanes 7 and 9 are shown in lanes 8 and 10, respectively. The asterisk indicates a degradation product. Lanes 1–6 show cutouts of the same gel with the vertical line indicating the removal of an empty lane. (I) Architecture of the ER–cell tip tethering complex. Edges connecting nodes indicate direct (black) or potentially indirect (green) interactions. Blue rectangles indicate coiled-coil regions shown in D.

Techniques Used: Generated, Expressing, Incubation, SDS Page, Western Blot

24) Product Images from "Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts"

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts

Journal: Structure (London, England : 1993)

doi: 10.1016/j.str.2017.07.014

NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .
Figure Legend Snippet: NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .

Techniques Used: Nuclear Magnetic Resonance, Isolation, Construct, Labeling

Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .
Figure Legend Snippet: Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .

Techniques Used: Mutagenesis, Western Blot, Activity Assay

25) Product Images from "Detection and Quantification of ADP-Ribosylated RhoA/B by Monoclonal Antibody"

Article Title: Detection and Quantification of ADP-Ribosylated RhoA/B by Monoclonal Antibody

Journal: Toxins

doi: 10.3390/toxins8040100

Mass spectrometric detection of ADP-ribosylated RhoA in CHO cells. CHO cells were treated with 500 nM C3 or C3-E174Q for 10 min. Untreated cells served as control. Subsequently, cell lysates were separated by 15% SDS-PAGE and stained with Coomassie brilliant blue. The samples of 20–30 kDa bands were digested with trypsin and peptides were subjected to mass spectrometry analysis. A MS/MS spectrum of the analyzed RhoA peptide is shown. ( a ) Identification of ADP-ribosylated RhoA; and ( b ) unmodified RhoA, blue arrows show specific y -ions/fragments of the modified or unmodified peptide.
Figure Legend Snippet: Mass spectrometric detection of ADP-ribosylated RhoA in CHO cells. CHO cells were treated with 500 nM C3 or C3-E174Q for 10 min. Untreated cells served as control. Subsequently, cell lysates were separated by 15% SDS-PAGE and stained with Coomassie brilliant blue. The samples of 20–30 kDa bands were digested with trypsin and peptides were subjected to mass spectrometry analysis. A MS/MS spectrum of the analyzed RhoA peptide is shown. ( a ) Identification of ADP-ribosylated RhoA; and ( b ) unmodified RhoA, blue arrows show specific y -ions/fragments of the modified or unmodified peptide.

Techniques Used: SDS Page, Staining, Mass Spectrometry, Modification

26) Product Images from "NF-?B1 p105 Negatively Regulates TPL-2 MEK Kinase Activity"

Article Title: NF-?B1 p105 Negatively Regulates TPL-2 MEK Kinase Activity

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.14.4739-4752.2003

Both TPL-2 binding sites on p105 are required for optimal association with TPL-2. (A) Schematic diagram of HA-p105 mutants. (B) 293 cells were transfected with vectors encoding wild-type or deletion mutant forms of HA-p105. Biotinylated TPL-2 398-467 peptide, coupled to streptavidin-agarose beads, was then used to affinity purify HA-p105 from cell lysates. Isolated protein was detected by Western blotting. (C) 293 cells were cotransfected with vectors encoding TPL-2 and the indicated HA-p105 mutants or EV. In this experiment, to assay the interaction between TPL-2 and HA-p105 under more stringent conditions, cells were lysed and immunoprecipitated in radioimmunoprecipitation assay buffer. Anti-HA immunoprecipitates and cell lysates were Western blotted and probed sequentially with the indicated antibodies. The amount of TPL-2 epression vector was adjusted so that similar steady-state levels of protein expression in cell lysates were obtained with or without HA-p105.
Figure Legend Snippet: Both TPL-2 binding sites on p105 are required for optimal association with TPL-2. (A) Schematic diagram of HA-p105 mutants. (B) 293 cells were transfected with vectors encoding wild-type or deletion mutant forms of HA-p105. Biotinylated TPL-2 398-467 peptide, coupled to streptavidin-agarose beads, was then used to affinity purify HA-p105 from cell lysates. Isolated protein was detected by Western blotting. (C) 293 cells were cotransfected with vectors encoding TPL-2 and the indicated HA-p105 mutants or EV. In this experiment, to assay the interaction between TPL-2 and HA-p105 under more stringent conditions, cells were lysed and immunoprecipitated in radioimmunoprecipitation assay buffer. Anti-HA immunoprecipitates and cell lysates were Western blotted and probed sequentially with the indicated antibodies. The amount of TPL-2 epression vector was adjusted so that similar steady-state levels of protein expression in cell lysates were obtained with or without HA-p105.

Techniques Used: Binding Assay, Transfection, Mutagenesis, Isolation, Western Blot, Immunoprecipitation, Radio Immunoprecipitation, Plasmid Preparation, Expressing

The p105 DD is a binding site for TPL-2. (A) Schematic diagram of HA-p105 mutants. (B) 293 cells were cotransfected with TPL-2ΔC and the indicated HA-p105 mutants. Anti-HA MAb immunoprecipitates and cell lysates were Western blotted and probed with the indicated antibodies. The amounts of vector encoding TPL-2ΔC were adjusted to achieve equal protein expression in lysates with or without HA-p105. (C) TPL-2 was synthesized and labeled with [ 35 S]methionine-[ 35 S]cysteine by in vitro cell-free translation. Pulldowns were then performed with GST-p105 808-892 or GST control. Isolated protein was resolved by SDS-PAGE and revealed by fluorography.
Figure Legend Snippet: The p105 DD is a binding site for TPL-2. (A) Schematic diagram of HA-p105 mutants. (B) 293 cells were cotransfected with TPL-2ΔC and the indicated HA-p105 mutants. Anti-HA MAb immunoprecipitates and cell lysates were Western blotted and probed with the indicated antibodies. The amounts of vector encoding TPL-2ΔC were adjusted to achieve equal protein expression in lysates with or without HA-p105. (C) TPL-2 was synthesized and labeled with [ 35 S]methionine-[ 35 S]cysteine by in vitro cell-free translation. Pulldowns were then performed with GST-p105 808-892 or GST control. Isolated protein was resolved by SDS-PAGE and revealed by fluorography.

Techniques Used: Binding Assay, Western Blot, Plasmid Preparation, Expressing, Synthesized, Labeling, In Vitro, Isolation, SDS Page

p105 blocks interaction between TPL-2 and MEK. (A) 3T3 fibroblasts were transfected with EV or TPL-2 vector or in combination with HA-p105 vector or EV. Cell lysates were Western blotted and probed sequentially with the indicated antibodies. (B) 293 cells were transfected with expression vectors encoding Myc-TPL-2 with or without wild-type or mutant version of HA-p105. GST-MEK1(K207A) protein, bound to GSH-Sepharose 4B beads, was used to affinity purify Myc-TPL-2 from cell lysates. Isolated protein and protein expression in lysates was assayed by Western blotting. (C) Lysates from 293 cells transfected with Myc-TPL-2 were incubated with the indicated concentrations of p105 DD protein prior to addition of GST-MEK1(K207A) affinity ligand. Pulldowns and lysates were Western blotted.
Figure Legend Snippet: p105 blocks interaction between TPL-2 and MEK. (A) 3T3 fibroblasts were transfected with EV or TPL-2 vector or in combination with HA-p105 vector or EV. Cell lysates were Western blotted and probed sequentially with the indicated antibodies. (B) 293 cells were transfected with expression vectors encoding Myc-TPL-2 with or without wild-type or mutant version of HA-p105. GST-MEK1(K207A) protein, bound to GSH-Sepharose 4B beads, was used to affinity purify Myc-TPL-2 from cell lysates. Isolated protein and protein expression in lysates was assayed by Western blotting. (C) Lysates from 293 cells transfected with Myc-TPL-2 were incubated with the indicated concentrations of p105 DD protein prior to addition of GST-MEK1(K207A) affinity ligand. Pulldowns and lysates were Western blotted.

Techniques Used: Transfection, Plasmid Preparation, Western Blot, Expressing, Mutagenesis, Isolation, Incubation

). (C and D) 293 cells were cotransfected with vectors encoding the indicated Myc-TPL-2 or TPL-2 mutants and HA-p105 or EV(−). Anti-HA immunoprecipitates and cell lysates were sequentially immunoblotted with the indicated antibodies.
Figure Legend Snippet: ). (C and D) 293 cells were cotransfected with vectors encoding the indicated Myc-TPL-2 or TPL-2 mutants and HA-p105 or EV(−). Anti-HA immunoprecipitates and cell lysates were sequentially immunoblotted with the indicated antibodies.

Techniques Used:

Characterization of the interaction of the TPL-2 C terminus with p105. (A) Schematic diagram of recombinant p105 proteins. (B) Recombinant p105 497-968 protein was digested with trypsin with or without TPL-2 398-497 peptide for 60 min, resolved by 10% Bis-Tris gel electrophoresis, and Western blotted. Protein fragments were visualized by Coomassie brilliant blue staining. The mobilities of p105 497-968 and the fragments corresponding to p105 497-683 and p105 534-683 are indicated. (C) Surface plasmon resonance analysis of the interaction of p105 497-805 and p105 540-801 protein with biotinylated TPL-2 398-497 peptide immobilized on a streptavidin-coated sensor surface. An open arrow denotes the injection of biotinylated TPL-2 C-terminal peptide, closed arrow denotes the injection of indicated p105 protein. (D) Binding affinities of TPL-2 398-497 peptide for the indicated recombinant p105 proteins, as determined by surface plasmon resonance.
Figure Legend Snippet: Characterization of the interaction of the TPL-2 C terminus with p105. (A) Schematic diagram of recombinant p105 proteins. (B) Recombinant p105 497-968 protein was digested with trypsin with or without TPL-2 398-497 peptide for 60 min, resolved by 10% Bis-Tris gel electrophoresis, and Western blotted. Protein fragments were visualized by Coomassie brilliant blue staining. The mobilities of p105 497-968 and the fragments corresponding to p105 497-683 and p105 534-683 are indicated. (C) Surface plasmon resonance analysis of the interaction of p105 497-805 and p105 540-801 protein with biotinylated TPL-2 398-497 peptide immobilized on a streptavidin-coated sensor surface. An open arrow denotes the injection of biotinylated TPL-2 C-terminal peptide, closed arrow denotes the injection of indicated p105 protein. (D) Binding affinities of TPL-2 398-497 peptide for the indicated recombinant p105 proteins, as determined by surface plasmon resonance.

Techniques Used: Recombinant, Nucleic Acid Electrophoresis, Western Blot, Staining, SPR Assay, Injection, Binding Assay

p105 amino acids 497 to 539 are required for dimerization of the C-terminal half of p105. (A) Binding of TPL2 398-497 peptide to p105 497-805 protein was determined by ITC. The right panel shows integrated heat changes (▪), corrected for the heat of dilution, which were fitted by using a single binding site model ( K d = 58 nM; stoichiometry, n = 0.57). Under the same conditions, p105 540-801 protein did not bind TPL2 398-497 peptide (○). The left panel shows the raw data of the p105 497-805 titration in which the heat change of this endothermic binding reaction was measured in microcalories/second. (B) Molecular masses of recombinant p105 proteins were determined by sedimentation equilibrium ultracentrifugation. The lower panels show the protein distribution at equilibrium. The upper panels give the residuals in relation to the radial position. Experimental and theoretical molecular masses of the indicated recombinant p105 proteins are shown.
Figure Legend Snippet: p105 amino acids 497 to 539 are required for dimerization of the C-terminal half of p105. (A) Binding of TPL2 398-497 peptide to p105 497-805 protein was determined by ITC. The right panel shows integrated heat changes (▪), corrected for the heat of dilution, which were fitted by using a single binding site model ( K d = 58 nM; stoichiometry, n = 0.57). Under the same conditions, p105 540-801 protein did not bind TPL2 398-497 peptide (○). The left panel shows the raw data of the p105 497-805 titration in which the heat change of this endothermic binding reaction was measured in microcalories/second. (B) Molecular masses of recombinant p105 proteins were determined by sedimentation equilibrium ultracentrifugation. The lower panels show the protein distribution at equilibrium. The upper panels give the residuals in relation to the radial position. Experimental and theoretical molecular masses of the indicated recombinant p105 proteins are shown.

Techniques Used: Binding Assay, Titration, Recombinant, Sedimentation

TPL-2 MEK kinase activity is inhibited by p105 in vitro. (A and B) Myc-TPL-2 was isolated by immunoprecipitation from lysates of transfected 293 cells and then preincubated with the different amounts of the indicated recombinant p105 proteins or control buffer (−). In vitro kinase assays (KAs) were performed with GST-MEK1(K207A) as a substrate and phosphorylation determined by Western blotting of reaction mixtures and probing with an anti-phospho-MEK1/2 Ser217/Ser221 antibody. Equal loading of GST-MEK1(K207A) protein was confirmed by reprobing blots with anti-MEK1/2 antibody. Western blotting of anti-Myc immunoprecipitates (Ip) demonstrated that similar amounts of TPL-2 were assayed in each reaction (lower panel). (C) MEK1 phosphorylation in replicates of the experiments shown in A and B was quantified by laser densitometry ( n = 3). Data are presented as percentages of control MEK kinase activity. (D) Myc-Raf1(CAAX) was immunoprecipitated from lysates of transfected 293 cells and MEK kinase activity assayed as in panel A. Recombinant p105 protein was added to a final concentration of 5 μM.
Figure Legend Snippet: TPL-2 MEK kinase activity is inhibited by p105 in vitro. (A and B) Myc-TPL-2 was isolated by immunoprecipitation from lysates of transfected 293 cells and then preincubated with the different amounts of the indicated recombinant p105 proteins or control buffer (−). In vitro kinase assays (KAs) were performed with GST-MEK1(K207A) as a substrate and phosphorylation determined by Western blotting of reaction mixtures and probing with an anti-phospho-MEK1/2 Ser217/Ser221 antibody. Equal loading of GST-MEK1(K207A) protein was confirmed by reprobing blots with anti-MEK1/2 antibody. Western blotting of anti-Myc immunoprecipitates (Ip) demonstrated that similar amounts of TPL-2 were assayed in each reaction (lower panel). (C) MEK1 phosphorylation in replicates of the experiments shown in A and B was quantified by laser densitometry ( n = 3). Data are presented as percentages of control MEK kinase activity. (D) Myc-Raf1(CAAX) was immunoprecipitated from lysates of transfected 293 cells and MEK kinase activity assayed as in panel A. Recombinant p105 protein was added to a final concentration of 5 μM.

Techniques Used: Activity Assay, In Vitro, Isolation, Immunoprecipitation, Transfection, Recombinant, Western Blot, Concentration Assay

27) Product Images from "hnRNP-Q1 represses nascent axon growth in cortical neurons by inhibiting Gap-43 mRNA translationGAP43, MARCKS, and CAP23 modulate PI(4,5)P"

Article Title: hnRNP-Q1 represses nascent axon growth in cortical neurons by inhibiting Gap-43 mRNA translationGAP43, MARCKS, and CAP23 modulate PI(4,5)P

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E15-07-0504

hnRNP-Q1 directly binds a Gap-43 5′-UTR GQ sequence through the RGG box. (A) Flag-tagged hnRNP-Q1 was immunoprecipitated from N2a cell lysates, and copurified endogenous mRNAs were assessed by qRT-PCR. n = 3, one-way ANOVA, Dunnett’s posthoc, p values: Gapdh , p = 0.9276; Gap-43 , p = 0.0002. (B) Biotinylated RNA probes corresponding to FL Gap-43 mRNA, specific Gap-43 mRNA sequences, and/or deletions, or the γ-actin 3′-UTR were in vitro transcribed (see C and D for RNA probe purity). The (C) subregion or (D) FL RNA probes were incubated with recombinant GST or GST-hnRNP-Q1 protein and precipitated with NeutrAvidin beads. Copurified protein was assessed by GST immunoblot. Relative band intensity is listed below the immunoblots, and RNA probe integrity is shown by formaldehyde gel electrophoresis. (E) Representative fluorescence spectroscopy binding curve of the hnRNP-Q1 RGG box peptide and 2AP-labeled Gap-43 5′GQ RNA probe complex in 150 mM KCl and in the presence of a fivefold excess of the hepatitis C virus core peptide. The K d value determined from triplicate experiments was 131 ± 14 nM.
Figure Legend Snippet: hnRNP-Q1 directly binds a Gap-43 5′-UTR GQ sequence through the RGG box. (A) Flag-tagged hnRNP-Q1 was immunoprecipitated from N2a cell lysates, and copurified endogenous mRNAs were assessed by qRT-PCR. n = 3, one-way ANOVA, Dunnett’s posthoc, p values: Gapdh , p = 0.9276; Gap-43 , p = 0.0002. (B) Biotinylated RNA probes corresponding to FL Gap-43 mRNA, specific Gap-43 mRNA sequences, and/or deletions, or the γ-actin 3′-UTR were in vitro transcribed (see C and D for RNA probe purity). The (C) subregion or (D) FL RNA probes were incubated with recombinant GST or GST-hnRNP-Q1 protein and precipitated with NeutrAvidin beads. Copurified protein was assessed by GST immunoblot. Relative band intensity is listed below the immunoblots, and RNA probe integrity is shown by formaldehyde gel electrophoresis. (E) Representative fluorescence spectroscopy binding curve of the hnRNP-Q1 RGG box peptide and 2AP-labeled Gap-43 5′GQ RNA probe complex in 150 mM KCl and in the presence of a fivefold excess of the hepatitis C virus core peptide. The K d value determined from triplicate experiments was 131 ± 14 nM.

Techniques Used: Sequencing, Immunoprecipitation, Quantitative RT-PCR, In Vitro, Incubation, Recombinant, Western Blot, Nucleic Acid Electrophoresis, Fluorescence, Spectroscopy, Binding Assay, Labeling

28) Product Images from "Impaired Repressor Function in SUMOylation-Defective Thyroid Hormone Receptor Isoforms"

Article Title: Impaired Repressor Function in SUMOylation-Defective Thyroid Hormone Receptor Isoforms

Journal: European Thyroid Journal

doi: 10.1159/000447232

ChIP and Re-ChIP analysis of TRβ on mGPDH and TSHα gene promoters. mGPDH or TSHα promoter constructs were transfected together with Flag-TRβ wild-type (wt) or double mutant Flag-TRβ(K50,443R) into HepG2 cells.
Figure Legend Snippet: ChIP and Re-ChIP analysis of TRβ on mGPDH and TSHα gene promoters. mGPDH or TSHα promoter constructs were transfected together with Flag-TRβ wild-type (wt) or double mutant Flag-TRβ(K50,443R) into HepG2 cells.

Techniques Used: Chromatin Immunoprecipitation, Construct, Transfection, Mutagenesis

TR is a SUMOylated protein. Expression plasmids of Flag-HA-tagged TRα wild-type (Flag-HA-TRα) ( a ) or Flag-HA-tagged TRβ wild-type (Flag-HA-TRβ) ( b ), SUMO wild-type (SUMO wt), or SUMO ΔGG were transfected into HepG2
Figure Legend Snippet: TR is a SUMOylated protein. Expression plasmids of Flag-HA-tagged TRα wild-type (Flag-HA-TRα) ( a ) or Flag-HA-tagged TRβ wild-type (Flag-HA-TRβ) ( b ), SUMO wild-type (SUMO wt), or SUMO ΔGG were transfected into HepG2

Techniques Used: Expressing, Transfection

In vitro SUMOylation of TRα and TRβ. a-c SUMOylation of TRα by SUMO-1 (S1) ( a ), SUMO-2 (S2) ( b ), and SUMO-3 (S3) ( c ) was identified. TRα wild-type (wt), the indicated single point mutants, a double mutant K281/387R, and
Figure Legend Snippet: In vitro SUMOylation of TRα and TRβ. a-c SUMOylation of TRα by SUMO-1 (S1) ( a ), SUMO-2 (S2) ( b ), and SUMO-3 (S3) ( c ) was identified. TRα wild-type (wt), the indicated single point mutants, a double mutant K281/387R, and

Techniques Used: In Vitro, Mutagenesis

29) Product Images from "RAB-6.2 and the retromer regulate glutamate receptor recycling through a retrograde pathway"

Article Title: RAB-6.2 and the retromer regulate glutamate receptor recycling through a retrograde pathway

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201104141

RAB-6.2 binds to and is colocalized with LIN-10. (A) Pull-down experiments using GST::LIN-10(PTB) or GST alone incubated with in vitro translated fusion proteins HA::RAB-6.2(GDP) or HA::RAB-6.2(GTP). (B) Pull-downs using GST::RAB-6.2(GDP), GST::RAB-6.2(GTP), or GST alone incubated with in vitro translated fusion protein HA::LIN-10(PTB). 10% of input was loaded as a control. (C–D′) LIN-10::CFP (C and D) and Venus::RAB-6.2 (C′ and D′) in neurons. (C′′ and D′′) Colocalization of LIN-10::CFP and Venus::RAB-6.2 was detected in both PVC cell bodies (C′′, arrowheads) and ventral cord dendrites (D′′, arrowheads). Bars, 5 µm. WB, Western blot.
Figure Legend Snippet: RAB-6.2 binds to and is colocalized with LIN-10. (A) Pull-down experiments using GST::LIN-10(PTB) or GST alone incubated with in vitro translated fusion proteins HA::RAB-6.2(GDP) or HA::RAB-6.2(GTP). (B) Pull-downs using GST::RAB-6.2(GDP), GST::RAB-6.2(GTP), or GST alone incubated with in vitro translated fusion protein HA::LIN-10(PTB). 10% of input was loaded as a control. (C–D′) LIN-10::CFP (C and D) and Venus::RAB-6.2 (C′ and D′) in neurons. (C′′ and D′′) Colocalization of LIN-10::CFP and Venus::RAB-6.2 was detected in both PVC cell bodies (C′′, arrowheads) and ventral cord dendrites (D′′, arrowheads). Bars, 5 µm. WB, Western blot.

Techniques Used: Incubation, In Vitro, Western Blot

30) Product Images from "Impaired Repressor Function in SUMOylation-Defective Thyroid Hormone Receptor Isoforms"

Article Title: Impaired Repressor Function in SUMOylation-Defective Thyroid Hormone Receptor Isoforms

Journal: European Thyroid Journal

doi: 10.1159/000447232

TR is a SUMOylated protein. Expression plasmids of Flag-HA-tagged TRα wild-type (Flag-HA-TRα) ( a ) or Flag-HA-tagged TRβ wild-type (Flag-HA-TRβ) ( b ), SUMO wild-type (SUMO wt), or SUMO ΔGG were transfected into HepG2
Figure Legend Snippet: TR is a SUMOylated protein. Expression plasmids of Flag-HA-tagged TRα wild-type (Flag-HA-TRα) ( a ) or Flag-HA-tagged TRβ wild-type (Flag-HA-TRβ) ( b ), SUMO wild-type (SUMO wt), or SUMO ΔGG were transfected into HepG2

Techniques Used: Expressing, Transfection

In vitro SUMOylation of TRα and TRβ. a-c SUMOylation of TRα by SUMO-1 (S1) ( a ), SUMO-2 (S2) ( b ), and SUMO-3 (S3) ( c ) was identified. TRα wild-type (wt), the indicated single point mutants, a double mutant K281/387R, and
Figure Legend Snippet: In vitro SUMOylation of TRα and TRβ. a-c SUMOylation of TRα by SUMO-1 (S1) ( a ), SUMO-2 (S2) ( b ), and SUMO-3 (S3) ( c ) was identified. TRα wild-type (wt), the indicated single point mutants, a double mutant K281/387R, and

Techniques Used: In Vitro, Mutagenesis

Regulation of a TSHα promoter by TR isoforms and mutated protein versions in response to T 3 . A TSHα promoter luciferase reporter was transfected together with TRα wild-type (wt) or the indicated mutants thereof ( a ), or together
Figure Legend Snippet: Regulation of a TSHα promoter by TR isoforms and mutated protein versions in response to T 3 . A TSHα promoter luciferase reporter was transfected together with TRα wild-type (wt) or the indicated mutants thereof ( a ), or together

Techniques Used: Luciferase, Transfection

ChIP and Re-ChIP analysis of TRα on mGPDH and TSHα gene promoters. mGPDH or TSHα promoter constructs were transfected together with HA-TRα wild-type (wt) or triple mutant HA-TRα(K281/286/387R) into HepG2 cells.
Figure Legend Snippet: ChIP and Re-ChIP analysis of TRα on mGPDH and TSHα gene promoters. mGPDH or TSHα promoter constructs were transfected together with HA-TRα wild-type (wt) or triple mutant HA-TRα(K281/286/387R) into HepG2 cells.

Techniques Used: Chromatin Immunoprecipitation, Construct, Transfection, Mutagenesis

31) Product Images from "ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage"

Article Title: ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

Journal: Genes & Development

doi: 10.1101/gad.886901

Ser395 is required for ATM-dependent phosphorylation in vivo. ( A ) p53/mdm2 double null 174-2 cells were transiently transfected with 1.5 μg of either wild-type (lanes 1,2 ) or S395A (lanes 3,4 ) Mdm2 expression plasmid, plus 4.5 μg of either empty vector (lanes 1,3 ) or ATM expression plasmid (lanes 2,4 ). Twenty-six h later, cells were harvested and subjected to SDS-PAGE followed by Western blot analysis. The membrane was first reacted with 2A10, followed by reprobing with a mixture of the Mdm2-specific MoAbs 2A9 and 4B2. ( B ) p53-null AP29 cells were infected with retroviruses expressing either wild-type or S395A human Mdm2. Forty-eight h later cells were treated with 25 μM MG132 for 4 h to block further Mdm2 degradation, and then irradiated with 8Gy and harvested 30 min later. Proteins were extracted in the presence of phosphatase inhibitors. Ten percent of the extract was taken directly for SDS-PAGE (lanes 5–8 ), whereas the rest was subjected to immunoprecipitation with MoAb 2A9, specific for human Mdm2 (lanes 1–4 ). Following transfer to a nitrocellulose membrane, the membranes were reacted sequentially with 2A10 ( upper row) and then with a mixture of 2A9 and 4B2 ( lower row).
Figure Legend Snippet: Ser395 is required for ATM-dependent phosphorylation in vivo. ( A ) p53/mdm2 double null 174-2 cells were transiently transfected with 1.5 μg of either wild-type (lanes 1,2 ) or S395A (lanes 3,4 ) Mdm2 expression plasmid, plus 4.5 μg of either empty vector (lanes 1,3 ) or ATM expression plasmid (lanes 2,4 ). Twenty-six h later, cells were harvested and subjected to SDS-PAGE followed by Western blot analysis. The membrane was first reacted with 2A10, followed by reprobing with a mixture of the Mdm2-specific MoAbs 2A9 and 4B2. ( B ) p53-null AP29 cells were infected with retroviruses expressing either wild-type or S395A human Mdm2. Forty-eight h later cells were treated with 25 μM MG132 for 4 h to block further Mdm2 degradation, and then irradiated with 8Gy and harvested 30 min later. Proteins were extracted in the presence of phosphatase inhibitors. Ten percent of the extract was taken directly for SDS-PAGE (lanes 5–8 ), whereas the rest was subjected to immunoprecipitation with MoAb 2A9, specific for human Mdm2 (lanes 1–4 ). Following transfer to a nitrocellulose membrane, the membranes were reacted sequentially with 2A10 ( upper row) and then with a mixture of 2A9 and 4B2 ( lower row).

Techniques Used: In Vivo, Transfection, Expressing, Plasmid Preparation, SDS Page, Western Blot, Infection, Blocking Assay, Irradiation, Immunoprecipitation

Mdm2 encompasses two putative 2A10 epitopes. ( A ) A 6-mer phage display peptide library was screened with the 2A10 antibody as described in Materials and Methods. Eleven positive clones obtained after the second panning, as well as four positive clones obtained after the third panning, were subjected to DNA sequencing. All clones were found to fall into only two sequence classes. The deduced amino acid sequences of the corresponding 6-mer peptides, present in the positive phage, are shown. Based on this data and on the screening of another independent library (data not shown), the consensus 2A10 epitope was deduced as 1-DYS-5, where 1 is preferentially D and 5 is preferentially L; the core DYS sequence is indicated in bold. Also shown is the number of positive phage found to carry the indicated sequence, out the total number of positive phage (in parentheses) sequenced after each panning. ( B ) are also indicated. Zn finger = zinc finger.
Figure Legend Snippet: Mdm2 encompasses two putative 2A10 epitopes. ( A ) A 6-mer phage display peptide library was screened with the 2A10 antibody as described in Materials and Methods. Eleven positive clones obtained after the second panning, as well as four positive clones obtained after the third panning, were subjected to DNA sequencing. All clones were found to fall into only two sequence classes. The deduced amino acid sequences of the corresponding 6-mer peptides, present in the positive phage, are shown. Based on this data and on the screening of another independent library (data not shown), the consensus 2A10 epitope was deduced as 1-DYS-5, where 1 is preferentially D and 5 is preferentially L; the core DYS sequence is indicated in bold. Also shown is the number of positive phage found to carry the indicated sequence, out the total number of positive phage (in parentheses) sequenced after each panning. ( B ) are also indicated. Zn finger = zinc finger.

Techniques Used: Clone Assay, DNA Sequencing, Sequencing

Serine 395 is the major site on Mdm2 for phosphorylation by ATM in vitro. ( A ) Immunoprecipitated wild-type (WT) or kinase dead (KD) FLAG-ATM were incubated with a fixed amount of E. coli -expressed recombinant proteins, consisting of fusions between GST and peptides derived from various regions of human Mdm2. The amino acid positions corresponding to each peptide are indicated in the upper part of the panel (GST–Mdm2 peptide). Kinase assays were performed in vitro as described in Materials and Methods. A fusion between GST and a peptide corresponding to residues 9–21 of human p53 (GST–p53 peptide) was used as a positive control. Upper panel: 32 P incorporation into the various GST peptides. Lower panel: Western blot with anti-FLAG M2 monoclonal antibody, confirming the presence of similar amounts of ATM protein in all reactions. ( B ) Immunoprecipitated WT or KD FLAG-ATM were incubated with recombinant proteins consisting of fusions between GST and full-length Mdm2, either wild-type or S395A. Kinase assays were performed in vitro as in A. Upper panel: Western blot with an Mdm2-specific monoclonal antibody, to assess the input amount of fusion protein in each reaction. Middle panel: 32 P incorporation into the GST–Mdm2 fusion proteins. Lower panel: Western blot with anti FLAG M2 monoclonal antibody.
Figure Legend Snippet: Serine 395 is the major site on Mdm2 for phosphorylation by ATM in vitro. ( A ) Immunoprecipitated wild-type (WT) or kinase dead (KD) FLAG-ATM were incubated with a fixed amount of E. coli -expressed recombinant proteins, consisting of fusions between GST and peptides derived from various regions of human Mdm2. The amino acid positions corresponding to each peptide are indicated in the upper part of the panel (GST–Mdm2 peptide). Kinase assays were performed in vitro as described in Materials and Methods. A fusion between GST and a peptide corresponding to residues 9–21 of human p53 (GST–p53 peptide) was used as a positive control. Upper panel: 32 P incorporation into the various GST peptides. Lower panel: Western blot with anti-FLAG M2 monoclonal antibody, confirming the presence of similar amounts of ATM protein in all reactions. ( B ) Immunoprecipitated WT or KD FLAG-ATM were incubated with recombinant proteins consisting of fusions between GST and full-length Mdm2, either wild-type or S395A. Kinase assays were performed in vitro as in A. Upper panel: Western blot with an Mdm2-specific monoclonal antibody, to assess the input amount of fusion protein in each reaction. Middle panel: 32 P incorporation into the GST–Mdm2 fusion proteins. Lower panel: Western blot with anti FLAG M2 monoclonal antibody.

Techniques Used: In Vitro, Immunoprecipitation, Incubation, Recombinant, Derivative Assay, Positive Control, Western Blot

Mutation of serine 395 decreases 2A10 immunoreactivity. H1299 cells were transiently transfected with expression plasmids (600 ng each) encoding either wild-type human Mdm2 (WT), Mdm2 S395A, or Mdm2 S395D. Twenty-six h later, cells were harvested and subjected to SDS-PAGE followed by Western blot analysis. The membranes were reacted either with a mixture of the 2A9 and 4B2 Mdm2-specific monoclonal antibodies or with the 2A10 Mdm2-specific monoclonal antibody.
Figure Legend Snippet: Mutation of serine 395 decreases 2A10 immunoreactivity. H1299 cells were transiently transfected with expression plasmids (600 ng each) encoding either wild-type human Mdm2 (WT), Mdm2 S395A, or Mdm2 S395D. Twenty-six h later, cells were harvested and subjected to SDS-PAGE followed by Western blot analysis. The membranes were reacted either with a mixture of the 2A9 and 4B2 Mdm2-specific monoclonal antibodies or with the 2A10 Mdm2-specific monoclonal antibody.

Techniques Used: Mutagenesis, Transfection, Expressing, SDS Page, Western Blot

Mdm2 S395D is impaired in promoting p53 degradation. ( A ) H1299 cells were transiently transfected with 15 ng of human p53 expression plasmid, either alone (lane 1 ) or in combination with 100, 300, or 600 ng of wild-type Mdm2 or Mdm2 S395D expression plasmids (lanes 2–4 and 5–7, respectively). Twenty-six h later cells were harvested and subjected to SDS-PAGE, followed by Western blot analysis. The membranes were reacted with a mixture of the 2A9 and 4B2 Mdm2-specific monoclonal antibodies ( upper panel) or with a mixture of the p53-specific monoclonal antibodies DO-1 and PAb1801 ( lower panel). ( B ) U2-OS cells were transiently transfected with 0.5 μg of GFP-p53 expression plasmid DNA, together with 2 μg of DNA encoding either wild-type (WT) or mutant human Mdm2, as indicated above the corresponding panels. Forty-eight h later cells were fixed and stained with DAPI (panels a,d,g ) and with the anti-Mdm2 monoclonal antibody 4B2 followed by Cy3-conjugated goat anti-mouse immunoglobulin serum (panels b,e,h ). GFP–p53, in the same microscopic fields, was visualized by monitoring green fluorescence with an appropriate filter (panels c,f,i ).
Figure Legend Snippet: Mdm2 S395D is impaired in promoting p53 degradation. ( A ) H1299 cells were transiently transfected with 15 ng of human p53 expression plasmid, either alone (lane 1 ) or in combination with 100, 300, or 600 ng of wild-type Mdm2 or Mdm2 S395D expression plasmids (lanes 2–4 and 5–7, respectively). Twenty-six h later cells were harvested and subjected to SDS-PAGE, followed by Western blot analysis. The membranes were reacted with a mixture of the 2A9 and 4B2 Mdm2-specific monoclonal antibodies ( upper panel) or with a mixture of the p53-specific monoclonal antibodies DO-1 and PAb1801 ( lower panel). ( B ) U2-OS cells were transiently transfected with 0.5 μg of GFP-p53 expression plasmid DNA, together with 2 μg of DNA encoding either wild-type (WT) or mutant human Mdm2, as indicated above the corresponding panels. Forty-eight h later cells were fixed and stained with DAPI (panels a,d,g ) and with the anti-Mdm2 monoclonal antibody 4B2 followed by Cy3-conjugated goat anti-mouse immunoglobulin serum (panels b,e,h ). GFP–p53, in the same microscopic fields, was visualized by monitoring green fluorescence with an appropriate filter (panels c,f,i ).

Techniques Used: Transfection, Expressing, Plasmid Preparation, SDS Page, Western Blot, Mutagenesis, Staining, Fluorescence

Microinjection of 2A10 induces p53 accumulation. Primary MEFs were microinjected with ascites fluid of either the anti-Mdm2 monoclonal antibody 2A10 (panels a–c ), or the anti-Mdm2 monoclonal antibody 4B2 (panels d–f ). Twenty-nine h later, cells were fixed and stained with DAPI (panels a,d ), Cy3-conjugated goat anti-mouse antibody to visualize the microinjected mouse monoclonal antibodies (panels b,e ), and anti-p53 polyclonal serum followed by FITC-conjugated donkey anti-rabbit antibody, to visualize endogenous p53 (panels c,f ). Panels a–c ) represent the same microscopic fields, photographed at three different wavelengths, as is also the case for panels d–f . Ig = immunoglobulin.
Figure Legend Snippet: Microinjection of 2A10 induces p53 accumulation. Primary MEFs were microinjected with ascites fluid of either the anti-Mdm2 monoclonal antibody 2A10 (panels a–c ), or the anti-Mdm2 monoclonal antibody 4B2 (panels d–f ). Twenty-nine h later, cells were fixed and stained with DAPI (panels a,d ), Cy3-conjugated goat anti-mouse antibody to visualize the microinjected mouse monoclonal antibodies (panels b,e ), and anti-p53 polyclonal serum followed by FITC-conjugated donkey anti-rabbit antibody, to visualize endogenous p53 (panels c,f ). Panels a–c ) represent the same microscopic fields, photographed at three different wavelengths, as is also the case for panels d–f . Ig = immunoglobulin.

Techniques Used: Staining

32) Product Images from "Expression of hsp16 in response to nucleotide depletion is regulated via the spc1 MAPK pathway in Schizosaccharomyces pombe"

Article Title: Expression of hsp16 in response to nucleotide depletion is regulated via the spc1 MAPK pathway in Schizosaccharomyces pombe

Journal: Nucleic Acids Research

doi:

Expression of hsp16. ( A and B ) Northern blot analysis of hsp16 expression in a cdc22 - M45 mutant background. (A) Total RNA was isolated from the strains indicated at 25°C, (B) total RNA was isolated following 4 h heat shock treatment at 36°C. RNA was analyzed by northern hybridization with a probe specific for hsp16 (A and B, upper panels). A ribosomal DNA probe was used as a loading control (A and B, lower panels). ( C ) hsp16 protein level correlates with RNA expression levels. Hsp16 protein levels are increased in a cdc22 -M45 mutant background (lanes 1, 3, 5 and 7 at 25°C; lanes 2, 4 and 6 at 36°C). All strains were cultured at 25°C, then shifted to 36°C for 4 h in YEA medium.
Figure Legend Snippet: Expression of hsp16. ( A and B ) Northern blot analysis of hsp16 expression in a cdc22 - M45 mutant background. (A) Total RNA was isolated from the strains indicated at 25°C, (B) total RNA was isolated following 4 h heat shock treatment at 36°C. RNA was analyzed by northern hybridization with a probe specific for hsp16 (A and B, upper panels). A ribosomal DNA probe was used as a loading control (A and B, lower panels). ( C ) hsp16 protein level correlates with RNA expression levels. Hsp16 protein levels are increased in a cdc22 -M45 mutant background (lanes 1, 3, 5 and 7 at 25°C; lanes 2, 4 and 6 at 36°C). All strains were cultured at 25°C, then shifted to 36°C for 4 h in YEA medium.

Techniques Used: Expressing, Northern Blot, Mutagenesis, Isolation, Hybridization, RNA Expression, Cell Culture

Hsp16–GFP expression is activated following HU or CPT treatment. Analysis of hsp16–GFP levels in cdc22 - M45 mutant. ( A ) Cells were cultured at 25°C (lightly shaded bars) in YEA to mid-exponential phase and then hydroxyurea (heavily shaded bars) was added at a final concentration of 11 mM to one-half of the culture and incubated for 4 h. ( B ) Cells were cultured at 25°C (lightly shaded bars) in YEA to mid-exponential and then camptothecin (heavily shaded bars) was added at a final concentration of 40 µM to one-half of the culture and incubated for 2 h. Hsp16–GFP levels were quantitated by fluorimetry.
Figure Legend Snippet: Hsp16–GFP expression is activated following HU or CPT treatment. Analysis of hsp16–GFP levels in cdc22 - M45 mutant. ( A ) Cells were cultured at 25°C (lightly shaded bars) in YEA to mid-exponential phase and then hydroxyurea (heavily shaded bars) was added at a final concentration of 11 mM to one-half of the culture and incubated for 4 h. ( B ) Cells were cultured at 25°C (lightly shaded bars) in YEA to mid-exponential and then camptothecin (heavily shaded bars) was added at a final concentration of 40 µM to one-half of the culture and incubated for 2 h. Hsp16–GFP levels were quantitated by fluorimetry.

Techniques Used: Expressing, Cycling Probe Technology, Mutagenesis, Cell Culture, Concentration Assay, Incubation

A model of the pathway involved in the regulation of hsp16 expression in S.pombe . This model is based on results in this study.
Figure Legend Snippet: A model of the pathway involved in the regulation of hsp16 expression in S.pombe . This model is based on results in this study.

Techniques Used: Expressing

33) Product Images from "A vesicle carrier that mediates peroxisome protein traffic from the endoplasmic reticulum"

Article Title: A vesicle carrier that mediates peroxisome protein traffic from the endoplasmic reticulum

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1013397107

pA - GFP-Pex15Gp and Pex3-pAp co-isolate in budded vesicles. ( A ) A fivefold scaled-up vesicle-budding incubation was carried out with microsomes prepared from pex19 Δ cells coexpressing pA-GST-Pex15Gp (CEN plasmid) and Pex3-pAp (chromosomally integrated). The resulting MSS fraction (lane 1) was incubated with glutathione-agarose beads in buffer with (lane 3) or without (lane 2) Triton X-100. Sec22p is a COPII vesicle cargo protein. ( B ) The MSS fraction was prepared from a budding reaction using membranes from the Pex3-pAp strain mixed with pex19Δ cytosol and purified GST-Pex19p. The MSS fraction was subjected to high-speed centrifugation to obtain vesicles enriched in an HSP. The HSP was resuspended with B88 buffer (lanes 1 and 2), 0.1 M Na 2 CO 3 (lanes 3 and 4), and 1% Triton X-100 (lanes 5 and 6). The resuspended HSP was centrifuged again at 55,000 rpm in TLA100.3 for 30 min and separated into pellet (P) and supernatant (S). Lane 7, 10% load of the starting microsome fraction.
Figure Legend Snippet: pA - GFP-Pex15Gp and Pex3-pAp co-isolate in budded vesicles. ( A ) A fivefold scaled-up vesicle-budding incubation was carried out with microsomes prepared from pex19 Δ cells coexpressing pA-GST-Pex15Gp (CEN plasmid) and Pex3-pAp (chromosomally integrated). The resulting MSS fraction (lane 1) was incubated with glutathione-agarose beads in buffer with (lane 3) or without (lane 2) Triton X-100. Sec22p is a COPII vesicle cargo protein. ( B ) The MSS fraction was prepared from a budding reaction using membranes from the Pex3-pAp strain mixed with pex19Δ cytosol and purified GST-Pex19p. The MSS fraction was subjected to high-speed centrifugation to obtain vesicles enriched in an HSP. The HSP was resuspended with B88 buffer (lanes 1 and 2), 0.1 M Na 2 CO 3 (lanes 3 and 4), and 1% Triton X-100 (lanes 5 and 6). The resuspended HSP was centrifuged again at 55,000 rpm in TLA100.3 for 30 min and separated into pellet (P) and supernatant (S). Lane 7, 10% load of the starting microsome fraction.

Techniques Used: Incubation, Plasmid Preparation, Purification, Centrifugation

34) Product Images from "Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts"

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts

Journal: Structure (London, England : 1993)

doi: 10.1016/j.str.2017.07.014

NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .
Figure Legend Snippet: NMR and HDX are consistent with compact autoinhibited BTK SH3-SH2-kinase (a) Chemical shift changes between the isolated SH3, SH2 and SH3-SH2. Red indicates chemical shift change and blue no change in resonance frequency. Gray shows ambiguity in assignment. Cartoon above the structure indicates the BTK construct studied; the red dashed box indicates the domain/s being monitored, here and in subsequent figures. W251 in SH3 and R307 in the pY pocket of SH2 are labeled. (b) Chemical shift changes in the isolated SH3 and SH2 domains in the context of FL BTK. Colors same as (a). PHTH and kinase domains are surface rendered. (c) Superpositions of 1 H- 15 N TROSY-HSQC spectra of SH3 (green) and SH2 (blue) with ( i ) SH3–SH2 (black) and ( ii ) FL BTK (black). W251 and R307 resonances are boxed. (d) HDX changes in SH3-SH2 in the context of FL BTK (D FL − D SH3-SH2 , D = Relative deuterium incorporation, here and all subsequent figures). Regions of protection are shown in purple, and exposure in green, here and all subsequent figures. (e) HDX difference data in (d) mapped onto autoinhibited FL BTK. Here and in all subsequent figures differences between 0.5 Da to 1.0 Da are shown as light blue (modest decrease) or light pink (modest increase), while differences greater than 1.0 Da are shown as dark blue (meaningful decrease) or red (meaningful increase). No change is gray and absence of data is pale peach. SH3-SH2 is shown in ribbons and PHTH and kinase domains are surface rendered. (e) HDX changes in ( i ) D 3-2-L-KD − D L-KD and (ii) D 2-L-KD − D L-KD . (i) Mapping changes from (h( i .

Techniques Used: Nuclear Magnetic Resonance, Isolation, Construct, Labeling

Interdomain contacts in FL BTK ). (c) Alternate view of the BTK PHTH domain in the autoinhibited structure. (d) Sequence alignment of the C-terminus of the TEC family, SRC, CSK and ABL kinase domains. Acidic nature of BTK D656 is conserved in TEC kinases (boxed, red). The C-terminal conserved tyrosine in SRC kinase is boxed (blue). (e) Structure of the autoinhibited SRC kinase (PDB: 1FMK) showing the C-terminal pY527 interaction with the conserved R175 in the SH2 binding pocket. C-terminal tail is gray and SH2 domain is blue.
Figure Legend Snippet: Interdomain contacts in FL BTK ). (c) Alternate view of the BTK PHTH domain in the autoinhibited structure. (d) Sequence alignment of the C-terminus of the TEC family, SRC, CSK and ABL kinase domains. Acidic nature of BTK D656 is conserved in TEC kinases (boxed, red). The C-terminal conserved tyrosine in SRC kinase is boxed (blue). (e) Structure of the autoinhibited SRC kinase (PDB: 1FMK) showing the C-terminal pY527 interaction with the conserved R175 in the SH2 binding pocket. C-terminal tail is gray and SH2 domain is blue.

Techniques Used: Sequencing, Binding Assay

Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .
Figure Legend Snippet: Characterization of FL BTK mutants (a) Location of W251 and W395 (sticks, orange) in autoinhibited BTK. BTK PHTH (teal), SH3 (green), SH2-kinase linker (red) and kinase domain (grey). (b) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance in wild type (WT) FL BTK ( i ), with added peptide ligands for SH3 ( ii ) and SH2 ( iii ). The two dashed lines indicate the positions of W395 resonance in WT FL BTK; the upfield W395 peak corresponds to the autoinhibited, inactive conformation and the downfield peak corresponding to the open, active conformation of BTK, here and in all subsequent figures. (c) 1 H- 15 N TROSY-HSQC spectra showing W395 resonance for FL BTK mutants: ( i ) P385A/T387A, ( ii ) D656K and ( iii ) PRR(A) (proline rich region mutant: P189A/P192A/P203A/P204A). (d e) Western blot showing the kinase activity of 6XHis-FL BTK WT and mutants: BTK P385A/T387A, BTK D656K and BTK PRR(A). Here and in subsequent figures autophosphorylation on BTK is monitored using an Anti-pY antibody and total protein levels are monitored with an Anti-6XHis antibody. (e) Histogram showing the BTK activity data in (d). Phosphorylation levels in the Anti-pY blot were quantified and divided by the total protein level (Anti-His blot). Activity of the FL WT BTK = 1, and the relative activity of BTK mutants is shown. Data is the average of three independent experiments. (f) 1 H- 15 N TROSY-HSQC spectra showing that the PRR occupies BTK SH3 in the PHTH-PRR-SH3 fragment. Superposition of the region 1 H- 15 N TROSY-HSQC spectra containing the W251 resonance for: ( i ) BTK PHTH-PRR-SH3 (red) and BTK SH3 (black), and ( ii .

Techniques Used: Mutagenesis, Western Blot, Activity Assay

35) Product Images from "Identification of lipocalin-2 as a PKCδ phosphorylation substrate in neutrophils"

Article Title: Identification of lipocalin-2 as a PKCδ phosphorylation substrate in neutrophils

Journal: Journal of Biomedical Science

doi: 10.1186/s12929-015-0129-z

PKCδ phosphorylation of LCN2 at T115 is reduced in neutrophils from Prkcd −/− mice. (A) An affinity-purified rabbit anti-phospho-LCN2 (T115) antibody detected PKCδ phosphorylation of recombinant LCN2 (P), but not unphosphorylated LCN2 (N). The antibody was not immunoreactive against the LCN2 T115A mutant before or after incubation with PKCδ. ( B) Representative western blot showing less immunoreactivity with the phospho-LCN2 (T115) antibody in neutrophil lysates from Prkcd −/− mice than in lysates from WT littermates. (C) The ratio of P-LCN2 (T115) to LCN2 immunoreactivity was significantly reduced in neutrophils from Prkcd −/− compared with Prkcd +/+ mice ( n = 3) (* p
Figure Legend Snippet: PKCδ phosphorylation of LCN2 at T115 is reduced in neutrophils from Prkcd −/− mice. (A) An affinity-purified rabbit anti-phospho-LCN2 (T115) antibody detected PKCδ phosphorylation of recombinant LCN2 (P), but not unphosphorylated LCN2 (N). The antibody was not immunoreactive against the LCN2 T115A mutant before or after incubation with PKCδ. ( B) Representative western blot showing less immunoreactivity with the phospho-LCN2 (T115) antibody in neutrophil lysates from Prkcd −/− mice than in lysates from WT littermates. (C) The ratio of P-LCN2 (T115) to LCN2 immunoreactivity was significantly reduced in neutrophils from Prkcd −/− compared with Prkcd +/+ mice ( n = 3) (* p

Techniques Used: Mouse Assay, Affinity Purification, Recombinant, Mutagenesis, Incubation, Western Blot

Purification of LCN2. (A) Recombinant GST-LCN2 was purified from E. coli BL21 by affinity chromatography using glutathione-sepharose 4B. Lysates from different purification steps were separated by SDS-PAGE: before (Bf) and after (Af) IPTG induction, supernatant after centrifugation (S), flow-through from column after loading supernatant (FT), 1st column wash (W1), 2nd column wash (W2), and elution of GST-LCN2 (E). (B) GST-LCN2 was digested by thrombin to remove the GST tag. GST-LCN2 was incubated with Thrombin-agarose (Sigma) at RT for up to 4 h. After 4 h incubation, the cleaved GST was absorbed by glutathione-sepharose. The supernatant containing only LCN2 (4 h*) was collected.
Figure Legend Snippet: Purification of LCN2. (A) Recombinant GST-LCN2 was purified from E. coli BL21 by affinity chromatography using glutathione-sepharose 4B. Lysates from different purification steps were separated by SDS-PAGE: before (Bf) and after (Af) IPTG induction, supernatant after centrifugation (S), flow-through from column after loading supernatant (FT), 1st column wash (W1), 2nd column wash (W2), and elution of GST-LCN2 (E). (B) GST-LCN2 was digested by thrombin to remove the GST tag. GST-LCN2 was incubated with Thrombin-agarose (Sigma) at RT for up to 4 h. After 4 h incubation, the cleaved GST was absorbed by glutathione-sepharose. The supernatant containing only LCN2 (4 h*) was collected.

Techniques Used: Purification, Recombinant, Affinity Chromatography, SDS Page, Centrifugation, Flow Cytometry, Incubation

PKCδ phosphorylates LCN2 at T115 in vitro . (A) Recombinant LCN2 proteins were subjected to in vitro kinase assays by PKCδ for up to 4 h. Representative autoradiographs of phosphorylated LCN2 (P-LCN2) are shown in the upper panel. Scanned images of Coomassie blue-stained gels (LCN2) are in the lower panel. (B) Analysis of LCN2 phosphorylation by PKCδ using mass spectrometry. LCN2 was phosphorylated by PKCδ and digested with trypsin. Fragments identified by nano-LC-MS/MS are underlined. The phosphorylated form of peptide AGQF[T]LGNMHR (in bold, amino acids 111–121) was detected. (C) Mass spectrometry spectrum. Identification of the phosphopeptide AGQF[T]LGNMHR (Mr = 1326.57, m/z = 615.33) by tandem MS indicating that the peptide was phosphorylated at T115. (D) Recombinant LCN2 T115A proteins were subjected to in vitro kinase assays by PKCδ for up to 4 h. (E) Crystal structure of LCN2 containing a siderophore (colored by atom type, N = blue, C = black, O = red) and an iron (orange). T115 with side chain shown is located in the β5 strand. (F) Sequence surrounding T115 (highlighted in red) from human, rat, and mouse LCN2 homologs. Conserved amino acids are surrounded by black boxes.
Figure Legend Snippet: PKCδ phosphorylates LCN2 at T115 in vitro . (A) Recombinant LCN2 proteins were subjected to in vitro kinase assays by PKCδ for up to 4 h. Representative autoradiographs of phosphorylated LCN2 (P-LCN2) are shown in the upper panel. Scanned images of Coomassie blue-stained gels (LCN2) are in the lower panel. (B) Analysis of LCN2 phosphorylation by PKCδ using mass spectrometry. LCN2 was phosphorylated by PKCδ and digested with trypsin. Fragments identified by nano-LC-MS/MS are underlined. The phosphorylated form of peptide AGQF[T]LGNMHR (in bold, amino acids 111–121) was detected. (C) Mass spectrometry spectrum. Identification of the phosphopeptide AGQF[T]LGNMHR (Mr = 1326.57, m/z = 615.33) by tandem MS indicating that the peptide was phosphorylated at T115. (D) Recombinant LCN2 T115A proteins were subjected to in vitro kinase assays by PKCδ for up to 4 h. (E) Crystal structure of LCN2 containing a siderophore (colored by atom type, N = blue, C = black, O = red) and an iron (orange). T115 with side chain shown is located in the β5 strand. (F) Sequence surrounding T115 (highlighted in red) from human, rat, and mouse LCN2 homologs. Conserved amino acids are surrounded by black boxes.

Techniques Used: In Vitro, Recombinant, Staining, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Sequencing

Colocalization of PKCδ and LCN2 in neutrophils. Neutrophils treated with or without fMLP were stained with specific antibodies against PKCδ (red) and LCN2 (green). Merged images (yellow) indicate colocalization of PKCδ and LCN2. Phalloidin staining (dark blue) revealed the reorganization of F-actin and polarization of neutrophils. An arrow indicates the front edge of the neutrophil that is enriched with F-actin. DAPI (light blue) was used to detect nuclei. Scale bars, 10 μm.
Figure Legend Snippet: Colocalization of PKCδ and LCN2 in neutrophils. Neutrophils treated with or without fMLP were stained with specific antibodies against PKCδ (red) and LCN2 (green). Merged images (yellow) indicate colocalization of PKCδ and LCN2. Phalloidin staining (dark blue) revealed the reorganization of F-actin and polarization of neutrophils. An arrow indicates the front edge of the neutrophil that is enriched with F-actin. DAPI (light blue) was used to detect nuclei. Scale bars, 10 μm.

Techniques Used: Staining

Identification and purification of PKCδ substrates in neutrophils. (A) Western blot with anti-thiophosphate ester antibody showing putative PKCδ substrates in neutrophil lysates from AS-PKCδ knock-in (KI) mice. The bottom panel shows β-actin immunoreactivity in the same samples as a loading control. (B, C) Identification of PKCδ substrates by MicroSol-IEF purification and mass spectrometry. AS-PKCδ neutrophil lysates were incubated with PMA and N 6 -(benzyl)-ATP-γS, and then thiophosphorylated proteins were alkylated with PNBM and separated by isoelectric focusing in 5 pools as shown. The proteins fractionated before (bf IEF) and after IEF were separated on parallel gels, one of which was subjected to western blot analysis using anti-thiophosphate ester antibody (B) and the other stained with Coomassie Blue (C) . The Coomassie-stained protein bands that matched with the immunoreactive bands were excised for analysis by mass spectrometry. The arrows indicate a protein band in the 7–10 pI pool that was identified as LCN2.
Figure Legend Snippet: Identification and purification of PKCδ substrates in neutrophils. (A) Western blot with anti-thiophosphate ester antibody showing putative PKCδ substrates in neutrophil lysates from AS-PKCδ knock-in (KI) mice. The bottom panel shows β-actin immunoreactivity in the same samples as a loading control. (B, C) Identification of PKCδ substrates by MicroSol-IEF purification and mass spectrometry. AS-PKCδ neutrophil lysates were incubated with PMA and N 6 -(benzyl)-ATP-γS, and then thiophosphorylated proteins were alkylated with PNBM and separated by isoelectric focusing in 5 pools as shown. The proteins fractionated before (bf IEF) and after IEF were separated on parallel gels, one of which was subjected to western blot analysis using anti-thiophosphate ester antibody (B) and the other stained with Coomassie Blue (C) . The Coomassie-stained protein bands that matched with the immunoreactive bands were excised for analysis by mass spectrometry. The arrows indicate a protein band in the 7–10 pI pool that was identified as LCN2.

Techniques Used: Purification, Western Blot, Knock-In, Mouse Assay, Electrofocusing, Mass Spectrometry, Incubation, Staining

The release of LCN2 is reduced in Prkcd −/− mice in response to fMLP and cerebral ischemia. (A) Neutrophils from Prkcd +/+ and Prkcd −/− were stimulated with 1 μM of fMLP at 37°C for up to 120 min. LCN2 released into the media (release) and remained in neutrophils (PMN) at different time points were detected by western blot analysis. Actin detected in neutrophils (PMN) was used as the loading control. (B) Mouse sera collected at different time points after global cerebral ischemia were subjected to western blot analysis with anti-LCN2 and anti-IgG antibodies. The serum of mice without ischemia was collected as a control (0). The top panel is a representative western blot. The LCN2 and IgG protein bands were quantified by densitometry in the bottom panel. Ischemia-induced LCN2 differed by genotype [F(1,22) = 56.6; p
Figure Legend Snippet: The release of LCN2 is reduced in Prkcd −/− mice in response to fMLP and cerebral ischemia. (A) Neutrophils from Prkcd +/+ and Prkcd −/− were stimulated with 1 μM of fMLP at 37°C for up to 120 min. LCN2 released into the media (release) and remained in neutrophils (PMN) at different time points were detected by western blot analysis. Actin detected in neutrophils (PMN) was used as the loading control. (B) Mouse sera collected at different time points after global cerebral ischemia were subjected to western blot analysis with anti-LCN2 and anti-IgG antibodies. The serum of mice without ischemia was collected as a control (0). The top panel is a representative western blot. The LCN2 and IgG protein bands were quantified by densitometry in the bottom panel. Ischemia-induced LCN2 differed by genotype [F(1,22) = 56.6; p

Techniques Used: Mouse Assay, Western Blot

36) Product Images from "CD40, an extracellular receptor for binding and uptake of Hsp70-peptide complexes"

Article Title: CD40, an extracellular receptor for binding and uptake of Hsp70-peptide complexes

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200208083

Transfection with human CD40 cDNA renders Cos-7 cells active in binding human Hsp70. Cos-7 cells were transiently transfected with a fusion construct that contained human CD40 cDNA, followed by an internal ribosomal entry site and the cDNA for EGFP, giving rise to green fluorescence of transfected cells. Cells were incubated for 30 min at 0°C with biotinylated Hsp70 (A), biotinylated GST as a control (B), Hsp70–peptide complex containing biotinylated peptide C (C), or with biotinylated peptide C alone (D). Thereafter, cells were washed and incubated with TRITC-streptavidin and processed for fluorescence microscopy as described in Fig. 1 . Left-hand panels show streptavidin fluorescence and right-hand panels show EGFP fluorescence.
Figure Legend Snippet: Transfection with human CD40 cDNA renders Cos-7 cells active in binding human Hsp70. Cos-7 cells were transiently transfected with a fusion construct that contained human CD40 cDNA, followed by an internal ribosomal entry site and the cDNA for EGFP, giving rise to green fluorescence of transfected cells. Cells were incubated for 30 min at 0°C with biotinylated Hsp70 (A), biotinylated GST as a control (B), Hsp70–peptide complex containing biotinylated peptide C (C), or with biotinylated peptide C alone (D). Thereafter, cells were washed and incubated with TRITC-streptavidin and processed for fluorescence microscopy as described in Fig. 1 . Left-hand panels show streptavidin fluorescence and right-hand panels show EGFP fluorescence.

Techniques Used: Transfection, Binding Assay, Construct, Fluorescence, Incubation, Microscopy

Peptide substrate stimulates Hsp70 binding to CD40. (A) His6-tagged Hsp70 was incubated with increasing concentrations of peptide C as indicated, and binding to GST-CD40 was analyzed by immunoblotting with antibodies directed against the His6-tag. The bottom panel is a quantitation of the data. (B) Equivalent concentrations (3 μM) of His6-tagged Hsp70 (in the presence of 2 mol ADP and in the absence or presence of a 30-fold molar excess of peptide C) or His6-tagged N70 were incubated with GST-CD40, and bound protein was analyzed as described for panel A.
Figure Legend Snippet: Peptide substrate stimulates Hsp70 binding to CD40. (A) His6-tagged Hsp70 was incubated with increasing concentrations of peptide C as indicated, and binding to GST-CD40 was analyzed by immunoblotting with antibodies directed against the His6-tag. The bottom panel is a quantitation of the data. (B) Equivalent concentrations (3 μM) of His6-tagged Hsp70 (in the presence of 2 mol ADP and in the absence or presence of a 30-fold molar excess of peptide C) or His6-tagged N70 were incubated with GST-CD40, and bound protein was analyzed as described for panel A.

Techniques Used: Binding Assay, Incubation, Quantitation Assay

Binding of Hsp70 to CD40 is direct and depends on ADP. (A) HeLa cell lysates were incubated with GST (control) or GST-CD40 in the amounts indicated. Thereafter, samples were affinity-purified on glutathione-sepharose as outlined in Materials and methods, subjected to SDS-PAGE, and analyzed by immunoblotting with antibodies directed against Hsc70 and Hsp70 (top lanes), and against Hsp90 (bottom lanes). (B) Human recombinant His6-tagged Hsp70 was incubated with ATP, ADP, or an excess of peptide C, followed by addition of CD40-GST or GST alone. After affinity purification, samples were analyzed by immunoblotting as described in A, using antibodies directed against the His6 tag. (C) Recombinant human His6-tagged Hsp70 was incubated with peptide C, either in the presence or absence of ADP. The reactions were then incubated with ANA-1 cell lysates as described in Materials and methods. Protein bound to Hsp70 was analyzed by affinity purification on Ni-NTA agarose and immunoblotting with antibodies directed against CD40. Input reflects the amount of protein subjected to affinity purification.
Figure Legend Snippet: Binding of Hsp70 to CD40 is direct and depends on ADP. (A) HeLa cell lysates were incubated with GST (control) or GST-CD40 in the amounts indicated. Thereafter, samples were affinity-purified on glutathione-sepharose as outlined in Materials and methods, subjected to SDS-PAGE, and analyzed by immunoblotting with antibodies directed against Hsc70 and Hsp70 (top lanes), and against Hsp90 (bottom lanes). (B) Human recombinant His6-tagged Hsp70 was incubated with ATP, ADP, or an excess of peptide C, followed by addition of CD40-GST or GST alone. After affinity purification, samples were analyzed by immunoblotting as described in A, using antibodies directed against the His6 tag. (C) Recombinant human His6-tagged Hsp70 was incubated with peptide C, either in the presence or absence of ADP. The reactions were then incubated with ANA-1 cell lysates as described in Materials and methods. Protein bound to Hsp70 was analyzed by affinity purification on Ni-NTA agarose and immunoblotting with antibodies directed against CD40. Input reflects the amount of protein subjected to affinity purification.

Techniques Used: Binding Assay, Incubation, Affinity Purification, SDS Page, Recombinant

Hsp70 binding to CD40 is mediated by the NH 2 -terminal ATPase domain and is competed by Hip. (A) Human His6-tagged Hsp70, its NH 2 - or COOH-terminal domains, or recombinant bacterial DnaK was incubated either with GST-CD40 or with GST. (B) Recombinant DnaK was incubated with ADP, ATP, or an excess of peptide C, followed by addition of GST-CD40 or GST alone. (C) His6-tagged N70 was incubated in the presence of ADP or ATP, followed by incubation with a 10-fold molar excess of Hsp70 in the presence of ADP or ATP. (D) Recombinant human His6-tagged Hsp70 protein was incubated with a fivefold molar excess of either recombinant Hip protein or Bag-1, and with GST-CD40 or GST as a control. Bound protein was analyzed after affinity purification on glutathione-sepharose by immunoblotting with an antibody directed against the NH 2 -terminal His6 tags, or with an antibody directed against DnaK.
Figure Legend Snippet: Hsp70 binding to CD40 is mediated by the NH 2 -terminal ATPase domain and is competed by Hip. (A) Human His6-tagged Hsp70, its NH 2 - or COOH-terminal domains, or recombinant bacterial DnaK was incubated either with GST-CD40 or with GST. (B) Recombinant DnaK was incubated with ADP, ATP, or an excess of peptide C, followed by addition of GST-CD40 or GST alone. (C) His6-tagged N70 was incubated in the presence of ADP or ATP, followed by incubation with a 10-fold molar excess of Hsp70 in the presence of ADP or ATP. (D) Recombinant human His6-tagged Hsp70 protein was incubated with a fivefold molar excess of either recombinant Hip protein or Bag-1, and with GST-CD40 or GST as a control. Bound protein was analyzed after affinity purification on glutathione-sepharose by immunoblotting with an antibody directed against the NH 2 -terminal His6 tags, or with an antibody directed against DnaK.

Techniques Used: Binding Assay, Recombinant, Incubation, Affinity Purification

LPS treatment of ANA-1 cells stimulates binding of Hsp70 and induces expression of CD40. Cells were incubated with LPS or mock-treated as outlined in Materials and methods. (A) Cells were incubated either with biotinylated Hsp70, Hsp70 loaded with biotinylated peptide C, or with biotinylated GST as a control. After 30 min at 4°C, cells were washed, incubated with TRITC-labeled streptavidin, washed again, and processed for fluorescence microscopy. (top) mock-treated ANA-1 cells; (bottom) ANA-1 cells after treatment with LPS. Note that Hsp70 carries on average five biotins, whereas peptide C contains a single biotin. (B) Cells were harvested, lysed, and centrifuged to obtain a total membrane pellet. Identical protein amounts of the samples were analyzed by immunoblotting with an antibody directed against CD40. (Lanes 1 and 4) total cell lysates; (lanes 2 and 5) membrane fractions; (lanes 3 and 6) supernatants.
Figure Legend Snippet: LPS treatment of ANA-1 cells stimulates binding of Hsp70 and induces expression of CD40. Cells were incubated with LPS or mock-treated as outlined in Materials and methods. (A) Cells were incubated either with biotinylated Hsp70, Hsp70 loaded with biotinylated peptide C, or with biotinylated GST as a control. After 30 min at 4°C, cells were washed, incubated with TRITC-labeled streptavidin, washed again, and processed for fluorescence microscopy. (top) mock-treated ANA-1 cells; (bottom) ANA-1 cells after treatment with LPS. Note that Hsp70 carries on average five biotins, whereas peptide C contains a single biotin. (B) Cells were harvested, lysed, and centrifuged to obtain a total membrane pellet. Identical protein amounts of the samples were analyzed by immunoblotting with an antibody directed against CD40. (Lanes 1 and 4) total cell lysates; (lanes 2 and 5) membrane fractions; (lanes 3 and 6) supernatants.

Techniques Used: Binding Assay, Expressing, Incubation, Labeling, Fluorescence, Microscopy

37) Product Images from "Engineering of Papaya Mosaic Virus (PapMV) Nanoparticles through Fusion of the HA11 Peptide to Several Putative Surface-Exposed Sites"

Article Title: Engineering of Papaya Mosaic Virus (PapMV) Nanoparticles through Fusion of the HA11 Peptide to Several Putative Surface-Exposed Sites

Journal: PLoS ONE

doi: 10.1371/journal.pone.0031925

Stable nanoparticles are more immunogenic in animals. Balb/C mice (5 per groups) were immunized twice with a 14-day interval with 100 µg s.c. of PapMV-HA11-12, PapMV-HA11-187 or PapMV-HA11-C, respectively. The total IgG (A) or the IgG2a (B) humoral response directed to the HA11 peptide was measured by ELISA. Also, the total IgG (C) and IgG2a (D) directed to the PapMV CP was measured by ELISA. *** P
Figure Legend Snippet: Stable nanoparticles are more immunogenic in animals. Balb/C mice (5 per groups) were immunized twice with a 14-day interval with 100 µg s.c. of PapMV-HA11-12, PapMV-HA11-187 or PapMV-HA11-C, respectively. The total IgG (A) or the IgG2a (B) humoral response directed to the HA11 peptide was measured by ELISA. Also, the total IgG (C) and IgG2a (D) directed to the PapMV CP was measured by ELISA. *** P

Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay

Structural changes in PapMV CP in the different recombinant nanoparticles induced by an increase in temperature. Each of the recombinant nanoparticles (PapMV-HA11-12, PapMV-HA11-187 and PapMV-HA11-C) at a concentration of 0.1 mg/ml were heated in steps of 1°C and secondary structure changes of the protein was monitored by circular dichroism. The read-out was performed at a wave length of 208 nm. The arrows show the point of inflection for each of the nanoparticles. The black bar represents the body temperature of mice (36.9°C).
Figure Legend Snippet: Structural changes in PapMV CP in the different recombinant nanoparticles induced by an increase in temperature. Each of the recombinant nanoparticles (PapMV-HA11-12, PapMV-HA11-187 and PapMV-HA11-C) at a concentration of 0.1 mg/ml were heated in steps of 1°C and secondary structure changes of the protein was monitored by circular dichroism. The read-out was performed at a wave length of 208 nm. The arrows show the point of inflection for each of the nanoparticles. The black bar represents the body temperature of mice (36.9°C).

Techniques Used: Recombinant, Concentration Assay, Mouse Assay

PapMV-HA11 recombinant proteins. The three PapMV-HA11 fusions produced have characteristics similar to those of PapMV nanoparticles. (A) The sequence of the PapMV-CP-HA11 proteins produced. (B) Bacterial lysate of the culture before induction (first lane), after induction with IPTG (second lane), and after successful purification with nickel beads, third lane, of PapMV-CP-HA11-12 (lane 1–3), 187 (lane 4–6) and C (lane7–9). (C)Transmission electron microscope images of each HA11 fusion. (D) Size of VLPs recorded by dynamic light scattering (DLS).
Figure Legend Snippet: PapMV-HA11 recombinant proteins. The three PapMV-HA11 fusions produced have characteristics similar to those of PapMV nanoparticles. (A) The sequence of the PapMV-CP-HA11 proteins produced. (B) Bacterial lysate of the culture before induction (first lane), after induction with IPTG (second lane), and after successful purification with nickel beads, third lane, of PapMV-CP-HA11-12 (lane 1–3), 187 (lane 4–6) and C (lane7–9). (C)Transmission electron microscope images of each HA11 fusion. (D) Size of VLPs recorded by dynamic light scattering (DLS).

Techniques Used: Recombinant, Produced, Sequencing, Purification, Microscopy

Immunoprecipitation and western blot of PapMV with or without HA11 fusion. PapMV was immunoprecipitated with anti-PapMV mouse serum (lane 1) and with anti-HA11 monoclonal antibody (lane 2). PapMV-HA11-12, 187 and C are immunoprecipitated by anti-HA11 monoclonal antibody (lane 3–5) confirming that the HA11 peptide is at the surface.
Figure Legend Snippet: Immunoprecipitation and western blot of PapMV with or without HA11 fusion. PapMV was immunoprecipitated with anti-PapMV mouse serum (lane 1) and with anti-HA11 monoclonal antibody (lane 2). PapMV-HA11-12, 187 and C are immunoprecipitated by anti-HA11 monoclonal antibody (lane 3–5) confirming that the HA11 peptide is at the surface.

Techniques Used: Immunoprecipitation, Western Blot

38) Product Images from "Molecular determinants of the modulation of cyclic nucleotide-activated channels by calmodulin"

Article Title: Molecular determinants of the modulation of cyclic nucleotide-activated channels by calmodulin

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Effect of CaM on two rat OLFα/human CONEα chimeric channels. Contribution from CONEα is in white and from OLFα in black. Numbers indicate the last and first residues of the respective sequences across the junction. Dashed lines indicate approximate borders between N-terminal (N), transmembrane (TMDs), and C-terminal (C) domains. Traces indicate patch-clamp recordings from excised, inside-out membrane patches of transfected cells at low cGMP concentration. Horizontal bars indicate times of application of the respective treatments. CaM was at 250 nM; membrane potential at −60 mV. The cGMP concentrations 10 μM and 5 μM correspond to roughly the K values of the two chimeras, respectively. Another chimera similar to ChiMG4 but with the OLFα/CONEα junction closer to the end of the transmembrane domains failed to give functional channels.
Figure Legend Snippet: Effect of CaM on two rat OLFα/human CONEα chimeric channels. Contribution from CONEα is in white and from OLFα in black. Numbers indicate the last and first residues of the respective sequences across the junction. Dashed lines indicate approximate borders between N-terminal (N), transmembrane (TMDs), and C-terminal (C) domains. Traces indicate patch-clamp recordings from excised, inside-out membrane patches of transfected cells at low cGMP concentration. Horizontal bars indicate times of application of the respective treatments. CaM was at 250 nM; membrane potential at −60 mV. The cGMP concentrations 10 μM and 5 μM correspond to roughly the K values of the two chimeras, respectively. Another chimera similar to ChiMG4 but with the OLFα/CONEα junction closer to the end of the transmembrane domains failed to give functional channels.

Techniques Used: Chick Chorioallantoic Membrane Assay, Patch Clamp, Transfection, Concentration Assay, Functional Assay

Identification of a CaM-binding site on human CONEα. ( A ) Sequence of the CaM-binding site on human CONEα aligned with that on rat OLFα. The consensus motif of three aromatic/hydrophobic amino acids at positions 1, 8, and 14 is indicated. Boldface indicates identical residues between the two sequences. ( B ) Gel-overlay experiment with biotinylated CaM and GST–fusion proteins of the N and C termini of CONEα. N′, N-terminal fusion protein with the CaM-binding site deleted. As controls, the corresponding fusion proteins of OLFα were included in the experiment. After the CaM overlay, the blots were stripped and probed with an α-GST antibody, and the results indicated roughly the same amount of protein in each lane (data not shown). The calculated M r of the OLFα and CONEα N-terminal fusion proteins are 44 and 47 kDa, respectively, and 61 and 62 kDa for the C-terminal fusion proteins. The additional bands probably represent degradation products. ( C ) Gel-shift experiment with a peptide (KY17) corresponding to the CaM-binding site on CONEα (residues 65–89). The peptide KY9, corresponding to the site on OLFα (residues 62–87), was included for comparison. CaM (375 pmol) and a peptide in peptide/CaM mole ratios of 1, 2, or 10 (indicated above the lanes), plus 2 mM Ca 2+ , was resolved on a 15% nondenaturing gel and visualized with Coomassie blue staining. The leftmost lane contains CaM but no peptide. The arrowhead indicates the position of free CaM. No shifts were observed without Ca 2+ (data not shown). ( D ) Dose–response relation between activated current and cGMP concentration for wild-type CONEα expressed in HEK 293 cells in the presence (●) and absence (□) of 250 nM CaM, both with 50 μM Ca 2+ . Results from patch-clamp recordings from excised, inside-out membrane patches of the transfected cells. Membrane potential at −60 mV. Individual data points from three patches are plotted with the same symbols. Curve fits are according to the Hill equation, I / I max = C n /[C n + K 1/2 n ]. The K 1/2 values in the absence or presence of CaM were 19.1 and 18.4 μM cGMP, respectively, both with n = 2.1.
Figure Legend Snippet: Identification of a CaM-binding site on human CONEα. ( A ) Sequence of the CaM-binding site on human CONEα aligned with that on rat OLFα. The consensus motif of three aromatic/hydrophobic amino acids at positions 1, 8, and 14 is indicated. Boldface indicates identical residues between the two sequences. ( B ) Gel-overlay experiment with biotinylated CaM and GST–fusion proteins of the N and C termini of CONEα. N′, N-terminal fusion protein with the CaM-binding site deleted. As controls, the corresponding fusion proteins of OLFα were included in the experiment. After the CaM overlay, the blots were stripped and probed with an α-GST antibody, and the results indicated roughly the same amount of protein in each lane (data not shown). The calculated M r of the OLFα and CONEα N-terminal fusion proteins are 44 and 47 kDa, respectively, and 61 and 62 kDa for the C-terminal fusion proteins. The additional bands probably represent degradation products. ( C ) Gel-shift experiment with a peptide (KY17) corresponding to the CaM-binding site on CONEα (residues 65–89). The peptide KY9, corresponding to the site on OLFα (residues 62–87), was included for comparison. CaM (375 pmol) and a peptide in peptide/CaM mole ratios of 1, 2, or 10 (indicated above the lanes), plus 2 mM Ca 2+ , was resolved on a 15% nondenaturing gel and visualized with Coomassie blue staining. The leftmost lane contains CaM but no peptide. The arrowhead indicates the position of free CaM. No shifts were observed without Ca 2+ (data not shown). ( D ) Dose–response relation between activated current and cGMP concentration for wild-type CONEα expressed in HEK 293 cells in the presence (●) and absence (□) of 250 nM CaM, both with 50 μM Ca 2+ . Results from patch-clamp recordings from excised, inside-out membrane patches of the transfected cells. Membrane potential at −60 mV. Individual data points from three patches are plotted with the same symbols. Curve fits are according to the Hill equation, I / I max = C n /[C n + K 1/2 n ]. The K 1/2 values in the absence or presence of CaM were 19.1 and 18.4 μM cGMP, respectively, both with n = 2.1.

Techniques Used: Chick Chorioallantoic Membrane Assay, Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Staining, Concentration Assay, Patch Clamp, Transfection

39) Product Images from "A novel fatty acid-binding protein 5-estrogen-related receptor α signaling pathway promotes cell growth and energy metabolism in prostate cancer cells"

Article Title: A novel fatty acid-binding protein 5-estrogen-related receptor α signaling pathway promotes cell growth and energy metabolism in prostate cancer cells

Journal: Oncotarget

doi: 10.18632/oncotarget.25878

FABP5 activates ERRα target genes mediated by direct interaction with ERRα in the nucleus ( A ) Detection of ERK8 expression level in control siRNA (20 nM) or siFABP5 (20 nM) transfected PCa cells by western blot analysis. The arrow indicates ERK8 band. Results shown are representative of three independent experiments. ( B ) Western blot analysis of ERRα in nuclear and cytoplasmic fractions from control siRNA (20 nM) or siFABP5 (20 nM) transfected PC-3 cells. TBP served as a nuclear marker and tubulin served as cytoplasmic marker. ( C , D ) GST pull-down assays. ERRα contains an activation function 1 (AF-1, 1~75aa), a central zinc finger DNA binding domain (DBD, 75~151aa), a hinge region (151~225aa), a ligand-binding domain (LBD, 225~423aa), and an activation function 2 domain (AF-2, 398~423aa). We prepared two deletion mutants of ERRα (Δ300aa and Δ398aa). GST, GST-ERRα, GST-ERRα Δ300aa or GST-ERRα Δ398aa was incubated with PC-3 whole cell lysates and glutathione sepharose overnight at 4°C. GST, FABP5 and PGC-1β levels were detected by western blot analysis. Results shown are representative of three independent experiments. ( E ) Immunoprecipitation was performed with FLAG antibody (MBL) on lysates from pCI-neo (e.v.) or pCI-neo/3×FLAG-FABP5-transfected 293T cells. Input (10%) and IP samples were analyzed by western blot analysis. Results shown are representative of three independent experiments. ( F ) ChIP–qPCR analysis to evaluate binding of the FABP5-ERRα complex to the ATP5B promoter. 293T cells were transfected with pCI-neo (e.v.), FLAG-FABP5, ERRα and pGC-1β as indicated. ChIP was performed using anti-DDDDK-tag antibody, and the ERRα-binding site in ATP5B (−300 to −213) promoter region was amplified using ChIP-qPCR primers to calculate % input. Primer sequences are described in the SI Materials and Methods. Results are mean ± S.D. for three independent experiments. ** P
Figure Legend Snippet: FABP5 activates ERRα target genes mediated by direct interaction with ERRα in the nucleus ( A ) Detection of ERK8 expression level in control siRNA (20 nM) or siFABP5 (20 nM) transfected PCa cells by western blot analysis. The arrow indicates ERK8 band. Results shown are representative of three independent experiments. ( B ) Western blot analysis of ERRα in nuclear and cytoplasmic fractions from control siRNA (20 nM) or siFABP5 (20 nM) transfected PC-3 cells. TBP served as a nuclear marker and tubulin served as cytoplasmic marker. ( C , D ) GST pull-down assays. ERRα contains an activation function 1 (AF-1, 1~75aa), a central zinc finger DNA binding domain (DBD, 75~151aa), a hinge region (151~225aa), a ligand-binding domain (LBD, 225~423aa), and an activation function 2 domain (AF-2, 398~423aa). We prepared two deletion mutants of ERRα (Δ300aa and Δ398aa). GST, GST-ERRα, GST-ERRα Δ300aa or GST-ERRα Δ398aa was incubated with PC-3 whole cell lysates and glutathione sepharose overnight at 4°C. GST, FABP5 and PGC-1β levels were detected by western blot analysis. Results shown are representative of three independent experiments. ( E ) Immunoprecipitation was performed with FLAG antibody (MBL) on lysates from pCI-neo (e.v.) or pCI-neo/3×FLAG-FABP5-transfected 293T cells. Input (10%) and IP samples were analyzed by western blot analysis. Results shown are representative of three independent experiments. ( F ) ChIP–qPCR analysis to evaluate binding of the FABP5-ERRα complex to the ATP5B promoter. 293T cells were transfected with pCI-neo (e.v.), FLAG-FABP5, ERRα and pGC-1β as indicated. ChIP was performed using anti-DDDDK-tag antibody, and the ERRα-binding site in ATP5B (−300 to −213) promoter region was amplified using ChIP-qPCR primers to calculate % input. Primer sequences are described in the SI Materials and Methods. Results are mean ± S.D. for three independent experiments. ** P

Techniques Used: Expressing, Transfection, Western Blot, Marker, Activation Assay, Binding Assay, Ligand Binding Assay, Incubation, Pyrolysis Gas Chromatography, Immunoprecipitation, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Amplification

40) Product Images from "A Rab8-specific GDP/GTP Exchange Factor Is Involved in Actin Remodeling and Polarized Membrane Transport"

Article Title: A Rab8-specific GDP/GTP Exchange Factor Is Involved in Actin Remodeling and Polarized Membrane Transport

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E02-03-0143

Characterization of Rab8 binding to Rabin8. (A) Table showing interactions of Rabin8 in the two-hybrid system. The interactions were assayed by X-gal overlay and by the ability of the yeast to grow in the absence of leucine; −, no interaction; +, weak interaction; +++, strong interaction. (B) Schematic representation of Rabin8 deletions interacting with Rab8-T22N in yeast two-hybrid analysis. The black box indicates the coiled-coli region of Rabin8, and the numbers behind the bars indicate the amino acids encompassing the Rabin8 deletions. Positive interaction, +; negative interaction, −. (C) In vitro binding of Rab8 mutants to recombinant GST-Rabin8. Lanes beneath in vitro indicate input of translated Rab8-T22N and Rab8-Q67L, whereas lanes in the GST-Rabin8 column indicate in vitro bound Rab8-T22N and Rab8-Q67L to GST-Rabin8. The GST column shows the result obtained by GST alone. Molecular weight markers are indicated on left. (D) In vitro association of Rabin8 to GST-Rabin8. In vitro translated full-length (FL) Rabin8 or the Rabin8 1–316 deletion mutant (DM) seen as in put material in the in vitro column. The lanes beneath the GST-Rabin8 column indicate bound material of full-length (FL) and deleted Rabin8 (DM) to GST-Rabin. The column on right shows corresponding binding to the GST control beads. Positions of protein standards are given at the left of the gel.
Figure Legend Snippet: Characterization of Rab8 binding to Rabin8. (A) Table showing interactions of Rabin8 in the two-hybrid system. The interactions were assayed by X-gal overlay and by the ability of the yeast to grow in the absence of leucine; −, no interaction; +, weak interaction; +++, strong interaction. (B) Schematic representation of Rabin8 deletions interacting with Rab8-T22N in yeast two-hybrid analysis. The black box indicates the coiled-coli region of Rabin8, and the numbers behind the bars indicate the amino acids encompassing the Rabin8 deletions. Positive interaction, +; negative interaction, −. (C) In vitro binding of Rab8 mutants to recombinant GST-Rabin8. Lanes beneath in vitro indicate input of translated Rab8-T22N and Rab8-Q67L, whereas lanes in the GST-Rabin8 column indicate in vitro bound Rab8-T22N and Rab8-Q67L to GST-Rabin8. The GST column shows the result obtained by GST alone. Molecular weight markers are indicated on left. (D) In vitro association of Rabin8 to GST-Rabin8. In vitro translated full-length (FL) Rabin8 or the Rabin8 1–316 deletion mutant (DM) seen as in put material in the in vitro column. The lanes beneath the GST-Rabin8 column indicate bound material of full-length (FL) and deleted Rabin8 (DM) to GST-Rabin. The column on right shows corresponding binding to the GST control beads. Positions of protein standards are given at the left of the gel.

Techniques Used: Binding Assay, In Vitro, Recombinant, Molecular Weight, Mutagenesis

41) Product Images from "Nuclear transport adapts to varying heat stress in a multistep mechanism"

Article Title: Nuclear transport adapts to varying heat stress in a multistep mechanism

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201712042

Thermosensitivity of Imp α1. (a and b) Using Imp α1, Imp β, and RanGDP preincubated at indicated temperatures, in vitro transport assays of GST-SV NLS–GFP were performed. After the reactions, the cells were fixed and stained with DAPI (a). Then, nuclear intensities of GST-SV NLS–GFP were plotted (b). Bars, 20 µm. (c–e) Imp α1 (c), Imp β (d), or RanGDP (e) was preincubated for 60 min at indicated temperatures, and the remaining two transport factors were preincubated at 37.3°C. Then, the import assays of GST-SV NLS–GFP were performed. The nuclear intensities were plotted (see also Fig. S3, a–c). Black bars show the median of > 100 cells at eight temperature conditions (total n = 1,521 [b], 1,255 [c], 1,598 [d], and 1,494 [e]). All plots in each graph were calculated from one simultaneous experiment. (f) Imp α1 and Imp β were independently preincubated at either 37.3 or 43.3°C for 60 min. Then, these proteins and either MBPx2 or MBPx2-SV NLS were incubated with amylose beads. (g) GST, GST–Imp β, and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST–Imp β was incubated with Imp α1, MBPx2-SV NLS, and glutathione beads. (h) GST, GST-CAS, Flag-RanGTP (Q69L), and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST-CAS was incubated with Imp α1, Flag-RanGTP (Q69L), and glutathione beads. Proteins bound to beads were analyzed by Coomassie brilliant blue staining. (i) Model for the inhibition of Imp α/β–dependent import and the nuclear translocation of Imp α. (j) Model for temperature-dependent transport modulations. cNLS indicates classical NLS, which is recognized by Imp α1.
Figure Legend Snippet: Thermosensitivity of Imp α1. (a and b) Using Imp α1, Imp β, and RanGDP preincubated at indicated temperatures, in vitro transport assays of GST-SV NLS–GFP were performed. After the reactions, the cells were fixed and stained with DAPI (a). Then, nuclear intensities of GST-SV NLS–GFP were plotted (b). Bars, 20 µm. (c–e) Imp α1 (c), Imp β (d), or RanGDP (e) was preincubated for 60 min at indicated temperatures, and the remaining two transport factors were preincubated at 37.3°C. Then, the import assays of GST-SV NLS–GFP were performed. The nuclear intensities were plotted (see also Fig. S3, a–c). Black bars show the median of > 100 cells at eight temperature conditions (total n = 1,521 [b], 1,255 [c], 1,598 [d], and 1,494 [e]). All plots in each graph were calculated from one simultaneous experiment. (f) Imp α1 and Imp β were independently preincubated at either 37.3 or 43.3°C for 60 min. Then, these proteins and either MBPx2 or MBPx2-SV NLS were incubated with amylose beads. (g) GST, GST–Imp β, and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST–Imp β was incubated with Imp α1, MBPx2-SV NLS, and glutathione beads. (h) GST, GST-CAS, Flag-RanGTP (Q69L), and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST-CAS was incubated with Imp α1, Flag-RanGTP (Q69L), and glutathione beads. Proteins bound to beads were analyzed by Coomassie brilliant blue staining. (i) Model for the inhibition of Imp α/β–dependent import and the nuclear translocation of Imp α. (j) Model for temperature-dependent transport modulations. cNLS indicates classical NLS, which is recognized by Imp α1.

Techniques Used: In Vitro, Staining, Incubation, Inhibition, Translocation Assay

42) Product Images from "The Permissive Cue Laminin Is Essential for Growth Cone TurningIn Vivo"

Article Title: The Permissive Cue Laminin Is Essential for Growth Cone TurningIn Vivo

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.21-24-09782.2001

Laminin is expressed by hemocytes at 30 and 35% of embryonic development in the grasshopper limb bud. A, B , Immunofluorescent images of grasshopper limb buds at 30% ( A ) and 35% ( B ) of development that are double-labeled with laminin γ antisera ( green ) and HRP ( red ). A , Ti1 neurons emerge from the surrounding epithelium at 30% of development ( arrow ) in a basal lamina ( BL ) that is rich in laminin. Laminin-expressing hemocytes are visible in the limb ( arrowheads ). B , Confocal image of a limb bud at 35% of embryonic development. The Ti1 pathway ( red ) has been established, and arrows point to the Ti1 cell bodies, which have separated slightly in this limb. Laminin immunoreactivity in the basal lamina is even, and laminin-expressing hemocytes ( arrowheads ) are abundant. C , Western blot analysis of laminin β and γ glutathione S -transferase fusion proteins with β and γ antibodies. Laminin γ antiserum is specific for the γ fusion protein but does not recognize the β-chain fusion protein, whereas β-chain antibodies cross-react with γ-chain fusion protein ( asterisk ). D , Western blot analysis of lysate from embryos at 40% of development with β and γ antibodies and preimmune sera ( PI ). Both β and γ antisera recognize a high molecular weight complex (polymerized laminin) in the stacking gel. The β and γ antibodies recognize a similarly sized band. Preimmune serum reacts with no bands. Scale bar, 10 μm.
Figure Legend Snippet: Laminin is expressed by hemocytes at 30 and 35% of embryonic development in the grasshopper limb bud. A, B , Immunofluorescent images of grasshopper limb buds at 30% ( A ) and 35% ( B ) of development that are double-labeled with laminin γ antisera ( green ) and HRP ( red ). A , Ti1 neurons emerge from the surrounding epithelium at 30% of development ( arrow ) in a basal lamina ( BL ) that is rich in laminin. Laminin-expressing hemocytes are visible in the limb ( arrowheads ). B , Confocal image of a limb bud at 35% of embryonic development. The Ti1 pathway ( red ) has been established, and arrows point to the Ti1 cell bodies, which have separated slightly in this limb. Laminin immunoreactivity in the basal lamina is even, and laminin-expressing hemocytes ( arrowheads ) are abundant. C , Western blot analysis of laminin β and γ glutathione S -transferase fusion proteins with β and γ antibodies. Laminin γ antiserum is specific for the γ fusion protein but does not recognize the β-chain fusion protein, whereas β-chain antibodies cross-react with γ-chain fusion protein ( asterisk ). D , Western blot analysis of lysate from embryos at 40% of development with β and γ antibodies and preimmune sera ( PI ). Both β and γ antisera recognize a high molecular weight complex (polymerized laminin) in the stacking gel. The β and γ antibodies recognize a similarly sized band. Preimmune serum reacts with no bands. Scale bar, 10 μm.

Techniques Used: Labeling, Expressing, Western Blot, Molecular Weight

43) Product Images from "Heterodimeric Interactions between Chicken Ovalbumin Upstream Promoter-Transcription Factor Family Members ARP1 and Ear2"

Article Title: Heterodimeric Interactions between Chicken Ovalbumin Upstream Promoter-Transcription Factor Family Members ARP1 and Ear2

Journal: The Journal of biological chemistry

doi:

In vitro interaction between ARP1 and Ear2 GST/ARP1 DE and GST/EAR2 DE were bound to glutathione-Sepharose and used as affinity matrices to examine the interaction with the in vitro translated [ 35 S]methionine-labeled Ear2 ( A ) and ARP1 ΔAB ( B ). Approximately 10% of input [ 35 S]methionine-labeled protein was retained on GST fusion proteins in all cases. Shown are representative experiments that were replicated 4–6 times.
Figure Legend Snippet: In vitro interaction between ARP1 and Ear2 GST/ARP1 DE and GST/EAR2 DE were bound to glutathione-Sepharose and used as affinity matrices to examine the interaction with the in vitro translated [ 35 S]methionine-labeled Ear2 ( A ) and ARP1 ΔAB ( B ). Approximately 10% of input [ 35 S]methionine-labeled protein was retained on GST fusion proteins in all cases. Shown are representative experiments that were replicated 4–6 times.

Techniques Used: In Vitro, Labeling

44) Product Images from "Heterodimeric Interactions between Chicken Ovalbumin Upstream Promoter-Transcription Factor Family Members ARP1 and Ear2"

Article Title: Heterodimeric Interactions between Chicken Ovalbumin Upstream Promoter-Transcription Factor Family Members ARP1 and Ear2

Journal: The Journal of biological chemistry

doi:

ARP1 and Ear2 interact in HEK 293 cells Cells were cotransfected with the indicated mammalian expression vectors and the 17-mer-ERE-globin-CAT reporter. Cells were harvested 24 h after transfection, and extracts were prepared using standard techniques. Transfection efficiency was normalized across treatments using a cotransfected β-galactosidase expression vector, and CAT activity was determined using [ 14 C]chloramphenicol and acetyl-CoA. Acetylated and unacetylated [ 14 C]chloramphenicol were separated by thin layer chromatography and visualized by autoradiography. A representative experiment is shown that was replicated three times.
Figure Legend Snippet: ARP1 and Ear2 interact in HEK 293 cells Cells were cotransfected with the indicated mammalian expression vectors and the 17-mer-ERE-globin-CAT reporter. Cells were harvested 24 h after transfection, and extracts were prepared using standard techniques. Transfection efficiency was normalized across treatments using a cotransfected β-galactosidase expression vector, and CAT activity was determined using [ 14 C]chloramphenicol and acetyl-CoA. Acetylated and unacetylated [ 14 C]chloramphenicol were separated by thin layer chromatography and visualized by autoradiography. A representative experiment is shown that was replicated three times.

Techniques Used: Expressing, Transfection, Plasmid Preparation, Activity Assay, Thin Layer Chromatography, Autoradiography

Relationship between COUP-TF family members The amino acid identities between domains of COUP-TFI and both ARP1 and Ear2 are indicated as percentages within each schematic domain. The corresponding identities between ARP1 and Ear2 are indicated within double-headed arrows . Alignments were carried out using Clustal X (version 1.63b) and the following GenBank™ accession numbers: COUP-TFI, gi466468; ARP1, gi482927; Ear2, gi482930.
Figure Legend Snippet: Relationship between COUP-TF family members The amino acid identities between domains of COUP-TFI and both ARP1 and Ear2 are indicated as percentages within each schematic domain. The corresponding identities between ARP1 and Ear2 are indicated within double-headed arrows . Alignments were carried out using Clustal X (version 1.63b) and the following GenBank™ accession numbers: COUP-TFI, gi466468; ARP1, gi482927; Ear2, gi482930.

Techniques Used:

In vitro interaction between ARP1 and Ear2 GST/ARP1 DE and GST/EAR2 DE were bound to glutathione-Sepharose and used as affinity matrices to examine the interaction with the in vitro translated [ 35 S]methionine-labeled Ear2 ( A ) and ARP1 ΔAB ( B ). Approximately 10% of input [ 35 S]methionine-labeled protein was retained on GST fusion proteins in all cases. Shown are representative experiments that were replicated 4–6 times.
Figure Legend Snippet: In vitro interaction between ARP1 and Ear2 GST/ARP1 DE and GST/EAR2 DE were bound to glutathione-Sepharose and used as affinity matrices to examine the interaction with the in vitro translated [ 35 S]methionine-labeled Ear2 ( A ) and ARP1 ΔAB ( B ). Approximately 10% of input [ 35 S]methionine-labeled protein was retained on GST fusion proteins in all cases. Shown are representative experiments that were replicated 4–6 times.

Techniques Used: In Vitro, Labeling

Formation of ARP1 and Ear2 homodimers and heterodimers on the DR1(G) probe Lanes 1 – 3 and 4 – 6 contain increasing amounts of mycARP1ΔAB and HA-Ear2 as indicated. Lanes 7 – 9 represent titration of a fixed amount of mycARP1ΔAB with increasing amounts of HA-Ear2, and lanes 10 – 12 correspond to the converse titration. The position of homodimeric HA-Ear2 ( C1 and C2 ) and mycARP1ΔAB ( C5 ) complexes as well as heterodimeric mycARP1ΔAB·HA-Ear2 complexes ( C3 and C4 ) are indicated to the right of this EMSA gel. Electrophoresis was carried out for about 1 h after the free probe ran out of the gel to maximize resolution of the multiple complexes. A representative experiment is shown which was replicated five times. Note that the amount of reticulocyte lysate in each lane was held constant by addition of unprogrammed lysate.
Figure Legend Snippet: Formation of ARP1 and Ear2 homodimers and heterodimers on the DR1(G) probe Lanes 1 – 3 and 4 – 6 contain increasing amounts of mycARP1ΔAB and HA-Ear2 as indicated. Lanes 7 – 9 represent titration of a fixed amount of mycARP1ΔAB with increasing amounts of HA-Ear2, and lanes 10 – 12 correspond to the converse titration. The position of homodimeric HA-Ear2 ( C1 and C2 ) and mycARP1ΔAB ( C5 ) complexes as well as heterodimeric mycARP1ΔAB·HA-Ear2 complexes ( C3 and C4 ) are indicated to the right of this EMSA gel. Electrophoresis was carried out for about 1 h after the free probe ran out of the gel to maximize resolution of the multiple complexes. A representative experiment is shown which was replicated five times. Note that the amount of reticulocyte lysate in each lane was held constant by addition of unprogrammed lysate.

Techniques Used: Titration, Nucleic Acid Electrophoresis

45) Product Images from "Functions of LIM proteins in cell polarity and chemotactic motility"

Article Title: Functions of LIM proteins in cell polarity and chemotactic motility

Journal: The EMBO Journal

doi: 10.1093/emboj/cdf550

Fig. 8. Binding of LimC and LimD to F-actin. Co-sedimentation of ( A ) GST–LimC, GST–LimD and ( B ) GST–LimC deletion constructs GST–CLIM and GST–NLIM-P with F-actin. G-actin (5 µM) from D.discoideum was incubated with the GST fusion proteins in polymerization buffer containing 2 mM MgCl 2 , 100 mM KCl and 1 mM EGTA. Pellets (P) and supernatants (S) were separated by high-speed centrifugation, and the proteins in these fractions were analyzed by SDS–PAGE (12% acrylamide) and staining with Coomassie Blue. Controls for the fusion proteins alone were performed without the addition of G-actin in the reaction mixture. The presence (+) or absence (–) of G-actin in the reaction mixture is indicated on the top of the lanes. Arrows marked with C and D indicate GST–LimC and GST–LimD, respectively. Varying amounts of polymerized (P) and unpolymerized actin (S) in GST–LimC and GST–LimD panels might be due to different actin preparations.
Figure Legend Snippet: Fig. 8. Binding of LimC and LimD to F-actin. Co-sedimentation of ( A ) GST–LimC, GST–LimD and ( B ) GST–LimC deletion constructs GST–CLIM and GST–NLIM-P with F-actin. G-actin (5 µM) from D.discoideum was incubated with the GST fusion proteins in polymerization buffer containing 2 mM MgCl 2 , 100 mM KCl and 1 mM EGTA. Pellets (P) and supernatants (S) were separated by high-speed centrifugation, and the proteins in these fractions were analyzed by SDS–PAGE (12% acrylamide) and staining with Coomassie Blue. Controls for the fusion proteins alone were performed without the addition of G-actin in the reaction mixture. The presence (+) or absence (–) of G-actin in the reaction mixture is indicated on the top of the lanes. Arrows marked with C and D indicate GST–LimC and GST–LimD, respectively. Varying amounts of polymerized (P) and unpolymerized actin (S) in GST–LimC and GST–LimD panels might be due to different actin preparations.

Techniques Used: Binding Assay, Sedimentation, Construct, Incubation, Centrifugation, SDS Page, Staining

46) Product Images from "Mammalian and Drosophila cells adhere to the laminin ?4 LG4 domain through syndecans, but not glypicans"

Article Title: Mammalian and Drosophila cells adhere to the laminin ?4 LG4 domain through syndecans, but not glypicans

Journal: Biochemical Journal

doi: 10.1042/BJ20040558

Adhesion of HUVECs to GST–LG4 mutants
Figure Legend Snippet: Adhesion of HUVECs to GST–LG4 mutants

Techniques Used:

Glypican-1 is dispensable for adhesion of HT1080 cells and HUVECs to laminin α4 LG4
Figure Legend Snippet: Glypican-1 is dispensable for adhesion of HT1080 cells and HUVECs to laminin α4 LG4

Techniques Used:

GST–LG4 pull-down of syndecan-4
Figure Legend Snippet: GST–LG4 pull-down of syndecan-4

Techniques Used:

The LG4 domain is a second cell-binding site within the laminin α4 G domain
Figure Legend Snippet: The LG4 domain is a second cell-binding site within the laminin α4 G domain

Techniques Used: Binding Assay

Inhibition of cell adhesion to GST–LG4 by heparin, heparan sulphate and heparitinase I
Figure Legend Snippet: Inhibition of cell adhesion to GST–LG4 by heparin, heparan sulphate and heparitinase I

Techniques Used: Inhibition

Adhesion of Drosophila Kc167 cells and knockdown variants to GST–LG4
Figure Legend Snippet: Adhesion of Drosophila Kc167 cells and knockdown variants to GST–LG4

Techniques Used:

47) Product Images from "Lipid binding promotes the open conformation and tumor-suppressive activity of neurofibromin 2"

Article Title: Lipid binding promotes the open conformation and tumor-suppressive activity of neurofibromin 2

Journal: Nature Communications

doi: 10.1038/s41467-018-03648-4

The lipid binding deficient mutant of neurofibromin 2 displays impaired inhibition of Rac1 activation and YAP activity. a 293 T or b SC4 cells were transfected with expression vectors for wild type or lipid binding deficient neurofibromin 2 or empty vector control (pCDNA) and levels of active Rac1 (Rac1-GTP) were assessed after 48 h. Levels of total Rac1, neurofibromin 2, and tubulin were assessed as controls. The blots shown are representative of three biological replicates. c HEK293T cells were transfected with expression vectors for wild type or lipid binding deficient neurofibromin 2 or empty vector control (pCDNA) along with YAP-driven luciferase and Renilla luciferase reporters. Activity of the luciferase reporter was assessed 24 h post transfection. Means of each data point were calculated from three independent biological replicates conducted in triplicate. Error bars represent ± S.D
Figure Legend Snippet: The lipid binding deficient mutant of neurofibromin 2 displays impaired inhibition of Rac1 activation and YAP activity. a 293 T or b SC4 cells were transfected with expression vectors for wild type or lipid binding deficient neurofibromin 2 or empty vector control (pCDNA) and levels of active Rac1 (Rac1-GTP) were assessed after 48 h. Levels of total Rac1, neurofibromin 2, and tubulin were assessed as controls. The blots shown are representative of three biological replicates. c HEK293T cells were transfected with expression vectors for wild type or lipid binding deficient neurofibromin 2 or empty vector control (pCDNA) along with YAP-driven luciferase and Renilla luciferase reporters. Activity of the luciferase reporter was assessed 24 h post transfection. Means of each data point were calculated from three independent biological replicates conducted in triplicate. Error bars represent ± S.D

Techniques Used: Binding Assay, Mutagenesis, Inhibition, Activation Assay, Activity Assay, Transfection, Expressing, Plasmid Preparation, Luciferase

Activation of the neurofibromin 2 tumor-suppressive function. In its inactive state, neurofibromin 2 is in a closed conformation through interactions of the FERM domain (teal; F1, residues 18–98; F2, residues 111–213; F3, residues 220–312) and the tail domain (pale orange). The α-helix C -terminal of F3 (residues 315–339; white) does not interact with the tail domain. PIP 2 ) is shown below the schematic on the bottom left and our PIP 2 -bound structure on the bottom right
Figure Legend Snippet: Activation of the neurofibromin 2 tumor-suppressive function. In its inactive state, neurofibromin 2 is in a closed conformation through interactions of the FERM domain (teal; F1, residues 18–98; F2, residues 111–213; F3, residues 220–312) and the tail domain (pale orange). The α-helix C -terminal of F3 (residues 315–339; white) does not interact with the tail domain. PIP 2 ) is shown below the schematic on the bottom left and our PIP 2 -bound structure on the bottom right

Techniques Used: Activation Assay

Lipid binding to neurofibromin 2 causes major conformational changes. a Schematic depiction of the domain organization of full-length neurofibromin 2. The F1, F2, and F3 FERM subdomains and the C -terminal domain (CTD) are indicated that are connected by the central α-helical domain. b The 2.61 Å PIP 2 -bound neurofibromin 2 structure. The F1 subdomain (residues 18–98) is shown in light orange, F2 (residues 111–213) in green, and F3 (residues 221–312) in blue. The α-helix from the central helical domain, αH, is shown in gray (residues 315–339). The cartoon illustrates binding of PIP 2 to full-length neurofibromin 2 with its head–tail interaction severed. c Close-up view of the PIP 2 binding site. The carbon atoms of PIP 2 are shown in gray, of the neurofibromin 2 F1 subdomain in orange, and F3 in blue. Hydrogen bonds are indicated and key binding residues are labeled. d ) in the same orientation as our lipid-bound structure shown in panel b . The electrostatic interaction between E317 OE2 and R57 NH2 is indicated (and the distance is 2.9 Å) that is severed in our lipid-bound structure shown in b . The cartoon highlights the distinct conformation of α-helix αH from the central domain
Figure Legend Snippet: Lipid binding to neurofibromin 2 causes major conformational changes. a Schematic depiction of the domain organization of full-length neurofibromin 2. The F1, F2, and F3 FERM subdomains and the C -terminal domain (CTD) are indicated that are connected by the central α-helical domain. b The 2.61 Å PIP 2 -bound neurofibromin 2 structure. The F1 subdomain (residues 18–98) is shown in light orange, F2 (residues 111–213) in green, and F3 (residues 221–312) in blue. The α-helix from the central helical domain, αH, is shown in gray (residues 315–339). The cartoon illustrates binding of PIP 2 to full-length neurofibromin 2 with its head–tail interaction severed. c Close-up view of the PIP 2 binding site. The carbon atoms of PIP 2 are shown in gray, of the neurofibromin 2 F1 subdomain in orange, and F3 in blue. Hydrogen bonds are indicated and key binding residues are labeled. d ) in the same orientation as our lipid-bound structure shown in panel b . The electrostatic interaction between E317 OE2 and R57 NH2 is indicated (and the distance is 2.9 Å) that is severed in our lipid-bound structure shown in b . The cartoon highlights the distinct conformation of α-helix αH from the central domain

Techniques Used: Binding Assay, Labeling

Lipid binding deficient mutants of neurofibromin 2 display impaired inhibition of cell proliferation. a SC4, b HEK293T, or c hSCλ-shNF2 cells were transfected with expression vectors for wild type and lipid binding deficient neurofibromin 2 or empty vector control (pCDNA). Total cell numbers were counted over 72 h. Means of each data point were calculated from three independent biological replicates conducted in triplicate. Error bars represent ± S.D. Immunoblot analysis was used to verify similar expression levels of the indicated neurofibromin 2 alleles. Tubulin was used as a control. The blots shown are representative of three biological replicates. For SC4 cells: difference between pCDNA and lipid binding deficient neurofibromin 2,
Figure Legend Snippet: Lipid binding deficient mutants of neurofibromin 2 display impaired inhibition of cell proliferation. a SC4, b HEK293T, or c hSCλ-shNF2 cells were transfected with expression vectors for wild type and lipid binding deficient neurofibromin 2 or empty vector control (pCDNA). Total cell numbers were counted over 72 h. Means of each data point were calculated from three independent biological replicates conducted in triplicate. Error bars represent ± S.D. Immunoblot analysis was used to verify similar expression levels of the indicated neurofibromin 2 alleles. Tubulin was used as a control. The blots shown are representative of three biological replicates. For SC4 cells: difference between pCDNA and lipid binding deficient neurofibromin 2,

Techniques Used: Binding Assay, Inhibition, Transfection, Expressing, Plasmid Preparation

The conformation of neurofibromin 2 dictates its binding. a Lipid co-sedimentation analysis of the PIP 2 binding to wild type and our lipid binding deficient mutant neurofibromin 2. wild-type neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 and pellets in the presence of PIP 2 . Mutant (T59V, W60E, R309Q, R310Q) neurofibromin 2 (residues 1–339) remains soluble in the absence and presence of PIP 2 . S supernatant, P pellet, WT wild type, LBD lipid binding deficient. b Lipid co-sedimentation analysis of the PIP 2 binding to wild-type and disease-derived mutant neurofibromin 2. Wild-type neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 and pellets in the presence of PIP 2 . Mutant (W60C) neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 , while a small fraction pellets in the presence of PIP 2 . S supernatant, P pellet, WT wild type. Microscale thermophoresis (MST) measurements show the binding of PIP 2 to c wild-type full-length neurofibromin 2 ( K d = 8.02 ± 0.91 μM) or to d our lipid binding deficient (LBD) mutant (T59V, W60E, R309Q, R310Q; K d = 859.23 ± 184.65 μM). MST measurements show binding of LATS1 (residues 69–100) to e wild type ( K d = 39.31 ± 4.25 μM), f the neurofibromin/PIP 2 complex ( K d = 3.77 ± 0.72 μM), or g to our LBD neurofibromin 2 mutant ( K d = 175.54 ± 34.49 μM). No binding was observed for the artificially closed A585W-R588K (AR) mutants to h PIP 2 , or i LATS1. Error bars represent ±S.D., n = 3 (three independent measurements with the same laser power)
Figure Legend Snippet: The conformation of neurofibromin 2 dictates its binding. a Lipid co-sedimentation analysis of the PIP 2 binding to wild type and our lipid binding deficient mutant neurofibromin 2. wild-type neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 and pellets in the presence of PIP 2 . Mutant (T59V, W60E, R309Q, R310Q) neurofibromin 2 (residues 1–339) remains soluble in the absence and presence of PIP 2 . S supernatant, P pellet, WT wild type, LBD lipid binding deficient. b Lipid co-sedimentation analysis of the PIP 2 binding to wild-type and disease-derived mutant neurofibromin 2. Wild-type neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 and pellets in the presence of PIP 2 . Mutant (W60C) neurofibromin 2 (residues 1–339) is soluble in the absence of PIP 2 , while a small fraction pellets in the presence of PIP 2 . S supernatant, P pellet, WT wild type. Microscale thermophoresis (MST) measurements show the binding of PIP 2 to c wild-type full-length neurofibromin 2 ( K d = 8.02 ± 0.91 μM) or to d our lipid binding deficient (LBD) mutant (T59V, W60E, R309Q, R310Q; K d = 859.23 ± 184.65 μM). MST measurements show binding of LATS1 (residues 69–100) to e wild type ( K d = 39.31 ± 4.25 μM), f the neurofibromin/PIP 2 complex ( K d = 3.77 ± 0.72 μM), or g to our LBD neurofibromin 2 mutant ( K d = 175.54 ± 34.49 μM). No binding was observed for the artificially closed A585W-R588K (AR) mutants to h PIP 2 , or i LATS1. Error bars represent ±S.D., n = 3 (three independent measurements with the same laser power)

Techniques Used: Binding Assay, Sedimentation, Mutagenesis, Derivative Assay, Microscale Thermophoresis

48) Product Images from "AtSPX1 affects the AtPHR1–DNA-binding equilibrium by binding monomeric AtPHR1 in solution"

Article Title: AtSPX1 affects the AtPHR1–DNA-binding equilibrium by binding monomeric AtPHR1 in solution

Journal: Biochemical Journal

doi: 10.1042/BCJ20170522

GST–AtSPX1 cannot disrupt preformed MBP–AtdPHR1–P1BS complexes in the presence of up to 5 mM Pi or 100 µM InsP6.
Figure Legend Snippet: GST–AtSPX1 cannot disrupt preformed MBP–AtdPHR1–P1BS complexes in the presence of up to 5 mM Pi or 100 µM InsP6.

Techniques Used:

Model of how AtSPX1 might regulate PSI gene expression by influencing the AtPHR1–DNA-binding equilibrium.
Figure Legend Snippet: Model of how AtSPX1 might regulate PSI gene expression by influencing the AtPHR1–DNA-binding equilibrium.

Techniques Used: Expressing, Binding Assay

GST–AtSPX1 can prevent free MBP–AtdPHR1 from binding to P1BS motifs in the presence of either 5 mM Pi or 500 µM InsP6.
Figure Legend Snippet: GST–AtSPX1 can prevent free MBP–AtdPHR1 from binding to P1BS motifs in the presence of either 5 mM Pi or 500 µM InsP6.

Techniques Used: Binding Assay

49) Product Images from "The movement protein NSm of tomato spotted wilt tospovirus (TSWV): RNA binding, interaction with the TSWV N protein, and identification of interacting plant proteins"

Article Title: The movement protein NSm of tomato spotted wilt tospovirus (TSWV): RNA binding, interaction with the TSWV N protein, and identification of interacting plant proteins

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Protein interactions of NtDnaJ_M541 in the yeast two-hybrid system. Yeast cells transformed with bait and prey vectors were plated on selective medium lacking leucine, tryptophan, and histidine and supplemented with 5 mM 3-aminotriazole. Empty vector constructs and a combination of SNF1/SNF4 were used as negative and positive controls, respectively ( A ). Aliquots containing 10 7 cells of the respective colonies were spotted on a filter and tested for β-galactosidase activity ( B ). Combinations of transformed plasmid: 1, pBD-NSm/pAD-NtDnaJ_M541; 2, pAS2/pAD-NtDnaJ_M541; 3, pBD-SNF1/pAD-NtDnaJ_M541; 4, pBD-SNF1/pAD-SNF4; 5, pAS2/pACT2.
Figure Legend Snippet: Protein interactions of NtDnaJ_M541 in the yeast two-hybrid system. Yeast cells transformed with bait and prey vectors were plated on selective medium lacking leucine, tryptophan, and histidine and supplemented with 5 mM 3-aminotriazole. Empty vector constructs and a combination of SNF1/SNF4 were used as negative and positive controls, respectively ( A ). Aliquots containing 10 7 cells of the respective colonies were spotted on a filter and tested for β-galactosidase activity ( B ). Combinations of transformed plasmid: 1, pBD-NSm/pAD-NtDnaJ_M541; 2, pAS2/pAD-NtDnaJ_M541; 3, pBD-SNF1/pAD-NtDnaJ_M541; 4, pBD-SNF1/pAD-SNF4; 5, pAS2/pACT2.

Techniques Used: Transformation Assay, Plasmid Preparation, Construct, Activity Assay

50) Product Images from "Multiple Histone Methyl-Lysine Readers Ensure Robust Development and Germline Immortality in Caenorhabditis elegans"

Article Title: Multiple Histone Methyl-Lysine Readers Ensure Robust Development and Germline Immortality in Caenorhabditis elegans

Journal: Genetics

doi: 10.1534/genetics.118.301518

Distinct expression patterns of C. elegans chromo-domain proteins CEC-1 and CEC-6. (A) Relative expression levels of CEC-1 and CEC-6 across developmental stages. The 3xHA (hemagglutinin) epitope was inserted in-frame at the endogenous locus using clustered regularly interspaced short palindromic repeats/Cas9 genome editing (see also Figure S3C). L1–L4, larval stages 1–4. (B) Localization of CEC-1 and CEC-6 by anti-HA tag immunofluorescence in embryos and L1 animals. The arrowheads [(B), lower right] indicate the primordial germ cells (see also Figure S3D). (C) Broad nuclear expression of CEC-1 in the adult head. (D) Schematic of an isolated germline arm indicating three regions depicted in (E). The distal germline is a syncytium, with germ cells surrounding a central canal. d, distal; p, proximal; and s, spermatheca. (E) Expression of CEC-1 and CEC-6 in dissected germlines. The arrows (top panel) indicate nuclei of the somatic gonad cells. Germlines in (C) were costained with an antibody detecting the RNA polymerase C-terminal domain (polII) to control for antibody penetration.
Figure Legend Snippet: Distinct expression patterns of C. elegans chromo-domain proteins CEC-1 and CEC-6. (A) Relative expression levels of CEC-1 and CEC-6 across developmental stages. The 3xHA (hemagglutinin) epitope was inserted in-frame at the endogenous locus using clustered regularly interspaced short palindromic repeats/Cas9 genome editing (see also Figure S3C). L1–L4, larval stages 1–4. (B) Localization of CEC-1 and CEC-6 by anti-HA tag immunofluorescence in embryos and L1 animals. The arrowheads [(B), lower right] indicate the primordial germ cells (see also Figure S3D). (C) Broad nuclear expression of CEC-1 in the adult head. (D) Schematic of an isolated germline arm indicating three regions depicted in (E). The distal germline is a syncytium, with germ cells surrounding a central canal. d, distal; p, proximal; and s, spermatheca. (E) Expression of CEC-1 and CEC-6 in dissected germlines. The arrows (top panel) indicate nuclei of the somatic gonad cells. Germlines in (C) were costained with an antibody detecting the RNA polymerase C-terminal domain (polII) to control for antibody penetration.

Techniques Used: Expressing, Capillary Electrochromatography, CRISPR, Immunofluorescence, Isolation

51) Product Images from "Cloning of a Novel Apaf-1-Interacting Protein: A Potent Suppressor of Apoptosis and Ischemic Neuronal Cell Death"

Article Title: Cloning of a Novel Apaf-1-Interacting Protein: A Potent Suppressor of Apoptosis and Ischemic Neuronal Cell Death

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.1426-04.2004

Neuroprotective effect of AAV-AIP against apoptosis and oxygen- glucose deprivation injury in primary hippocampal-cortical neurons. a , Primary neurons were infected for 3 d with AAV-AIP or AAV-CON carrying the truncated AIP cDNA that lacks the CARD domain,
Figure Legend Snippet: Neuroprotective effect of AAV-AIP against apoptosis and oxygen- glucose deprivation injury in primary hippocampal-cortical neurons. a , Primary neurons were infected for 3 d with AAV-AIP or AAV-CON carrying the truncated AIP cDNA that lacks the CARD domain,

Techniques Used: Infection

Characterization of the anti-apoptotic effect of AIP in cell lines. a , Transfection of AIP cDNA inhibited apoptosis in human 293 cells induced by transient cDNA transfection of rat caspase-9 or Apaf-1. Cell death was analyzed at 24 hr after transfection.
Figure Legend Snippet: Characterization of the anti-apoptotic effect of AIP in cell lines. a , Transfection of AIP cDNA inhibited apoptosis in human 293 cells induced by transient cDNA transfection of rat caspase-9 or Apaf-1. Cell death was analyzed at 24 hr after transfection.

Techniques Used: Transfection

52) Product Images from "Human Papillomavirus Type 8 Interferes with a Novel C/EBP?-Mediated Mechanism of Keratinocyte CCL20 Chemokine Expression and Langerhans Cell Migration"

Article Title: Human Papillomavirus Type 8 Interferes with a Novel C/EBP?-Mediated Mechanism of Keratinocyte CCL20 Chemokine Expression and Langerhans Cell Migration

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1002833

C/EBPβ binds to the enhancer region of CCL20 in vivo. (A) Nucleotide sequence of the human CCL20 promoter region with twelve putative C/EBP binding sites (underlined). Numbers below the underlined C/EBP binding sites mark the sequences, which display C/EBP DNA binding activity in EMSA. In bold is the DNA sequence tested for C/EBP binding in ChIP assay. (B) 32 P-labeled oligonucleotides containing the respective C/EBP binding sites (nt 294–308, nt 574–584, nt 652–667, nt 716–724, nt 734–748) of the CCL20 promoter were incubated with 5 µg GST, GST-C/EBPα or GST-C/EBPβ fusion proteins and analyzed by EMSA. The arrow indicates complexes corresponding to C/EBP DNA binding activity. (C) Chromatin immunoprecipitation assay was performed using RTS3b cells transfected with the C/EBPβ expression vector. For precipitation anti-C/EBPβ (H-7) antibody was used. Genomic DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter (in bold). The amplicon was quantified (left panel) and visualized on an agarose gel (right panel). The amount of target DNA precipitated with the control antibody was set at 1. Shown are mean values ± SD from four experiments. The asterisk represents statistical significance, p = 0.02.
Figure Legend Snippet: C/EBPβ binds to the enhancer region of CCL20 in vivo. (A) Nucleotide sequence of the human CCL20 promoter region with twelve putative C/EBP binding sites (underlined). Numbers below the underlined C/EBP binding sites mark the sequences, which display C/EBP DNA binding activity in EMSA. In bold is the DNA sequence tested for C/EBP binding in ChIP assay. (B) 32 P-labeled oligonucleotides containing the respective C/EBP binding sites (nt 294–308, nt 574–584, nt 652–667, nt 716–724, nt 734–748) of the CCL20 promoter were incubated with 5 µg GST, GST-C/EBPα or GST-C/EBPβ fusion proteins and analyzed by EMSA. The arrow indicates complexes corresponding to C/EBP DNA binding activity. (C) Chromatin immunoprecipitation assay was performed using RTS3b cells transfected with the C/EBPβ expression vector. For precipitation anti-C/EBPβ (H-7) antibody was used. Genomic DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter (in bold). The amplicon was quantified (left panel) and visualized on an agarose gel (right panel). The amount of target DNA precipitated with the control antibody was set at 1. Shown are mean values ± SD from four experiments. The asterisk represents statistical significance, p = 0.02.

Techniques Used: In Vivo, Sequencing, Binding Assay, Activity Assay, Chromatin Immunoprecipitation, Labeling, Incubation, Transfection, Expressing, Plasmid Preparation, Isolation, Amplification, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis

HPV8 E7 interferes with binding of C/EBPβ to the CCL20 promoter. (A) Nuclear extracts from HaCaT cells stably expressing HPV8 E7 (pLXSN-HPV8 E7) and corresponding control cells (pLXSN) were analyzed by Western blot for C/EBPβ protein and HMGB1 expression (upper panels). Identical amounts of the respective nuclear extracts were used for EMSA using the 32 P-labeled oligonucleotides (nt 734–748) containing the C/EBP binding site in the CCL20 promoter (lower panel). The complex corresponding to endogenous C/EBP binding activity within the CCL20 promoter is indicated by an arrow. (B) The same cells were used for chromatin immunoprecipitation. Protein-genomic DNA complexes were precipitated with anti-C/EBPβ antibody. DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter. The amplicon was quantified (lower panel) and visualized on an agarose gel (upper panel). The amount of target DNA precipitated from the pLXSN control cells was set at 100%. The mean values ± SD from three independent experiments are presented. Asterisks represent statistical significance, p = 0.008.
Figure Legend Snippet: HPV8 E7 interferes with binding of C/EBPβ to the CCL20 promoter. (A) Nuclear extracts from HaCaT cells stably expressing HPV8 E7 (pLXSN-HPV8 E7) and corresponding control cells (pLXSN) were analyzed by Western blot for C/EBPβ protein and HMGB1 expression (upper panels). Identical amounts of the respective nuclear extracts were used for EMSA using the 32 P-labeled oligonucleotides (nt 734–748) containing the C/EBP binding site in the CCL20 promoter (lower panel). The complex corresponding to endogenous C/EBP binding activity within the CCL20 promoter is indicated by an arrow. (B) The same cells were used for chromatin immunoprecipitation. Protein-genomic DNA complexes were precipitated with anti-C/EBPβ antibody. DNA was isolated, amplified by real-time PCR with primers specific for the nt 638–677 region of the CCL20 promoter. The amplicon was quantified (lower panel) and visualized on an agarose gel (upper panel). The amount of target DNA precipitated from the pLXSN control cells was set at 100%. The mean values ± SD from three independent experiments are presented. Asterisks represent statistical significance, p = 0.008.

Techniques Used: Binding Assay, Stable Transfection, Expressing, Western Blot, Labeling, Activity Assay, Chromatin Immunoprecipitation, Isolation, Amplification, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis

53) Product Images from "Cloning of a Novel Apaf-1-Interacting Protein: A Potent Suppressor of Apoptosis and Ischemic Neuronal Cell Death"

Article Title: Cloning of a Novel Apaf-1-Interacting Protein: A Potent Suppressor of Apoptosis and Ischemic Neuronal Cell Death

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.1426-04.2004

Neuroprotective effect of AAV-AIP against apoptosis and oxygen- glucose deprivation injury in primary hippocampal-cortical neurons. a , Primary neurons were infected for 3 d with AAV-AIP or AAV-CON carrying the truncated AIP cDNA that lacks the CARD domain,
Figure Legend Snippet: Neuroprotective effect of AAV-AIP against apoptosis and oxygen- glucose deprivation injury in primary hippocampal-cortical neurons. a , Primary neurons were infected for 3 d with AAV-AIP or AAV-CON carrying the truncated AIP cDNA that lacks the CARD domain,

Techniques Used: Infection

Characterization of the anti-apoptotic effect of AIP in cell lines. a , Transfection of AIP cDNA inhibited apoptosis in human 293 cells induced by transient cDNA transfection of rat caspase-9 or Apaf-1. Cell death was analyzed at 24 hr after transfection.
Figure Legend Snippet: Characterization of the anti-apoptotic effect of AIP in cell lines. a , Transfection of AIP cDNA inhibited apoptosis in human 293 cells induced by transient cDNA transfection of rat caspase-9 or Apaf-1. Cell death was analyzed at 24 hr after transfection.

Techniques Used: Transfection

54) Product Images from "Point mutation in the gene encoding p300 suppresses thrombocytopenia in Mpl−/− mice"

Article Title: Point mutation in the gene encoding p300 suppresses thrombocytopenia in Mpl−/− mice

Journal: Blood

doi: 10.1182/blood-2007-10-119677

The Plt6 mutation reduces p300 affinity for c-Myb . GST, GST-p300 KIX (Y630N), and GST-p300 KIX (wild type; 2 μg each) were used as baits for pull-down experiments with 35 S-labeled, in vitro–transcribed/translated c-Myb. Pull-down reactions
Figure Legend Snippet: The Plt6 mutation reduces p300 affinity for c-Myb . GST, GST-p300 KIX (Y630N), and GST-p300 KIX (wild type; 2 μg each) were used as baits for pull-down experiments with 35 S-labeled, in vitro–transcribed/translated c-Myb. Pull-down reactions

Techniques Used: Mutagenesis, Labeling, In Vitro

55) Product Images from "The Rose (Rosa hybrida) NAC Transcription Factor 3 Gene, RhNAC3, Involved in ABA Signaling Pathway Both in Rose and Arabidopsis"

Article Title: The Rose (Rosa hybrida) NAC Transcription Factor 3 Gene, RhNAC3, Involved in ABA Signaling Pathway Both in Rose and Arabidopsis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0109415

ABA-related gene expression in RhNAC3 -silenced rose petals. A , The putative ABA signaling and downstream rose genes from the ABA-signaling pathway in rose. a, The clone ID from the rose transcriptome database [7] . b, Description of the A. thaliana homolog given by The Arabidopsis Information Resource (TAIR, http://www.arabidopsis.org ). B , qRT-PCR analysis of RhNAC3 -silenced rose petals. The rose cDNAs of TRV and RhNAC3 -silenced (TRV- RhNAC3 ) petals were described in our previous report [26] . Data represent the fold change of each gene by TRV- RhNAC3 relative to the TRV control. RhUbi1 was used as the internal control. Error bars indicate SE ( n = 3). C , Sequences and positions of putative RhNAC3 binding elements used for the EMSA. Probes were derived from the regulatory sequence of three selected ABA-related rose genes. Underlined letters indicate the core sequences of putative NAC protein-binding sites. The sense strands of oligonucleotide probes corresponding to the predicted RhNAC3 binding sites are shown. D , DNA-binding specificity for RhNAC3 with the probes indicated in C . The arrows indicate the positions of protein/DNA complexes and the free probes, respectively. Purified protein (2 µg) was incubated with 0.2 pmol of biotin probe. E , DNA-binding specificity for RhNAC3 with RU03861 . The RU03861 (P3) probe incubated with GST was used as a control, and a 10, 100, and 1000 fold excess of the unlabeled P3 was used for competitive binding.
Figure Legend Snippet: ABA-related gene expression in RhNAC3 -silenced rose petals. A , The putative ABA signaling and downstream rose genes from the ABA-signaling pathway in rose. a, The clone ID from the rose transcriptome database [7] . b, Description of the A. thaliana homolog given by The Arabidopsis Information Resource (TAIR, http://www.arabidopsis.org ). B , qRT-PCR analysis of RhNAC3 -silenced rose petals. The rose cDNAs of TRV and RhNAC3 -silenced (TRV- RhNAC3 ) petals were described in our previous report [26] . Data represent the fold change of each gene by TRV- RhNAC3 relative to the TRV control. RhUbi1 was used as the internal control. Error bars indicate SE ( n = 3). C , Sequences and positions of putative RhNAC3 binding elements used for the EMSA. Probes were derived from the regulatory sequence of three selected ABA-related rose genes. Underlined letters indicate the core sequences of putative NAC protein-binding sites. The sense strands of oligonucleotide probes corresponding to the predicted RhNAC3 binding sites are shown. D , DNA-binding specificity for RhNAC3 with the probes indicated in C . The arrows indicate the positions of protein/DNA complexes and the free probes, respectively. Purified protein (2 µg) was incubated with 0.2 pmol of biotin probe. E , DNA-binding specificity for RhNAC3 with RU03861 . The RU03861 (P3) probe incubated with GST was used as a control, and a 10, 100, and 1000 fold excess of the unlabeled P3 was used for competitive binding.

Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay, Derivative Assay, Sequencing, Protein Binding, Purification, Incubation

56) Product Images from "Characterizing the N- and C-terminal Small Ubiquitin-like Modifier (SUMO)-interacting Motifs of the Scaffold Protein DAXX *"

Article Title: Characterizing the N- and C-terminal Small Ubiquitin-like Modifier (SUMO)-interacting Motifs of the Scaffold Protein DAXX *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.231647

Mapping binding interfaces of SUMO-1 and SUMO-2 with SIM-N and SIM-C. A , modular organization of murine and human DAXX, including SIM-N, SIM-C, the DHB domain, an uncharacterized helical domain, an “acidic” region, which contains 80% Glu/Asp
Figure Legend Snippet: Mapping binding interfaces of SUMO-1 and SUMO-2 with SIM-N and SIM-C. A , modular organization of murine and human DAXX, including SIM-N, SIM-C, the DHB domain, an uncharacterized helical domain, an “acidic” region, which contains 80% Glu/Asp

Techniques Used: Binding Assay

SIM-C of DAXX 566–739 binds only the SUMO-1 moiety of sumoylated Ets1. A , superimposed 15 N HSQC spectra of sumoylated 15 N-labeled Ets1 1–138 in the absence ( red ) and presence ( black ) of unlabeled DAXX 566–739 . The lack of any detectable
Figure Legend Snippet: SIM-C of DAXX 566–739 binds only the SUMO-1 moiety of sumoylated Ets1. A , superimposed 15 N HSQC spectra of sumoylated 15 N-labeled Ets1 1–138 in the absence ( red ) and presence ( black ) of unlabeled DAXX 566–739 . The lack of any detectable

Techniques Used: Labeling

SIM-N binds the DHB domain and is sequestered from SUMO-1 when present within DAXX 1–144 . A , amides in the DHB domain of DAXX 55–144 undergoing the greatest combined amide shift perturbations ( magenta ; Δδ > 0.045
Figure Legend Snippet: SIM-N binds the DHB domain and is sequestered from SUMO-1 when present within DAXX 1–144 . A , amides in the DHB domain of DAXX 55–144 undergoing the greatest combined amide shift perturbations ( magenta ; Δδ > 0.045

Techniques Used:

57) Product Images from "Functions of LIM proteins in cell polarity and chemotactic motility"

Article Title: Functions of LIM proteins in cell polarity and chemotactic motility

Journal: The EMBO Journal

doi: 10.1093/emboj/cdf550

Fig. 8. Binding of LimC and LimD to F-actin. Co-sedimentation of ( A ) GST–LimC, GST–LimD and ( B ) GST–LimC deletion constructs GST–CLIM and GST–NLIM-P with F-actin. G-actin (5 µM) from D.discoideum was incubated with the GST fusion proteins in polymerization buffer containing 2 mM MgCl 2 , 100 mM KCl and 1 mM EGTA. Pellets (P) and supernatants (S) were separated by high-speed centrifugation, and the proteins in these fractions were analyzed by SDS–PAGE (12% acrylamide) and staining with Coomassie Blue. Controls for the fusion proteins alone were performed without the addition of G-actin in the reaction mixture. The presence (+) or absence (–) of G-actin in the reaction mixture is indicated on the top of the lanes. Arrows marked with C and D indicate GST–LimC and GST–LimD, respectively. Varying amounts of polymerized (P) and unpolymerized actin (S) in GST–LimC and GST–LimD panels might be due to different actin preparations.
Figure Legend Snippet: Fig. 8. Binding of LimC and LimD to F-actin. Co-sedimentation of ( A ) GST–LimC, GST–LimD and ( B ) GST–LimC deletion constructs GST–CLIM and GST–NLIM-P with F-actin. G-actin (5 µM) from D.discoideum was incubated with the GST fusion proteins in polymerization buffer containing 2 mM MgCl 2 , 100 mM KCl and 1 mM EGTA. Pellets (P) and supernatants (S) were separated by high-speed centrifugation, and the proteins in these fractions were analyzed by SDS–PAGE (12% acrylamide) and staining with Coomassie Blue. Controls for the fusion proteins alone were performed without the addition of G-actin in the reaction mixture. The presence (+) or absence (–) of G-actin in the reaction mixture is indicated on the top of the lanes. Arrows marked with C and D indicate GST–LimC and GST–LimD, respectively. Varying amounts of polymerized (P) and unpolymerized actin (S) in GST–LimC and GST–LimD panels might be due to different actin preparations.

Techniques Used: Binding Assay, Sedimentation, Construct, Incubation, Centrifugation, SDS Page, Staining

Fig. 4. GFP–LimC and GFP–LimD redistribution during fluid-phase endocytosis. Cells expressing GFP–LimC ( A ) or GFP–LimD ( B ) were allowed to adhere to glass coverslips and the supernatant was replaced by phosphate buffer containing 1 mg/ml TRITC–dextran. Confocal sections were taken at the times indicated. Arrowheads in the 0 s panels indicate the site of formation of pinocytic vesicles and arrows in subsequent images indicate newly formed pinosomes. Bars, 10 µm.
Figure Legend Snippet: Fig. 4. GFP–LimC and GFP–LimD redistribution during fluid-phase endocytosis. Cells expressing GFP–LimC ( A ) or GFP–LimD ( B ) were allowed to adhere to glass coverslips and the supernatant was replaced by phosphate buffer containing 1 mg/ml TRITC–dextran. Confocal sections were taken at the times indicated. Arrowheads in the 0 s panels indicate the site of formation of pinocytic vesicles and arrows in subsequent images indicate newly formed pinosomes. Bars, 10 µm.

Techniques Used: Expressing

Fig. 3. Distribution of GFP–LimC and GFP–LimD fusion proteins. ( A ) Both the fusion proteins accumulate to high levels at distinct areas of the cell cortex and are distributed throughout the cytoplasm. Occasional localization of both the fusion proteins in the nucleus was also observed (arrowheads). Bars, 10 µm. ( B ) GFP–LimC (upper panels) and GFP–LimD (lower panels) localization coincides with that of actin in the cell cortex. The cells were fixed with cold methanol and immunolabeled with anti-actin monoclonal antibody followed by Cy3-conjugated anti-mouse secondary antibody. Overlay images show the co-localization of GFP–LimC or GFP–LimD fluorescence with the actin staining in the cell cortex. Bars, 10 µm.
Figure Legend Snippet: Fig. 3. Distribution of GFP–LimC and GFP–LimD fusion proteins. ( A ) Both the fusion proteins accumulate to high levels at distinct areas of the cell cortex and are distributed throughout the cytoplasm. Occasional localization of both the fusion proteins in the nucleus was also observed (arrowheads). Bars, 10 µm. ( B ) GFP–LimC (upper panels) and GFP–LimD (lower panels) localization coincides with that of actin in the cell cortex. The cells were fixed with cold methanol and immunolabeled with anti-actin monoclonal antibody followed by Cy3-conjugated anti-mouse secondary antibody. Overlay images show the co-localization of GFP–LimC or GFP–LimD fluorescence with the actin staining in the cell cortex. Bars, 10 µm.

Techniques Used: Immunolabeling, Fluorescence, Staining

Fig. 2. Presence of limC and limD mRNAs and protein during development. The same amount (30 µg) of total RNA isolated from cells developed on phosphate-buffered agar plates at different hours of development as indicated was loaded in each lane. Hybridization was with 32 P-labeled limC or limD cDNA. mRNA sizes are given in kb. For detection of LimD protein, total cellular extracts from AX2 cells (4 × 10 5 cells per lane) harvested at different time points were separated by SDS–PAGE (15% acrylamide). The resulting western blot was probed with LimD-specific monoclonal antibody K4-353-6.
Figure Legend Snippet: Fig. 2. Presence of limC and limD mRNAs and protein during development. The same amount (30 µg) of total RNA isolated from cells developed on phosphate-buffered agar plates at different hours of development as indicated was loaded in each lane. Hybridization was with 32 P-labeled limC or limD cDNA. mRNA sizes are given in kb. For detection of LimD protein, total cellular extracts from AX2 cells (4 × 10 5 cells per lane) harvested at different time points were separated by SDS–PAGE (15% acrylamide). The resulting western blot was probed with LimD-specific monoclonal antibody K4-353-6.

Techniques Used: Isolation, Hybridization, Labeling, SDS Page, Western Blot

Fig. 9. F-actin distribution and cell polarization in mutant cells. ( A ) LimD – cells have a polarization defect and have F-actin acumulated in patches at the cortex. ( B ) LimC – cells are polarized and show F-actin accumulation at cell–cell contacts comparable to AX2 ( D ). ( C ) LimC – /LimD – cells resemble LimD – single mutants. Aggregation stage cells (t6) were fixed with picric acid/paraformaldehyde and stained with TRITC–phalloidin. Bar, 10 µm.
Figure Legend Snippet: Fig. 9. F-actin distribution and cell polarization in mutant cells. ( A ) LimD – cells have a polarization defect and have F-actin acumulated in patches at the cortex. ( B ) LimC – cells are polarized and show F-actin accumulation at cell–cell contacts comparable to AX2 ( D ). ( C ) LimC – /LimD – cells resemble LimD – single mutants. Aggregation stage cells (t6) were fixed with picric acid/paraformaldehyde and stained with TRITC–phalloidin. Bar, 10 µm.

Techniques Used: Mutagenesis, Staining

58) Product Images from "Phosphoproteomics reveals malaria parasite Protein Kinase G as a signalling hub regulating egress and invasion"

Article Title: Phosphoproteomics reveals malaria parasite Protein Kinase G as a signalling hub regulating egress and invasion

Journal: Nature Communications

doi: 10.1038/ncomms8285

Pf CDPK1 is phosphorylated by Pf PKG in vitro . ( a ) An in vitro kinase reaction with [ 32 P]-ATP was carried out using a recombinant HIS-tagged Pf PKG (1 μg) with histone (2 μg) as a substrate in the presence and absence of cGMP (10 μM). ( b ) An in vitro kinase reaction with GST-tagged ‘kinase dead' mutant of Pf CDPK1 where asparate-191 was substituted for an asparagine (CDPK1-KD, 1 μg). This construct was used as a substrate for purified recombinant HIS-tagged Pf PKG (1 μg) in the presence and absence of cGMP (10 μM). Coomassie-stained gel is shown as a loading control. ( c ) In vitro Pf PKG kinase assay performed with recombinant GST-tagged CDPK1-KD (50 ng) as a substrate or a mutant version of CDPK1-KD where serine-64 was substituted by alanine (CDPK1-KD(S-A); 50 ng). The kinase assay was conducted either in the presence or absence of Pf PKG (50 ng) and the resulting reaction probed with a phospho-specific antibody to phosphoserine-64 on CDPK1 (CDPK1-pS64). Blots were stripped and probed with a structural Pf CDPK1 antibody as a loading control. The results shown are representative of three independent experiments.
Figure Legend Snippet: Pf CDPK1 is phosphorylated by Pf PKG in vitro . ( a ) An in vitro kinase reaction with [ 32 P]-ATP was carried out using a recombinant HIS-tagged Pf PKG (1 μg) with histone (2 μg) as a substrate in the presence and absence of cGMP (10 μM). ( b ) An in vitro kinase reaction with GST-tagged ‘kinase dead' mutant of Pf CDPK1 where asparate-191 was substituted for an asparagine (CDPK1-KD, 1 μg). This construct was used as a substrate for purified recombinant HIS-tagged Pf PKG (1 μg) in the presence and absence of cGMP (10 μM). Coomassie-stained gel is shown as a loading control. ( c ) In vitro Pf PKG kinase assay performed with recombinant GST-tagged CDPK1-KD (50 ng) as a substrate or a mutant version of CDPK1-KD where serine-64 was substituted by alanine (CDPK1-KD(S-A); 50 ng). The kinase assay was conducted either in the presence or absence of Pf PKG (50 ng) and the resulting reaction probed with a phospho-specific antibody to phosphoserine-64 on CDPK1 (CDPK1-pS64). Blots were stripped and probed with a structural Pf CDPK1 antibody as a loading control. The results shown are representative of three independent experiments.

Techniques Used: In Vitro, Recombinant, Mutagenesis, Construct, Purification, Staining, Kinase Assay

59) Product Images from "Dematin exhibits a natively unfolded core domain and an independently folded headpiece domain"

Article Title: Dematin exhibits a natively unfolded core domain and an independently folded headpiece domain

Journal: Protein Science : A Publication of the Protein Society

doi: 10.1002/pro.59

15 N HSQC spectra of dematin constructs. ( A ) dematin headpiece (DHP) [data from Frank et al. , the spectrum was taken at 20°C, and pH 6.0; ( B ) rD (∼ 50 μ M ); ( C ) Overlay of the spectra of DHP (black) and rD (red). Spectra of
Figure Legend Snippet: 15 N HSQC spectra of dematin constructs. ( A ) dematin headpiece (DHP) [data from Frank et al. , the spectrum was taken at 20°C, and pH 6.0; ( B ) rD (∼ 50 μ M ); ( C ) Overlay of the spectra of DHP (black) and rD (red). Spectra of

Techniques Used: Construct

Amino acid sequence of the 48 kDa form of dematin. The first 315 amino acids belong to the N-terminal core domain. The C-terminal headpiece domain, residues 316–383, is shown in blue. The proline residues are highlighted in red. The PEST region,
Figure Legend Snippet: Amino acid sequence of the 48 kDa form of dematin. The first 315 amino acids belong to the N-terminal core domain. The C-terminal headpiece domain, residues 316–383, is shown in blue. The proline residues are highlighted in red. The PEST region,

Techniques Used: Sequencing

Far UV circular dichroism spectra of dematin. Open circles: dematin purified from human erythrocyte; Filled circles: rD. The concentration of both samples was 3 μ M in 200 m M NaCl, 10 m M phosphate, and pH 7.0 at room temperature. Each spectrum
Figure Legend Snippet: Far UV circular dichroism spectra of dematin. Open circles: dematin purified from human erythrocyte; Filled circles: rD. The concentration of both samples was 3 μ M in 200 m M NaCl, 10 m M phosphate, and pH 7.0 at room temperature. Each spectrum

Techniques Used: Purification, Concentration Assay

Dematin constructs. Top schematic shows wild type sequence highlighting the PEST sequence (residues 89–102) and the C-terminal headpiece domain (residues 316–383). The wild type PEST sequence is shown below the wild type dematin. The mutated
Figure Legend Snippet: Dematin constructs. Top schematic shows wild type sequence highlighting the PEST sequence (residues 89–102) and the C-terminal headpiece domain (residues 316–383). The wild type PEST sequence is shown below the wild type dematin. The mutated

Techniques Used: Construct, Sequencing

60) Product Images from "Drosophila SPF45: A Bifunctional Protein with Roles in Both Splicing and DNA Repair"

Article Title: Drosophila SPF45: A Bifunctional Protein with Roles in Both Splicing and DNA Repair

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.0020178

SPF45 Function Is Required to Repair DNA Damage (A) Ectopic expression of SPF45 improves the survival rate of E. coli recG mutants after MMS exposure. The survival was expressed as the average-fold increase in survival over the control E. coli recG mutants. Error bars are standard deviations calculated from five independent experiments. An unpaired t test was performed to assess whether there is a statistically significant difference between survival rates of an E. coli recG strain expressing a D. melanogaster protein (either SPF45 J23 or SPF45 + ) and the survival rate of the same E. coli recG strain expressing an empty GST vector . Asterisks denote differences significant at the 95% level ( p
Figure Legend Snippet: SPF45 Function Is Required to Repair DNA Damage (A) Ectopic expression of SPF45 improves the survival rate of E. coli recG mutants after MMS exposure. The survival was expressed as the average-fold increase in survival over the control E. coli recG mutants. Error bars are standard deviations calculated from five independent experiments. An unpaired t test was performed to assess whether there is a statistically significant difference between survival rates of an E. coli recG strain expressing a D. melanogaster protein (either SPF45 J23 or SPF45 + ) and the survival rate of the same E. coli recG strain expressing an empty GST vector . Asterisks denote differences significant at the 95% level ( p

Techniques Used: Expressing, Plasmid Preparation

61) Product Images from "Nuclear transport adapts to varying heat stress in a multistep mechanism"

Article Title: Nuclear transport adapts to varying heat stress in a multistep mechanism

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201712042

Thermosensitivity of Imp α1. (a and b) Using Imp α1, Imp β, and RanGDP preincubated at indicated temperatures, in vitro transport assays of GST-SV NLS–GFP were performed. After the reactions, the cells were fixed and stained with DAPI (a). Then, nuclear intensities of GST-SV NLS–GFP were plotted (b). Bars, 20 µm. (c–e) Imp α1 (c), Imp β (d), or RanGDP (e) was preincubated for 60 min at indicated temperatures, and the remaining two transport factors were preincubated at 37.3°C. Then, the import assays of GST-SV NLS–GFP were performed. The nuclear intensities were plotted (see also Fig. S3, a–c). Black bars show the median of > 100 cells at eight temperature conditions (total n = 1,521 [b], 1,255 [c], 1,598 [d], and 1,494 [e]). All plots in each graph were calculated from one simultaneous experiment. (f) Imp α1 and Imp β were independently preincubated at either 37.3 or 43.3°C for 60 min. Then, these proteins and either MBPx2 or MBPx2-SV NLS were incubated with amylose beads. (g) GST, GST–Imp β, and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST–Imp β was incubated with Imp α1, MBPx2-SV NLS, and glutathione beads. (h) GST, GST-CAS, Flag-RanGTP (Q69L), and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST-CAS was incubated with Imp α1, Flag-RanGTP (Q69L), and glutathione beads. Proteins bound to beads were analyzed by Coomassie brilliant blue staining. (i) Model for the inhibition of Imp α/β–dependent import and the nuclear translocation of Imp α. (j) Model for temperature-dependent transport modulations. cNLS indicates classical NLS, which is recognized by Imp α1.
Figure Legend Snippet: Thermosensitivity of Imp α1. (a and b) Using Imp α1, Imp β, and RanGDP preincubated at indicated temperatures, in vitro transport assays of GST-SV NLS–GFP were performed. After the reactions, the cells were fixed and stained with DAPI (a). Then, nuclear intensities of GST-SV NLS–GFP were plotted (b). Bars, 20 µm. (c–e) Imp α1 (c), Imp β (d), or RanGDP (e) was preincubated for 60 min at indicated temperatures, and the remaining two transport factors were preincubated at 37.3°C. Then, the import assays of GST-SV NLS–GFP were performed. The nuclear intensities were plotted (see also Fig. S3, a–c). Black bars show the median of > 100 cells at eight temperature conditions (total n = 1,521 [b], 1,255 [c], 1,598 [d], and 1,494 [e]). All plots in each graph were calculated from one simultaneous experiment. (f) Imp α1 and Imp β were independently preincubated at either 37.3 or 43.3°C for 60 min. Then, these proteins and either MBPx2 or MBPx2-SV NLS were incubated with amylose beads. (g) GST, GST–Imp β, and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST–Imp β was incubated with Imp α1, MBPx2-SV NLS, and glutathione beads. (h) GST, GST-CAS, Flag-RanGTP (Q69L), and Imp α1 were independently preincubated at either 37.3 or 43.3°C. Then, either GST or GST-CAS was incubated with Imp α1, Flag-RanGTP (Q69L), and glutathione beads. Proteins bound to beads were analyzed by Coomassie brilliant blue staining. (i) Model for the inhibition of Imp α/β–dependent import and the nuclear translocation of Imp α. (j) Model for temperature-dependent transport modulations. cNLS indicates classical NLS, which is recognized by Imp α1.

Techniques Used: In Vitro, Staining, Incubation, Inhibition, Translocation Assay

Relationship between Imp α/β–dependent import and nuclear translocation of Imp α1. (a) After the incubation at 43.3°C, GFP-SV NLS–expressing stable HeLa S3 cells were fixed at various time points and stained with anti–Imp α1 antibody and DRAQ5 and observed. (b and c) The N/C intensities of Imp α1 (b) and GFP-SV NLS (c) versus time (min) were plotted. (d) Scatter plots of the nuclear accumulation levels of GFP-SV NLS versus endogenous Imp α1. On the x and y axes, N/C intensities of GFP-SV NLS and Imp α1 are shown, respectively. (e) The cells were incubated for 60 min at indicated temperatures, and the cells were permeabilized using ice-cold Triton X-100 and washed out soluble fractions. Then, the cells were fixed and stained with anti–Imp α1 and DRAQ5. Bars, 10 µm. (f) Nuclear intensities of insoluble Imp α1 were plotted. Black bars show the median of > 50 cells at each temperature. Black bars show the median of > 50 cells at seven time points (b and c) or eight temperature conditions (f; total n = 424 [b–d] and 445 [f]). All plots in each graph were calculated from one simultaneous experiment. The red line in f shows the threshold temperature. (g) Cells were incubated for 60 min either at 37.3 or 43.3°C and separated into soluble and insoluble fractions. Then, Imp α1 was detected using WB.
Figure Legend Snippet: Relationship between Imp α/β–dependent import and nuclear translocation of Imp α1. (a) After the incubation at 43.3°C, GFP-SV NLS–expressing stable HeLa S3 cells were fixed at various time points and stained with anti–Imp α1 antibody and DRAQ5 and observed. (b and c) The N/C intensities of Imp α1 (b) and GFP-SV NLS (c) versus time (min) were plotted. (d) Scatter plots of the nuclear accumulation levels of GFP-SV NLS versus endogenous Imp α1. On the x and y axes, N/C intensities of GFP-SV NLS and Imp α1 are shown, respectively. (e) The cells were incubated for 60 min at indicated temperatures, and the cells were permeabilized using ice-cold Triton X-100 and washed out soluble fractions. Then, the cells were fixed and stained with anti–Imp α1 and DRAQ5. Bars, 10 µm. (f) Nuclear intensities of insoluble Imp α1 were plotted. Black bars show the median of > 50 cells at each temperature. Black bars show the median of > 50 cells at seven time points (b and c) or eight temperature conditions (f; total n = 424 [b–d] and 445 [f]). All plots in each graph were calculated from one simultaneous experiment. The red line in f shows the threshold temperature. (g) Cells were incubated for 60 min either at 37.3 or 43.3°C and separated into soluble and insoluble fractions. Then, Imp α1 was detected using WB.

Techniques Used: Translocation Assay, Incubation, Expressing, Staining, Western Blot

Nuclear transport factors in high-temperature conditions. (a–e) After incubation at various temperatures for 60 min, the cells were fixed and stained with DRAQ5 and an antibody recognizing endogenous Ran (a), Imp β (b), CRM1 (c), or Imp α1 (d and e). Then, N/C intensities were plotted (see also Fig. S1, c and d). Bars, 10 µm. (f) After 60 min incubation at indicated temperatures, endogenous HSC70, HSP70, and Imp α1 were detected using WB. (g–l) Cells transfected with either negative control (g and j), Hikeshi 2 (h and k), or Hikeshi 3 (i and l) siRNA-treated cells were incubated at various temperature for 60 min. Then, the cells were stained with either anti-HSC/HSP70 (g–i) or anti–Imp α1 (j–l) antibodies, and N/C intensities at each temperature were plotted. Black bars show the median of > 50 cells at eight temperature conditions (total n = 521 [a], 478 [b], 513 [c], 462 [e], 500 [g], 467 [h], 502 [i], 460 [j], 462 [k], and 463 [l]). All plots in each graph were calculated from one simultaneous experiment. Red lines show threshold temperatures.
Figure Legend Snippet: Nuclear transport factors in high-temperature conditions. (a–e) After incubation at various temperatures for 60 min, the cells were fixed and stained with DRAQ5 and an antibody recognizing endogenous Ran (a), Imp β (b), CRM1 (c), or Imp α1 (d and e). Then, N/C intensities were plotted (see also Fig. S1, c and d). Bars, 10 µm. (f) After 60 min incubation at indicated temperatures, endogenous HSC70, HSP70, and Imp α1 were detected using WB. (g–l) Cells transfected with either negative control (g and j), Hikeshi 2 (h and k), or Hikeshi 3 (i and l) siRNA-treated cells were incubated at various temperature for 60 min. Then, the cells were stained with either anti-HSC/HSP70 (g–i) or anti–Imp α1 (j–l) antibodies, and N/C intensities at each temperature were plotted. Black bars show the median of > 50 cells at eight temperature conditions (total n = 521 [a], 478 [b], 513 [c], 462 [e], 500 [g], 467 [h], 502 [i], 460 [j], 462 [k], and 463 [l]). All plots in each graph were calculated from one simultaneous experiment. Red lines show threshold temperatures.

Techniques Used: Incubation, Staining, Western Blot, Transfection, Negative Control

62) Product Images from "SUMO-specific protease 2 in Mdm2-mediated regulation of p53"

Article Title: SUMO-specific protease 2 in Mdm2-mediated regulation of p53

Journal: Cell Death and Differentiation

doi: 10.1038/cdd.2010.168

SENP2 interferes with the DNA damage-induced cell death and the growth factor-deprived stress mediated by p53. ( a ) Disruption of p53 results in the survival of HCT116 cells treated with doxorubicin. ( b ) Immunoblot analysis indicates the expression of
Figure Legend Snippet: SENP2 interferes with the DNA damage-induced cell death and the growth factor-deprived stress mediated by p53. ( a ) Disruption of p53 results in the survival of HCT116 cells treated with doxorubicin. ( b ) Immunoblot analysis indicates the expression of

Techniques Used: Expressing

DNA damage-induced apoptosis promotes the interaction of Mdm2 and SENP2 at the PML bodies. ( a ) Triple labeling of Mdm2, PML and activated caspase-3 reveals that Mdm2 accumulates in the PML bodies of cells undergoing p53-dependent apoptosis. Mdm2-GFP was
Figure Legend Snippet: DNA damage-induced apoptosis promotes the interaction of Mdm2 and SENP2 at the PML bodies. ( a ) Triple labeling of Mdm2, PML and activated caspase-3 reveals that Mdm2 accumulates in the PML bodies of cells undergoing p53-dependent apoptosis. Mdm2-GFP was

Techniques Used: Labeling

63) Product Images from "The Kinesin-associated Protein UNC-76 Is Required for Axonal Transport in the Drosophila Nervous System"

Article Title: The Kinesin-associated Protein UNC-76 Is Required for Axonal Transport in the Drosophila Nervous System

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E02-12-0800

UNC-76 interacts with the KHC tail domain in the yeast two-hybrid assay and in copurification assays. (A) Yeast cells containing a lacZ reporter gene and various combinations of LexA DNA binding domain (baits, left column) and B42 activation domain (preys, right column) fusion proteins were grown on CM Gal/Raff Xgal plates. Colonies in which reporter gene activation is enhanced by specific bait-prey interactions are blue, whereas colonies in which a bait-prey interaction do not occur are white. Colonies that contain the KHC stalk and tail domains (aa 675-976) or the KHC tail domain (aa 850-975) bait fusions and the UNC-76 prey fusion enhance reporter gene transcription, but colonies containing the KHC stalk domain (aa 675-850) and UNC-76 do not. Control, LexA DNA binding domain bait or B42 activation domain prey. (B) Western analysis of protein fractions from UNC-76 copurification assay. 6xHIS-tagged full-length UNC-76 was bound to Ni 2 + -NTA agarose beads and incubated with detergent-soluble extracts of adult flies containing a transgenic copy of myc epitope-tagged KLC. KHC and KLC copurify with UNC-76 beads (lane U), but not with Ni 2 + -NTA agarose beads alone (lane B). KHC, blot probed with anti-KHC antibody; KLC, blot probed with anti-myc antibody to detect transgenic KLC; L, detergent-soluble lysate; B, proteins that copurify with Ni 2 + -NTA beads; S, supernatant from UNC-76 copurification assay; U, proteins that copurify with 6xHIS-UNC-76 beads.
Figure Legend Snippet: UNC-76 interacts with the KHC tail domain in the yeast two-hybrid assay and in copurification assays. (A) Yeast cells containing a lacZ reporter gene and various combinations of LexA DNA binding domain (baits, left column) and B42 activation domain (preys, right column) fusion proteins were grown on CM Gal/Raff Xgal plates. Colonies in which reporter gene activation is enhanced by specific bait-prey interactions are blue, whereas colonies in which a bait-prey interaction do not occur are white. Colonies that contain the KHC stalk and tail domains (aa 675-976) or the KHC tail domain (aa 850-975) bait fusions and the UNC-76 prey fusion enhance reporter gene transcription, but colonies containing the KHC stalk domain (aa 675-850) and UNC-76 do not. Control, LexA DNA binding domain bait or B42 activation domain prey. (B) Western analysis of protein fractions from UNC-76 copurification assay. 6xHIS-tagged full-length UNC-76 was bound to Ni 2 + -NTA agarose beads and incubated with detergent-soluble extracts of adult flies containing a transgenic copy of myc epitope-tagged KLC. KHC and KLC copurify with UNC-76 beads (lane U), but not with Ni 2 + -NTA agarose beads alone (lane B). KHC, blot probed with anti-KHC antibody; KLC, blot probed with anti-myc antibody to detect transgenic KLC; L, detergent-soluble lysate; B, proteins that copurify with Ni 2 + -NTA beads; S, supernatant from UNC-76 copurification assay; U, proteins that copurify with 6xHIS-UNC-76 beads.

Techniques Used: Y2H Assay, Copurification, Binding Assay, Activation Assay, Western Blot, Incubation, Transgenic Assay

64) Product Images from "Differential Regulation of Human Papillomavirus Type 8 by Interferon Regulatory Factors 3 and 7 ▿"

Article Title: Differential Regulation of Human Papillomavirus Type 8 by Interferon Regulatory Factors 3 and 7 ▿

Journal: Journal of Virology

doi: 10.1128/JVI.00998-10

Suppression of IRF-3 dominates over the IRF-7 stimulatory effect. (A) Purified GST and GST-IRF-3 fusion proteins were incubated with 32 P-labeled oligonucleotides (nt 7365 to 7391) comprising the IRF-BS and analyzed by EMSA. The IRF-3 band is indicated
Figure Legend Snippet: Suppression of IRF-3 dominates over the IRF-7 stimulatory effect. (A) Purified GST and GST-IRF-3 fusion proteins were incubated with 32 P-labeled oligonucleotides (nt 7365 to 7391) comprising the IRF-BS and analyzed by EMSA. The IRF-3 band is indicated

Techniques Used: Purification, Incubation, Labeling

IRF-7 activates the HPV8 NCR. (A) NHK cells were transfected with the HPV8 NCR luciferase construct (0.5 μg) and IRF-7Δ247-467 expression vectors as indicated. The total amount of DNA was adjusted with the pFlag-CMV2 control vector. (B)
Figure Legend Snippet: IRF-7 activates the HPV8 NCR. (A) NHK cells were transfected with the HPV8 NCR luciferase construct (0.5 μg) and IRF-7Δ247-467 expression vectors as indicated. The total amount of DNA was adjusted with the pFlag-CMV2 control vector. (B)

Techniques Used: Transfection, Luciferase, Construct, Expressing, Plasmid Preparation

65) Product Images from "Membrane-anchored carbonic anhydrase IV interacts with monocarboxylate transporters via their chaperones CD147 and GP70"

Article Title: Membrane-anchored carbonic anhydrase IV interacts with monocarboxylate transporters via their chaperones CD147 and GP70

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA118.005536

Binding of CAIV to hCD147 requires the Glu-73 in the Ig1 domain of hCD147. A, representative Western blots of CAIV ( left blot ) and GST ( right blot ), respectively. CAIV was pulled down with GST ( lane 1 ), a GST fusion protein of the Ig1 domain of hCD147–WT ( lane 2 ), a GST fusion protein of Ig1 domain of the hCD147 mutant E31Q ( lane 3 ), and a GST fusion protein of Ig1 domain of the hCD147 mutant E73Q ( lane 4 ). B, relative intensity of the fluorescent signal of CAIV. For every blot, the signals for CAIV were normalized to the corresponding signals for GST–hCD147–WT. Each individual signal for CAIV was normalized to the intensity of the signal for GST in the same lane. The significance indicators above the dots refer to GST–hCD147–WT.
Figure Legend Snippet: Binding of CAIV to hCD147 requires the Glu-73 in the Ig1 domain of hCD147. A, representative Western blots of CAIV ( left blot ) and GST ( right blot ), respectively. CAIV was pulled down with GST ( lane 1 ), a GST fusion protein of the Ig1 domain of hCD147–WT ( lane 2 ), a GST fusion protein of Ig1 domain of the hCD147 mutant E31Q ( lane 3 ), and a GST fusion protein of Ig1 domain of the hCD147 mutant E73Q ( lane 4 ). B, relative intensity of the fluorescent signal of CAIV. For every blot, the signals for CAIV were normalized to the corresponding signals for GST–hCD147–WT. Each individual signal for CAIV was normalized to the intensity of the signal for GST in the same lane. The significance indicators above the dots refer to GST–hCD147–WT.

Techniques Used: Binding Assay, Western Blot, Mutagenesis

66) Product Images from "CtrA, a Global Response Regulator, Uses a Distinct Second Category of Weak DNA Binding Sites for Cell Cycle Transcription Control in Caulobacter crescentus "

Article Title: CtrA, a Global Response Regulator, Uses a Distinct Second Category of Weak DNA Binding Sites for Cell Cycle Transcription Control in Caulobacter crescentus

Journal: Journal of Bacteriology

doi: 10.1128/JB.00355-09

Double-stranded oligonucleotides (A) based on the ctrA P1 and P2 promoters and (B) based on the Cori replication origin. The bars indicate the established CtrA footprints. The full sequence of the wild type (unaltered DNA) is shown, and only the changes
Figure Legend Snippet: Double-stranded oligonucleotides (A) based on the ctrA P1 and P2 promoters and (B) based on the Cori replication origin. The bars indicate the established CtrA footprints. The full sequence of the wild type (unaltered DNA) is shown, and only the changes

Techniques Used: Sequencing

67) Product Images from "Transportin-SR2 mediates nuclear import of phosphorylated SR proteins"

Article Title: Transportin-SR2 mediates nuclear import of phosphorylated SR proteins

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.181354098

TNR-SR2 mediates nuclear import of phosphorylated SR proteins. GST-ASF and -RS were in vitro phosphorylated or mock-treated by SRPK1. The nuclear import assay for these two GST-SR protein fusions was carried out in a bacterial extract containing TRN-SR2 (+TRN-SR2) or in mock extract (−TRN-SR2). Effects of low temperature ( d and i ) or of RanQ69L-GTP (0.1 mg/ml) ( e and j ) on import were examined.
Figure Legend Snippet: TNR-SR2 mediates nuclear import of phosphorylated SR proteins. GST-ASF and -RS were in vitro phosphorylated or mock-treated by SRPK1. The nuclear import assay for these two GST-SR protein fusions was carried out in a bacterial extract containing TRN-SR2 (+TRN-SR2) or in mock extract (−TRN-SR2). Effects of low temperature ( d and i ) or of RanQ69L-GTP (0.1 mg/ml) ( e and j ) on import were examined.

Techniques Used: In Vitro

TRN-SR2 interacts with nucleoporin p62 and is targeted to nuclear speckles. ( A ) GST or GST-transport receptor fusions (2 μg each) were incubated with HeLa cytosol, as described in Materials and Methods . Proteins interacting with GST or GST-fusion transporters were selected by glutathione-Sepharose and detected by immunoblotting with mAb 414 (lanes 1–5) or an antibody to p62 (lanes 6–9). For competition, binding reaction mixtures contained transport buffer alone (−; lane 7), 10 μM phosphorylated SR peptide (SR; lane 8), or 5 μM RanQ69L-GTP (Ran; lane 9). Lane 1 shows 6.6% of the input into the pull-down assay. The asterisk represents a band that was detected in some but not all batches of the cytosol used. ( B ) Permeabilized HeLa cells were incubated with 0.6 μM GST-TRN-SR2 or GST-impβ in the presence of an ATP regeneration system. Double-label immunofluorescence was performed by using polyclonal anti-GST ( a and d ) and monoclonal anti-SC35 ( b and e ) antibodies. Merged images are shown in c and f .
Figure Legend Snippet: TRN-SR2 interacts with nucleoporin p62 and is targeted to nuclear speckles. ( A ) GST or GST-transport receptor fusions (2 μg each) were incubated with HeLa cytosol, as described in Materials and Methods . Proteins interacting with GST or GST-fusion transporters were selected by glutathione-Sepharose and detected by immunoblotting with mAb 414 (lanes 1–5) or an antibody to p62 (lanes 6–9). For competition, binding reaction mixtures contained transport buffer alone (−; lane 7), 10 μM phosphorylated SR peptide (SR; lane 8), or 5 μM RanQ69L-GTP (Ran; lane 9). Lane 1 shows 6.6% of the input into the pull-down assay. The asterisk represents a band that was detected in some but not all batches of the cytosol used. ( B ) Permeabilized HeLa cells were incubated with 0.6 μM GST-TRN-SR2 or GST-impβ in the presence of an ATP regeneration system. Double-label immunofluorescence was performed by using polyclonal anti-GST ( a and d ) and monoclonal anti-SC35 ( b and e ) antibodies. Merged images are shown in c and f .

Techniques Used: Incubation, Binding Assay, Pull Down Assay, Immunofluorescence

RNA-binding capacity of SR proteins correlates with their temperature sensitivity to nuclear import. ( A ) Schematic representation of the GST fusions with ASF, FFDD, ΔRRM1, and RS domain only. Calculated molecular mass (in kDa) of unphosphorylated fusion proteins and relative UV-crosslinking efficiency of phosphorylated proteins are indicated, respectively ( Right ). G represents the glycine-rich hinge of ASF. ( B ) ( a–d ) Nuclear import of phosphorylated GST-ΔRRM1 and GST-FFDD was assayed at 30°C in the mock E. coli lysate or in lysate containing TRN-SR2. ( e–h ) Phosphorylated GST fusion SR proteins (as indicated) were subjected to nuclear import assay in the TRN-SR2-containing lysate on ice. ( C ) Phosphorylated GST-ASF was incubated with E. coli lysate in the absence (−) or presence (+) of RNase A under the import conditions. The reaction mixtures were sedimented on 10–30% glycerol gradient, followed by Western blot analysis by using anti-GST antibodies. GST-ASF peak fractions are indicated by arrowheads (open for mock-treated and closed for RNase-treated). Asterisks represent partially degraded GST-ASF. ( D ) Nuclear import of phosphorylated GST-ASF was assayed in the RNase A-treated (+RNase A) or mock-treated (−RNase A) TRN-SR2-containing extract at 30°C or on ice.
Figure Legend Snippet: RNA-binding capacity of SR proteins correlates with their temperature sensitivity to nuclear import. ( A ) Schematic representation of the GST fusions with ASF, FFDD, ΔRRM1, and RS domain only. Calculated molecular mass (in kDa) of unphosphorylated fusion proteins and relative UV-crosslinking efficiency of phosphorylated proteins are indicated, respectively ( Right ). G represents the glycine-rich hinge of ASF. ( B ) ( a–d ) Nuclear import of phosphorylated GST-ΔRRM1 and GST-FFDD was assayed at 30°C in the mock E. coli lysate or in lysate containing TRN-SR2. ( e–h ) Phosphorylated GST fusion SR proteins (as indicated) were subjected to nuclear import assay in the TRN-SR2-containing lysate on ice. ( C ) Phosphorylated GST-ASF was incubated with E. coli lysate in the absence (−) or presence (+) of RNase A under the import conditions. The reaction mixtures were sedimented on 10–30% glycerol gradient, followed by Western blot analysis by using anti-GST antibodies. GST-ASF peak fractions are indicated by arrowheads (open for mock-treated and closed for RNase-treated). Asterisks represent partially degraded GST-ASF. ( D ) Nuclear import of phosphorylated GST-ASF was assayed in the RNase A-treated (+RNase A) or mock-treated (−RNase A) TRN-SR2-containing extract at 30°C or on ice.

Techniques Used: RNA Binding Assay, Incubation, Western Blot

SR peptide interacts directly with TRN-SR2 and blocks nuclear import of GST-ASF. ( A ) Radiolabeled phosphorylated SR peptide (0.04 μM) was incubated with buffer alone or with 0.4 μM GST-TRN-SR2, GST-impβ, or GST-TRN. For competition experiments by using Ran, 0.8 or 2.4 μM RanGTP or RanGDP was added to appropriate reaction mixtures. One-half of each reaction mixture was analyzed by electrophoresis on a 5.5% nondenaturing gel (native gel, Upper ), and the other half was fractionated by SDS/PAGE on a 20% gel ( Lower ) for monitoring the peptide level in the reactions, because free peptide was not detectable in the nondenaturing gel. ( B ) Nuclear import of GST-ASF (0.5 μM) was compared with that of BSA-NLS (0.5 μM) under control conditions (no peptide) or in the presence of phosphorylated SR peptide at a 45× molar excess over import substrate or SV40 NLS peptide at a 120× molar excess.
Figure Legend Snippet: SR peptide interacts directly with TRN-SR2 and blocks nuclear import of GST-ASF. ( A ) Radiolabeled phosphorylated SR peptide (0.04 μM) was incubated with buffer alone or with 0.4 μM GST-TRN-SR2, GST-impβ, or GST-TRN. For competition experiments by using Ran, 0.8 or 2.4 μM RanGTP or RanGDP was added to appropriate reaction mixtures. One-half of each reaction mixture was analyzed by electrophoresis on a 5.5% nondenaturing gel (native gel, Upper ), and the other half was fractionated by SDS/PAGE on a 20% gel ( Lower ) for monitoring the peptide level in the reactions, because free peptide was not detectable in the nondenaturing gel. ( B ) Nuclear import of GST-ASF (0.5 μM) was compared with that of BSA-NLS (0.5 μM) under control conditions (no peptide) or in the presence of phosphorylated SR peptide at a 45× molar excess over import substrate or SV40 NLS peptide at a 120× molar excess.

Techniques Used: Incubation, Electrophoresis, SDS Page

68) Product Images from "Lumican Binds ALK5 to Promote Epithelium Wound Healing"

Article Title: Lumican Binds ALK5 to Promote Epithelium Wound Healing

Journal: PLoS ONE

doi: 10.1371/journal.pone.0082730

Identification of Lumikines (Lum C-terminal peptide(s) capable of stimulating wound healing in vitro and in vivo. (A) Amino acid sequences of synthetic LumC peptides, LumC 33 Δ C20 , LumC 18 Δ C5 , Lum C13 and LumC 13C-A (substitution of C with A). (B) In vitro analysis of the function of LumC peptides on the healing of HTCE cells. Healing followed biphasic kinetics in cells treated with CM, BM+GST-Lum, BM+Lum C13 and BM+LumC 13C-A ; whereas those of BM, BM+LumC 33 Δ C20 and BM+LumC 18 Δ C5 followed monophasic kinetics. The R 2 values were as follows: full_Lum 0.993; LumC 18ΔC5 0.970; LumC 33ΔC20 0.936; LumC 13 0.952; LumC 13c-a 0.902. These data suggest that the last C-terminal 13 amino acids have wound healing activity. (C–G) In vivo wound healing activity of Lumican peptides. To confirm LumC 13C-A can also promote corneal epithelium wound healing in vivo, Lum -/- mice were subjected to epithelium debridement. C–F are representative cut view images showing the migration distance. Migration distance was measured between the original wound edge and the wound front. In LumC 13C-A treated corneas, the wound front moved ∼144 µm. The control peptide, LumC 33 Δ C20 , did not promote epithelium wound healing. (G) Summary of epithelium migration. The average epithelium migration (µm) and standard deviation were calculated from five corneas of two separate experiments. In PBS and peptide LumC 33 Δ C20 peptide treated cornea, the epithelium moved ∼38 µm, while corneas treated with LumC 13C-A migrated ∼140 µm. Injured corneal epithelium of wild type mice migrated about 100 µm.
Figure Legend Snippet: Identification of Lumikines (Lum C-terminal peptide(s) capable of stimulating wound healing in vitro and in vivo. (A) Amino acid sequences of synthetic LumC peptides, LumC 33 Δ C20 , LumC 18 Δ C5 , Lum C13 and LumC 13C-A (substitution of C with A). (B) In vitro analysis of the function of LumC peptides on the healing of HTCE cells. Healing followed biphasic kinetics in cells treated with CM, BM+GST-Lum, BM+Lum C13 and BM+LumC 13C-A ; whereas those of BM, BM+LumC 33 Δ C20 and BM+LumC 18 Δ C5 followed monophasic kinetics. The R 2 values were as follows: full_Lum 0.993; LumC 18ΔC5 0.970; LumC 33ΔC20 0.936; LumC 13 0.952; LumC 13c-a 0.902. These data suggest that the last C-terminal 13 amino acids have wound healing activity. (C–G) In vivo wound healing activity of Lumican peptides. To confirm LumC 13C-A can also promote corneal epithelium wound healing in vivo, Lum -/- mice were subjected to epithelium debridement. C–F are representative cut view images showing the migration distance. Migration distance was measured between the original wound edge and the wound front. In LumC 13C-A treated corneas, the wound front moved ∼144 µm. The control peptide, LumC 33 Δ C20 , did not promote epithelium wound healing. (G) Summary of epithelium migration. The average epithelium migration (µm) and standard deviation were calculated from five corneas of two separate experiments. In PBS and peptide LumC 33 Δ C20 peptide treated cornea, the epithelium moved ∼38 µm, while corneas treated with LumC 13C-A migrated ∼140 µm. Injured corneal epithelium of wild type mice migrated about 100 µm.

Techniques Used: In Vitro, In Vivo, Activity Assay, Mouse Assay, Migration, Standard Deviation

Purification of recombinant Lumican and the healing of scratched HTCE cells. Purification of GST-Lum and GST-LumC 50 recombinant proteins Purification of recombinant GST-Lum and GST-LumC 50 was monitored by Coomassie Brilliant Blue (CBB) staining and western blot anlaysis. (A) CBB staining revealed two major bands eluted with glutathione. The upper band with a Mr. ∼70 kDa was GST-Lum and the lower band with a Mr. ∼25 kDa was GST. (B) Immunostaining with an anti-LumN oilgopeptide antibody (CDDLKLKSVPMVPPGIK) only labeled the 70 kDa band (GST-Lum fusion protein) while the lower band did not react to the antibody and is likely related to GST. (C) CBB stained two bands at 30 and 25 kDa from E.coli transfected with GST-LumC 50 plasmid. (D) Immunostaining with an anti-LumC peptide antibody (NPLTQSSLPPDMYEC) labeled the 30 kDa GST-LumC 50 fusion protein. Effect of recombinant GST-Lum and GST-LumC 50 on healing of scratched HTCE cells Confluent HTCE cells were wounded in CM (complete medium), BM (basic medium), BM + GST (glutathione S-transferase recombinant protein), BM+recombinant GST-Lum (0.15 µM) and GSTLumC 50. The wound gap was determined by time-lapse microscopy. (E) Representative time-lapse images of the healing of scratched HTCE cells; (F) The healing followed biphasic kinetics in cells treated with BM+GST-Lum and CM, whereas those of BM and BM+GST followed monophasic kinetics. R 2 values were as follows: BM 0.957; CM 0.994; GST 0.985; LumC 50 0.985; Lum 0.995. The rate constants are summarized in Table 1 .
Figure Legend Snippet: Purification of recombinant Lumican and the healing of scratched HTCE cells. Purification of GST-Lum and GST-LumC 50 recombinant proteins Purification of recombinant GST-Lum and GST-LumC 50 was monitored by Coomassie Brilliant Blue (CBB) staining and western blot anlaysis. (A) CBB staining revealed two major bands eluted with glutathione. The upper band with a Mr. ∼70 kDa was GST-Lum and the lower band with a Mr. ∼25 kDa was GST. (B) Immunostaining with an anti-LumN oilgopeptide antibody (CDDLKLKSVPMVPPGIK) only labeled the 70 kDa band (GST-Lum fusion protein) while the lower band did not react to the antibody and is likely related to GST. (C) CBB stained two bands at 30 and 25 kDa from E.coli transfected with GST-LumC 50 plasmid. (D) Immunostaining with an anti-LumC peptide antibody (NPLTQSSLPPDMYEC) labeled the 30 kDa GST-LumC 50 fusion protein. Effect of recombinant GST-Lum and GST-LumC 50 on healing of scratched HTCE cells Confluent HTCE cells were wounded in CM (complete medium), BM (basic medium), BM + GST (glutathione S-transferase recombinant protein), BM+recombinant GST-Lum (0.15 µM) and GSTLumC 50. The wound gap was determined by time-lapse microscopy. (E) Representative time-lapse images of the healing of scratched HTCE cells; (F) The healing followed biphasic kinetics in cells treated with BM+GST-Lum and CM, whereas those of BM and BM+GST followed monophasic kinetics. R 2 values were as follows: BM 0.957; CM 0.994; GST 0.985; LumC 50 0.985; Lum 0.995. The rate constants are summarized in Table 1 .

Techniques Used: Purification, Recombinant, Staining, Western Blot, Immunostaining, Labeling, Transfection, Plasmid Preparation, Time-lapse Microscopy

Lumican binds to ALK5: in silico analysis and pull down assays. In silico molecular dynamic analysis was performed to identify a binding partner of Lum. Panels A and B represent potential binding of Kera and Lum to ALK5 (TGFβ type 1 receptor), respectively. ALK5 in green and the GS domain of ALK5 (TGFbR1) in pink. (A) Keratocan interacts via its Leucine Rich Repeat domain with the extracellular domain of ALK5 with low affinity (ΔG = 30.39 kJ/mol). (B) Lum favorably interacts via its C-terminal domain with the GS domain of ALK5 (ΔG = −100 kJ/mol). The LumC domain has an even higher affinity with ALK5 (ΔG of −1086 kJ/mol). (C) GST pull down assay shows in vitro interaction between ALK5 and GST-Lum. ALK5-Flag was co-eluted with GST-Lum, but not GST, suggesting a direct interaction between Lum and ALK5. (D) In vitro interaction between ALK5 and the C-terminal Lumican. Both ALK5-Flag and GST-LumC were visible in lysates incubated with GST and GST-LumC. IP with an anti-flag antibody resulted in a GST positive band in the mixture of GST-LumC 50 and cell lysate, but not in the mixture of GST and lysate, indicating that GST-LumC 50 , but not GST, is co-precipitated with ALK5-flag by anti-flag antibodies. (E) C-terminal of Lum binds to ALK5. ALK5-Flag was co-precipitated with LumC 50 -myc and Lum-myc, but not LumN-myc.
Figure Legend Snippet: Lumican binds to ALK5: in silico analysis and pull down assays. In silico molecular dynamic analysis was performed to identify a binding partner of Lum. Panels A and B represent potential binding of Kera and Lum to ALK5 (TGFβ type 1 receptor), respectively. ALK5 in green and the GS domain of ALK5 (TGFbR1) in pink. (A) Keratocan interacts via its Leucine Rich Repeat domain with the extracellular domain of ALK5 with low affinity (ΔG = 30.39 kJ/mol). (B) Lum favorably interacts via its C-terminal domain with the GS domain of ALK5 (ΔG = −100 kJ/mol). The LumC domain has an even higher affinity with ALK5 (ΔG of −1086 kJ/mol). (C) GST pull down assay shows in vitro interaction between ALK5 and GST-Lum. ALK5-Flag was co-eluted with GST-Lum, but not GST, suggesting a direct interaction between Lum and ALK5. (D) In vitro interaction between ALK5 and the C-terminal Lumican. Both ALK5-Flag and GST-LumC were visible in lysates incubated with GST and GST-LumC. IP with an anti-flag antibody resulted in a GST positive band in the mixture of GST-LumC 50 and cell lysate, but not in the mixture of GST and lysate, indicating that GST-LumC 50 , but not GST, is co-precipitated with ALK5-flag by anti-flag antibodies. (E) C-terminal of Lum binds to ALK5. ALK5-Flag was co-precipitated with LumC 50 -myc and Lum-myc, but not LumN-myc.

Techniques Used: In Silico, Binding Assay, Pull Down Assay, In Vitro, Incubation

Administration of Lum lifts cell cycle suppression at the wound edge. Expression of Ki67, a marker of cells engaged in the cell cycle, was determined by immunostaining with an anti-Ki67 antibody at various time periods following wounding. (A) Images of Ki67 expression pattern Treatment with BM or BM+GST contained few Ki67 positive cells at the wound edge 0.5, 2 and 4 h after wounding but showed an increase in expression at 6 h. Treatment with CM and GST-Lum resulted in many Ki67 positive cells at all time points examined. Scale bar = 50 µm. (B) Graphical representation of the percentage of Ki67 positive cells at the wound edge (average±std, n = 12). (C) Representative images of EdU-labeled cells (cells in S-phase) at the wound edge. Few cells at the wound edge were EdU positive at 6 h and 12 h under the treatment of BM and BM+GST, while many EdU positive cells were seen in cells treated with CM and GST-LumC. Scale bar = 50 µm (D) Graphical representation of the percentage of EdU positive cells at the wound edge (mean±std, n = 4). No significant difference was seen at the 6 h time point. More cells at the wound edge enter S-phase 12 hours after wounding in CM and GST-Lum than those with BM and GST treatment. Statistical significance was analyzed by ANOVA. P value of
Figure Legend Snippet: Administration of Lum lifts cell cycle suppression at the wound edge. Expression of Ki67, a marker of cells engaged in the cell cycle, was determined by immunostaining with an anti-Ki67 antibody at various time periods following wounding. (A) Images of Ki67 expression pattern Treatment with BM or BM+GST contained few Ki67 positive cells at the wound edge 0.5, 2 and 4 h after wounding but showed an increase in expression at 6 h. Treatment with CM and GST-Lum resulted in many Ki67 positive cells at all time points examined. Scale bar = 50 µm. (B) Graphical representation of the percentage of Ki67 positive cells at the wound edge (average±std, n = 12). (C) Representative images of EdU-labeled cells (cells in S-phase) at the wound edge. Few cells at the wound edge were EdU positive at 6 h and 12 h under the treatment of BM and BM+GST, while many EdU positive cells were seen in cells treated with CM and GST-LumC. Scale bar = 50 µm (D) Graphical representation of the percentage of EdU positive cells at the wound edge (mean±std, n = 4). No significant difference was seen at the 6 h time point. More cells at the wound edge enter S-phase 12 hours after wounding in CM and GST-Lum than those with BM and GST treatment. Statistical significance was analyzed by ANOVA. P value of

Techniques Used: Expressing, Marker, Immunostaining, Labeling

69) Product Images from "Corticosteroid-Binding Globulin: Structure-Function Implications from Species Differences"

Article Title: Corticosteroid-Binding Globulin: Structure-Function Implications from Species Differences

Journal: PLoS ONE

doi: 10.1371/journal.pone.0052759

Alignment of reactive center loop sequences of CBG variants and of closely related AAT. The RCL sequence shows a high degree of variance even within closely related proteins. The numbering of residues in the RCL of SERPINs is commonly in relation to the normal cleavage site in AAT between P1 and P1′. Already known cleavage sites are shown with grey boxes. The new cleavage site in human CBG observed in the structure is depicted in green. Introduced mutations in rat CBG-RCL1 through RCL3 are marked by orange boxes. The variant marked with an asterix bears in addition two mutations in the top of β-sheet A deleting a salt-bridge by converting it to amino acids present in human CBG (D323N, R174K). The wild-type protein sequences are annotated in the Uniprot knowledgebase with the following accession codes: rat CBG, P31211; human CBG, P08185; human AAT; P01009. The amino acids in the RCL are numbered following the convention of Schechter and Berger, 1967 [49] .
Figure Legend Snippet: Alignment of reactive center loop sequences of CBG variants and of closely related AAT. The RCL sequence shows a high degree of variance even within closely related proteins. The numbering of residues in the RCL of SERPINs is commonly in relation to the normal cleavage site in AAT between P1 and P1′. Already known cleavage sites are shown with grey boxes. The new cleavage site in human CBG observed in the structure is depicted in green. Introduced mutations in rat CBG-RCL1 through RCL3 are marked by orange boxes. The variant marked with an asterix bears in addition two mutations in the top of β-sheet A deleting a salt-bridge by converting it to amino acids present in human CBG (D323N, R174K). The wild-type protein sequences are annotated in the Uniprot knowledgebase with the following accession codes: rat CBG, P31211; human CBG, P08185; human AAT; P01009. The amino acids in the RCL are numbered following the convention of Schechter and Berger, 1967 [49] .

Techniques Used: Sequencing, Variant Assay

70) Product Images from "Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region"

Article Title: Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA118.003290

Direct SPA-binding data for the WASP GBD and mutant BR variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD BR variants, as appropriate, in each SPA. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 3 .
Figure Legend Snippet: Direct SPA-binding data for the WASP GBD and mutant BR variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD BR variants, as appropriate, in each SPA. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 3 .

Techniques Used: Binding Assay, Mutagenesis, Concentration Assay, Labeling, Incubation, Variant Assay

Binding kinetics for WASP BR mutants measured by bio-layer interferometry. GST fusion proteins were loaded onto anti-GST sensors and dipped alternately into a concentration range of Cdc42·GMPPNP (of at least three different concentrations) and buffer to measure on- and off-rates. A, data for k on , k off , and K d , where n = 3–9 independent experiments, plotted as boxplots showing median and quartile values with data outlying the distribution appearing as dots for all mutants. Statistical significance from WT values is indicated as follows: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001 as analyzed by t test with the false discovery rate controlled by the Benjamini-Hochberg method (analysis performed in R). Note: K225A/K226A value is statistically significantly lower than the WT but not than the other single mutations in the N-terminal triad; therefore, this is most likely a false discovery error. B, raw data from representative experiments. The fitted values from these data are reported in Table 4 .
Figure Legend Snippet: Binding kinetics for WASP BR mutants measured by bio-layer interferometry. GST fusion proteins were loaded onto anti-GST sensors and dipped alternately into a concentration range of Cdc42·GMPPNP (of at least three different concentrations) and buffer to measure on- and off-rates. A, data for k on , k off , and K d , where n = 3–9 independent experiments, plotted as boxplots showing median and quartile values with data outlying the distribution appearing as dots for all mutants. Statistical significance from WT values is indicated as follows: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001 as analyzed by t test with the false discovery rate controlled by the Benjamini-Hochberg method (analysis performed in R). Note: K225A/K226A value is statistically significantly lower than the WT but not than the other single mutations in the N-terminal triad; therefore, this is most likely a false discovery error. B, raw data from representative experiments. The fitted values from these data are reported in Table 4 .

Techniques Used: Binding Assay, Concentration Assay

Direct SPA-binding data for the WASP GBD and mutant variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD variants, as appropriate. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. A, binding of representative mutants in the WASP GBD to Cdc42. B, binding of WASP BR hexa-mutant and C-terminal deletion mutant to Cdc42. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 2 .
Figure Legend Snippet: Direct SPA-binding data for the WASP GBD and mutant variants, with Cdc42. The indicated concentration of [ 3 H]GTP-labeled Cdc42 was incubated with GST-tagged WASP GBD variants, as appropriate. The SPA signal was corrected by subtraction of the background signal from parallel measurements in which the effector protein was omitted. The effect of the concentration of Cdc42 on this corrected SPA signal was fitted to a binding isotherm to give an apparent K d value and the signal at saturating Cdc42 concentrations. The data and curve fits are displayed as a percentage of this maximal signal. A, binding of representative mutants in the WASP GBD to Cdc42. B, binding of WASP BR hexa-mutant and C-terminal deletion mutant to Cdc42. 2–4 experimental replicates were performed for each WASP variant with 12 data points in each. A summary of all the binding data can be found in Table 2 .

Techniques Used: Binding Assay, Mutagenesis, Concentration Assay, Labeling, Incubation, Variant Assay

71) Product Images from "Flotillin-1/Reggie-2 Protein Plays Dual Role in Activation of Receptor-tyrosine Kinase/Mitogen-activated Protein Kinase Signaling *"

Article Title: Flotillin-1/Reggie-2 Protein Plays Dual Role in Activation of Receptor-tyrosine Kinase/Mitogen-activated Protein Kinase Signaling *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.287599

Flotillin-1 functions as a MAP kinase scaffold. A , CRAF was immunoprecipitated ( IP ) from HeLa cells, and the immunoprecipitates were probed for flot-1 (47 kDa) and prohibitin-1 (PHB-1; 30 kDa), which both coprecipitated with CRAF. B , in flotillin-1-GST (75 kDa) pulldown assays, CRAF (74 kDa), MEK1/2 (45/47 kDa), ERK1/2 (42 kDa), and KSR1 (110 kDa) interacted with flot-1. C , purified recombinant flot-1 directly interacted with GST-tagged CRAF, MEK1, and ERK2. D , KSR1 was knocked down with two different shRNAs in HeLa cells. Pulldown experiments with flotillin-1-GST show that CRAF, MEK1/2, and ERK1/2 are capable of binding to flot-1 in the absence of KSR1. In addition, KSR1 was also found in flot-1 pulldown assays from control cells. B–D , Ponceau staining was used to visualize the fusion proteins (marked by an asterisk ) on the blot membranes.
Figure Legend Snippet: Flotillin-1 functions as a MAP kinase scaffold. A , CRAF was immunoprecipitated ( IP ) from HeLa cells, and the immunoprecipitates were probed for flot-1 (47 kDa) and prohibitin-1 (PHB-1; 30 kDa), which both coprecipitated with CRAF. B , in flotillin-1-GST (75 kDa) pulldown assays, CRAF (74 kDa), MEK1/2 (45/47 kDa), ERK1/2 (42 kDa), and KSR1 (110 kDa) interacted with flot-1. C , purified recombinant flot-1 directly interacted with GST-tagged CRAF, MEK1, and ERK2. D , KSR1 was knocked down with two different shRNAs in HeLa cells. Pulldown experiments with flotillin-1-GST show that CRAF, MEK1/2, and ERK1/2 are capable of binding to flot-1 in the absence of KSR1. In addition, KSR1 was also found in flot-1 pulldown assays from control cells. B–D , Ponceau staining was used to visualize the fusion proteins (marked by an asterisk ) on the blot membranes.

Techniques Used: Immunoprecipitation, Purification, Recombinant, Binding Assay, Staining

72) Product Images from "?-Defensin-2 Protein Is a Serum Biomarker for Disease Activity in Psoriasis and Reaches Biologically Relevant Concentrations in Lesional Skin"

Article Title: ?-Defensin-2 Protein Is a Serum Biomarker for Disease Activity in Psoriasis and Reaches Biologically Relevant Concentrations in Lesional Skin

Journal: PLoS ONE

doi: 10.1371/journal.pone.0004725

Analysis of beta-defensin mRNA expression in normal and inflamed human tissues. Quantitative real-time PCR was performed on RNA of normal human tissues (mostly obtained from one individual), purified epidermis from skin biopsies of healthy controls, psoriasis patients and atopic dermatitis patients, and inflamed synovium from rheumatoid arthritis patients. Expression of target genes was normalized to that of RPLP0. For graphical representation all values were expressed relative to hBD-2 in tongue, which was set at unity [34] . Primer sequences and efficiency of amplification are given in supplemental table S1 . For details on normal human tissues see materials and methods . Bars represent mean and SD.
Figure Legend Snippet: Analysis of beta-defensin mRNA expression in normal and inflamed human tissues. Quantitative real-time PCR was performed on RNA of normal human tissues (mostly obtained from one individual), purified epidermis from skin biopsies of healthy controls, psoriasis patients and atopic dermatitis patients, and inflamed synovium from rheumatoid arthritis patients. Expression of target genes was normalized to that of RPLP0. For graphical representation all values were expressed relative to hBD-2 in tongue, which was set at unity [34] . Primer sequences and efficiency of amplification are given in supplemental table S1 . For details on normal human tissues see materials and methods . Bars represent mean and SD.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Purification, Amplification

Correlation between serum hBD-2 protein levels and genomic copy number. Serum hBD-2 protein levels of 70 healthy controls (determined by ELISA) were plotted against the genomic copy number of the beta-defensin repeat on chromosome 8p23, as determined by MAPH, REDVR and PRT. A significant linear correlation was found. Pearson's R = 0.46 and p
Figure Legend Snippet: Correlation between serum hBD-2 protein levels and genomic copy number. Serum hBD-2 protein levels of 70 healthy controls (determined by ELISA) were plotted against the genomic copy number of the beta-defensin repeat on chromosome 8p23, as determined by MAPH, REDVR and PRT. A significant linear correlation was found. Pearson's R = 0.46 and p

Techniques Used: Enzyme-linked Immunosorbent Assay

Correlation between the change in serum hBD-2 concentration and change in clinical score. Serum hBD-2 protein levels of 15 patients for which PASI scores and serum was available on two different occasions over a 6–18 week interval, were plotted against the change in PASI score (ΔPASI). A significant linear correlation was found. Pearson R = 0.74, p
Figure Legend Snippet: Correlation between the change in serum hBD-2 concentration and change in clinical score. Serum hBD-2 protein levels of 15 patients for which PASI scores and serum was available on two different occasions over a 6–18 week interval, were plotted against the change in PASI score (ΔPASI). A significant linear correlation was found. Pearson R = 0.74, p

Techniques Used: Concentration Assay

Correlation between serum hBD-2 protein and PASI score. Serum hBD-2 protein levels of 38 psoriasis patients of varying disease severity were plotted against their PASI score. A significant linear correlation was found. Pearson's R = 0.82, p
Figure Legend Snippet: Correlation between serum hBD-2 protein and PASI score. Serum hBD-2 protein levels of 38 psoriasis patients of varying disease severity were plotted against their PASI score. A significant linear correlation was found. Pearson's R = 0.82, p

Techniques Used:

Induction of hBD-2 protein expression in reconstructed skin by proinflammatory cytokines. Expression of hBD-2 in 3-D reconstructed skin following stimulation with psoriasis-associated cytokines (10 ng/ml IL-1α, 5 ng/ml TNFα and 5 ng/ml IL-6) for 72 hours. Note that without stimulation there is no hBD-2 expression (A), whereas the cytokine mixture induces high expression levels that are secreted into the underlying culture medium (147 ng/ml in 24 h). Part of the hBD-2 protein remains adsorbed to the dermal matrix as witnessed by the staining of structures in the dermis (B). Bar = 100 µm.
Figure Legend Snippet: Induction of hBD-2 protein expression in reconstructed skin by proinflammatory cytokines. Expression of hBD-2 in 3-D reconstructed skin following stimulation with psoriasis-associated cytokines (10 ng/ml IL-1α, 5 ng/ml TNFα and 5 ng/ml IL-6) for 72 hours. Note that without stimulation there is no hBD-2 expression (A), whereas the cytokine mixture induces high expression levels that are secreted into the underlying culture medium (147 ng/ml in 24 h). Part of the hBD-2 protein remains adsorbed to the dermal matrix as witnessed by the staining of structures in the dermis (B). Bar = 100 µm.

Techniques Used: Expressing, Staining

Immunolocalization of hBD-2 in human epithelia. Immunohistochemical staining of normal human tissues (tongue, plantar skin and trunk skin, A–C) with a polyclonal rabbit antiserum against recombinant hBD-2. Note that protein data largely follow the mRNA data demonstrating the absence in normal skin, low expression in tongue and plantar skin. Bar = 100 µm. Control sections stained with pre-immune serum were negative (not shown).
Figure Legend Snippet: Immunolocalization of hBD-2 in human epithelia. Immunohistochemical staining of normal human tissues (tongue, plantar skin and trunk skin, A–C) with a polyclonal rabbit antiserum against recombinant hBD-2. Note that protein data largely follow the mRNA data demonstrating the absence in normal skin, low expression in tongue and plantar skin. Bar = 100 µm. Control sections stained with pre-immune serum were negative (not shown).

Techniques Used: Immunohistochemistry, Staining, Recombinant, Expressing

73) Product Images from "The Erv41–Erv46 complex serves as a retrograde receptor to retrieve escaped ER proteins"

Article Title: The Erv41–Erv46 complex serves as a retrograde receptor to retrieve escaped ER proteins

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201408024

Erv41–Erv46 complex binds to Gls1 in a pH-dependent manner in vitro. (A and B) GST (A)- or GST-Gls1 (B)–bound glutathione agarose beads were incubated with cell lysate from microsomes overexpressing Erv41–Erv46 complex (CBY978) in different pH buffers (pH 5.5, 6.0, 6.5, 7.0, and 7.5) at 4°C. After washing, proteins bound to the beads were eluted and resolved on 10.5% polyacrylamide gels and immunoblotted for Gls1, Erv41, Erv46, Yet3, and GST. (C) Eluted samples were compared on a single blot for levels of GST-Gls1, Erv46, and GST. Figure panels were assembled from single immunoblots, and the molecular mass markers shown indicate relative positions across neighboring strips.
Figure Legend Snippet: Erv41–Erv46 complex binds to Gls1 in a pH-dependent manner in vitro. (A and B) GST (A)- or GST-Gls1 (B)–bound glutathione agarose beads were incubated with cell lysate from microsomes overexpressing Erv41–Erv46 complex (CBY978) in different pH buffers (pH 5.5, 6.0, 6.5, 7.0, and 7.5) at 4°C. After washing, proteins bound to the beads were eluted and resolved on 10.5% polyacrylamide gels and immunoblotted for Gls1, Erv41, Erv46, Yet3, and GST. (C) Eluted samples were compared on a single blot for levels of GST-Gls1, Erv46, and GST. Figure panels were assembled from single immunoblots, and the molecular mass markers shown indicate relative positions across neighboring strips.

Techniques Used: In Vitro, Incubation, Western Blot

74) Product Images from "The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter ▿"

Article Title: The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter ▿

Journal:

doi: 10.1128/JVI.01356-08

The ankyrin repeat of Bcl3 mediates Tax binding and represses recruitment of p300 to the HTLV-1 promoter. (A) Schematic diagram of full-length GST-Bcl3 (GST-Bcl3 wt ) and the truncated protein carrying the ARD (GST-Bcl3 ARD). (B) GST pull-down assay was
Figure Legend Snippet: The ankyrin repeat of Bcl3 mediates Tax binding and represses recruitment of p300 to the HTLV-1 promoter. (A) Schematic diagram of full-length GST-Bcl3 (GST-Bcl3 wt ) and the truncated protein carrying the ARD (GST-Bcl3 ARD). (B) GST pull-down assay was

Techniques Used: Binding Assay, Pull Down Assay

75) Product Images from "The Hematopoietic Transcription Factor AML1 (RUNX1) Is Negatively Regulated by the Cell Cycle Protein Cyclin D3"

Article Title: The Hematopoietic Transcription Factor AML1 (RUNX1) Is Negatively Regulated by the Cell Cycle Protein Cyclin D3

Journal:

doi: 10.1128/MCB.25.23.10205-10219.2005

Inhibitory effect of cyclin D3 on AML1 transactivation. A. CV-1 cells were transfected with 6 μg of the luciferase reporter p(Mono) 4 TK81-luc, 600 ng of pCMV5-CBFβ, and 30 ng of pRL-CMV in every transfection. Six hundred ng of pCMV5-AML1
Figure Legend Snippet: Inhibitory effect of cyclin D3 on AML1 transactivation. A. CV-1 cells were transfected with 6 μg of the luciferase reporter p(Mono) 4 TK81-luc, 600 ng of pCMV5-CBFβ, and 30 ng of pRL-CMV in every transfection. Six hundred ng of pCMV5-AML1

Techniques Used: Transfection, Luciferase

Cyclin D interacts with AML1 in vivo. A. Schematic depiction of HA-tagged AML1 proteins and GST-AML1 fusion proteins used in the experiments. runt, Runt homology domain; AD, activation domain. B. HA-tagged AML1 proteins were expressed in the presence
Figure Legend Snippet: Cyclin D interacts with AML1 in vivo. A. Schematic depiction of HA-tagged AML1 proteins and GST-AML1 fusion proteins used in the experiments. runt, Runt homology domain; AD, activation domain. B. HA-tagged AML1 proteins were expressed in the presence

Techniques Used: In Vivo, Activation Assay

Cyclin D3 competes with CBFβ for AML1 association and disrupts AML1 DNA binding. A. Competitive association between cyclin D3 and CBFβ with AML1. 293T cells were cotransfected with 5 μg of pRSV-cyclin D3 and pcDNA6-HA-AML1, with
Figure Legend Snippet: Cyclin D3 competes with CBFβ for AML1 association and disrupts AML1 DNA binding. A. Competitive association between cyclin D3 and CBFβ with AML1. 293T cells were cotransfected with 5 μg of pRSV-cyclin D3 and pcDNA6-HA-AML1, with

Techniques Used: Binding Assay

Models of the effect of cyclin D on the regulation of AML1 function. A. Cyclin D is able to compete with CBFβ for AML1 binding. The loss of association with CBFβ reduces AML1 transactivation activity through the lowering of its ability
Figure Legend Snippet: Models of the effect of cyclin D on the regulation of AML1 function. A. Cyclin D is able to compete with CBFβ for AML1 binding. The loss of association with CBFβ reduces AML1 transactivation activity through the lowering of its ability

Techniques Used: Binding Assay, Activity Assay

In vitro association of AML1 with cyclin D proteins. A. Cyclin D3 protein was produced by an in vitro transcription/translation system and used for in vitro pull-down assays with bacterially produced GST, GST-Rb, and GST-AML1(88-381) immobilized on glutathione-agarose
Figure Legend Snippet: In vitro association of AML1 with cyclin D proteins. A. Cyclin D3 protein was produced by an in vitro transcription/translation system and used for in vitro pull-down assays with bacterially produced GST, GST-Rb, and GST-AML1(88-381) immobilized on glutathione-agarose

Techniques Used: In Vitro, Produced

The presence of C/EBPα partially relieves cyclin D3 inhibition on AML1. A. K562 cells were transfected with the indicated expression constructs as described for Fig. with or without 2 μg of pCMV5-C/EBPα in the presence
Figure Legend Snippet: The presence of C/EBPα partially relieves cyclin D3 inhibition on AML1. A. K562 cells were transfected with the indicated expression constructs as described for Fig. with or without 2 μg of pCMV5-C/EBPα in the presence

Techniques Used: Inhibition, Transfection, Expressing, Construct

Cyclin D proteins are associated with AML1 in vivo. A. 293T cells were transfected with AML1 and cyclin D expression constructs as indicated in the figure. Cell lysates were immunoprecipitated (IP) with anti-HA antibodies (α-HA). The immunoblot
Figure Legend Snippet: Cyclin D proteins are associated with AML1 in vivo. A. 293T cells were transfected with AML1 and cyclin D expression constructs as indicated in the figure. Cell lysates were immunoprecipitated (IP) with anti-HA antibodies (α-HA). The immunoblot

Techniques Used: In Vivo, Transfection, Expressing, Construct, Immunoprecipitation

Effect of AML1 on cyclin D3 kinase activity. A. 293T cells were transfected with 1 μg of pRc-CMV-cyclin D3-HA and 0, 1, or 3 μg of pCMV5-AML1. Two-hundred-microgram samples of protein extracts were subjected to anti-HA immunoprecipitation.
Figure Legend Snippet: Effect of AML1 on cyclin D3 kinase activity. A. 293T cells were transfected with 1 μg of pRc-CMV-cyclin D3-HA and 0, 1, or 3 μg of pCMV5-AML1. Two-hundred-microgram samples of protein extracts were subjected to anti-HA immunoprecipitation.

Techniques Used: Activity Assay, Transfection, Immunoprecipitation

HDAC activity is not required for cyclin D3 inhibition of AML1. K562 cells were transfected with 10 μg of p(Mono) 4 TK81-luc, 2 μg of pCMV5-CBFβ with or without 2 μg of pCMV5-AML1, and/or 4 μg of pRcCMV-cyclin D3-HA.
Figure Legend Snippet: HDAC activity is not required for cyclin D3 inhibition of AML1. K562 cells were transfected with 10 μg of p(Mono) 4 TK81-luc, 2 μg of pCMV5-CBFβ with or without 2 μg of pCMV5-AML1, and/or 4 μg of pRcCMV-cyclin D3-HA.

Techniques Used: Activity Assay, Inhibition, Transfection

Related Articles

Clone Assay:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Paragraph title: Characterization of genomic DNA: Southern hybridization, cloning, sequencing and sequence analysis ... Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences). .. GST fusion proteins were purified using glutathione-Sepharose beads (Amersham Biosciences) according to the manufacturer's protocol.

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: .. Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen). .. Proteins were purified by glutathione-Sepharose 4B (Amersham Biosciences) (S. japonicum GST-tagged) or on Ni-affinity (Qiagen, Milan, Italy) (N-6His-tagged) column chromatography according to manufacturer's instructions.

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: The PCR-amplified DNA was treated with BamH I/EcoR I and cloned into the corresponding sites of pGEX-4T3 to generate pGEX-4T-3-CD81 LEL. .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Article Title: Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region
Article Snippet: .. Protein expression constructs All WASP–GBD peptides were expressed as GST fusion proteins in pGEX-2T (Amersham Biosciences) with residues 201–321 of WASP cloned into BamH1 and EcoR1 sites of the multicloning site ( ). .. The construct expressing Cdc42 Δ7 Q61L ( ) has been described previously.

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains. .. The murine BTK SH3 domain (E215-S275), BTK SH2 domain (W281-S378), and BTK SH3-SH2 domain (E215-S378) were used for HDX-MS experiments and cloned into the pGEX-4T vector (GE Healthcare).

Amplification:

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: To construct a plasmid expressing the large extracellular loop of CD81 (CD81 LEL), a part of CD81 gene corresponding to nucleotides 337–603 was amplified from a human liver cDNA library with a primer pair 5′- CGCGGATCCTTTGTCAACAAGGACCAGATCG-3′ (forward) and 5′-CCGGAATCC TCACTTCCCGGAGAAGAGGTCAT-3′ (reverse). .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

DNA Synthesis:

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains. .. All mutations were introduced using the site-directed mutagenesis kit (Agilent Technologies) and verified by sequencing at the Iowa State University DNA synthesis and sequencing facility.

Synthesized:

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: 5′-GATCGGATCCGCAGGATCAGCCATGGTAGA-3′ ORF encoding human GSTP1 was synthesized by RT-PCR from HaCaT cells RNA using “First strand cDNA synthesis kit” (Amersham Biosciences, Piscataway, NJ) with the following specific primers: GSTP1 FW . .. Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen).

Autoradiography:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

Article Title: The Mediator subunit MED1/TRAP220 is required for optimal glucocorticoid receptor-mediated transcription activation
Article Snippet: In vitro protein binding assay The assay was performed with GST-fusion proteins (5 µg) immobilized on glutathione-Sepharose beads (Amersham Pharmacia) and in vitro -translated 35 S-labeled proteins (TNT kit, Promega). .. After incubating at 4°C for 4 h and washing with buffer A (20 mM Tris, pH 7.9, 10% glycerol, 0.2 mM EDTA, 300 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1% NP-40), bound proteins were eluted by boiling in SDS sample buffer, resolved by SDS-PAGE and visualized by autoradiography.

Construct:

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: Paragraph title: Plasmids, constructs and primers ... Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen).

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: To construct a plasmid expressing the large extracellular loop of CD81 (CD81 LEL), a part of CD81 gene corresponding to nucleotides 337–603 was amplified from a human liver cDNA library with a primer pair 5′- CGCGGATCCTTTGTCAACAAGGACCAGATCG-3′ (forward) and 5′-CCGGAATCC TCACTTCCCGGAGAAGAGGTCAT-3′ (reverse). .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Article Title: Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region
Article Snippet: .. Protein expression constructs All WASP–GBD peptides were expressed as GST fusion proteins in pGEX-2T (Amersham Biosciences) with residues 201–321 of WASP cloned into BamH1 and EcoR1 sites of the multicloning site ( ). .. The construct expressing Cdc42 Δ7 Q61L ( ) has been described previously.

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: Paragraph title: Constructs ... The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains.

Electrophoresis:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: .. Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity. .. The Mbo I purified band (called GuMbo I family) was used as a probe and hybridized under conditions of high stringency, using the non-radioactive ECL method (Enhanced Chemioluminescent Kit, Amersham Bioscences) while the Dde I 350-bp isolated band (called GuDde I family) was cloned in the One Shot Top 10 competent E. coli (Invitrogen Life Technologies, Carlsbad, CA, USA) using the Ready To Go pUC18 BAP+ligase kit (Amersham Biotech, Inc., Uppsala, Sweden) and following the manufacturer's recommendations.

Incubation:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: 600 µg of the whole-cell extracts were incubated with anti-Pim-1 or -3 antibodies for 2 h at +4°C. .. For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare).

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences). .. Reciprocally, to pull down the endogenous integrin β5 subunit, 200 μg COS-7 cell lysate was mixed with 5 μg purified GST–hPAK4 KD fusion protein in RIPA buffer and incubated overnight at 4°C.

Expressing:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Expression of GST fusion proteins was induced with 100 µM isopropyl-β-D-thiogalactosidase (IPTG) for 5 hours at 37°C. .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences). .. GST fusion proteins were purified using glutathione-Sepharose beads (Amersham Biosciences) according to the manufacturer's protocol.

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: Paragraph title: Protein Expression and Purification ... GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Article Title: Bond swapping from a charge cloud allows flexible coordination of upstream signals through WASP: Multiple regulatory roles for the WASP basic region
Article Snippet: .. Protein expression constructs All WASP–GBD peptides were expressed as GST fusion proteins in pGEX-2T (Amersham Biosciences) with residues 201–321 of WASP cloned into BamH1 and EcoR1 sites of the multicloning site ( ). .. The construct expressing Cdc42 Δ7 Q61L ( ) has been described previously.

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: All kinase domain containing constructs carry a Y617P mutation for soluble protein expression in bacteria. .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains.

Western Blot:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

Transformation Assay:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Following sequence verification, DNA was transformed into AB1899 or DH5α strain of Escherichia coli . .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Over Expression:

Article Title: Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes
Article Snippet: Paragraph title: Protein overexpression and purification ... The purification was performed using glutathione sepharose 4B according to the manufacturer’s instruction (Amersham Biosciences, Freiburg, Germany).

Kinase Assay:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: Paragraph title: Immunoprecipitation and kinase assay ... For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare).

Derivative Assay:

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: The C-terminally 6X-His tagged wild-type or kinase inactive (K430R) BTK Linker Kinase Domain (L-KD, K382-S659) was cloned into the pET28a vector (EMD Millipore) with a vector derived Glycine residue at the N-terminus after the start Methionine. .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains.

Hybridization:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Paragraph title: Characterization of genomic DNA: Southern hybridization, cloning, sequencing and sequence analysis ... Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

Transfection:

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: For testing the in vivo association of PAK4-ΔIBD mutant with integrin αvβ5, COS-7 cells were transfected with Flag–PAK4 and Flag–PAK4-ΔIBD. .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences).

Southern Blot:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Briefly, approximately 7 µg of genomic DNA was digested with 14 U of Mbo I or Dde I at 37°C for 16 h and subsequently analyzed by gel-electrophoresis using 1% agarose gels containing ethidium bromide (0.5 µg/mL) and TAE buffer (80.04 M Tris-acetate, 0.002 M EDTA) at 25 V for 16 h. The genomic organization of the isolated repetitive fragment was determined using Southern blot hybridization. .. Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

Immunoprecipitation:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: Paragraph title: Immunoprecipitation and kinase assay ... For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare).

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: Precleared lysates (100 μg) were immunoprecipitated by 6 μl ascites fluid of anti–integrin αvβ5 mAb P1F6 (Life Technology) or rabbit IgG or α-Rab pAb (C-19; Santa Cruz Biotechnology, Inc.) followed by Western blot analysis using anti-Flag tag mAb M2 (Sigma). .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences).

Polymerase Chain Reaction:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Hsp40HPD→AAA , Hsp401-80 , Hsp401-80 HPD→AAA mutants were prepared by subcloning restriction or PCR fragments into the bacterial expression plasmid pGEX-KG. .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: The PCR-amplified DNA was treated with BamH I/EcoR I and cloned into the corresponding sites of pGEX-4T3 to generate pGEX-4T-3-CD81 LEL. .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: 5′-GATCGGATCCGCAGGATCAGCCATGGTAGA-3′ ORF encoding human GSTP1 was synthesized by RT-PCR from HaCaT cells RNA using “First strand cDNA synthesis kit” (Amersham Biosciences, Piscataway, NJ) with the following specific primers: GSTP1 FW . .. Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen).

Binding Assay:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences). ..

Article Title: Novel DNA Aptamers for Parkinson’s Disease Treatment Inhibit α-Synuclein Aggregation and Facilitate its Degradation
Article Snippet: Then the fusion protein GST-α-syn was purified on glutathione-sepharose 4B according to the manufacturer’s instructions (GE Healthcare, Boston, MA). .. The purified GST-fusion proteins were desalted on Vivaspin 6 column from GE Healthcare, followed by dialysis into binding buffer (PBS, 1 mM MgCI2 , pH 7.4) to remove the free glutathione.

Nucleic Acid Electrophoresis:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Briefly, approximately 7 µg of genomic DNA was digested with 14 U of Mbo I or Dde I at 37°C for 16 h and subsequently analyzed by gel-electrophoresis using 1% agarose gels containing ethidium bromide (0.5 µg/mL) and TAE buffer (80.04 M Tris-acetate, 0.002 M EDTA) at 25 V for 16 h. The genomic organization of the isolated repetitive fragment was determined using Southern blot hybridization. .. Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

In Vivo:

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: For testing the in vivo association of PAK4-ΔIBD mutant with integrin αvβ5, COS-7 cells were transfected with Flag–PAK4 and Flag–PAK4-ΔIBD. .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences).

Mutagenesis:

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: For testing the in vivo association of PAK4-ΔIBD mutant with integrin αvβ5, COS-7 cells were transfected with Flag–PAK4 and Flag–PAK4-ΔIBD. .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences).

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: All kinase domain containing constructs carry a Y617P mutation for soluble protein expression in bacteria. .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains.

Isolation:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Briefly, approximately 7 µg of genomic DNA was digested with 14 U of Mbo I or Dde I at 37°C for 16 h and subsequently analyzed by gel-electrophoresis using 1% agarose gels containing ethidium bromide (0.5 µg/mL) and TAE buffer (80.04 M Tris-acetate, 0.002 M EDTA) at 25 V for 16 h. The genomic organization of the isolated repetitive fragment was determined using Southern blot hybridization. .. Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

Subcloning:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Hsp40HPD→AAA , Hsp401-80 , Hsp401-80 HPD→AAA mutants were prepared by subcloning restriction or PCR fragments into the bacterial expression plasmid pGEX-KG. .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Purification:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity. .. The Mbo I purified band (called GuMbo I family) was used as a probe and hybridized under conditions of high stringency, using the non-radioactive ECL method (Enhanced Chemioluminescent Kit, Amersham Bioscences) while the Dde I 350-bp isolated band (called GuDde I family) was cloned in the One Shot Top 10 competent E. coli (Invitrogen Life Technologies, Carlsbad, CA, USA) using the Ready To Go pUC18 BAP+ligase kit (Amersham Biotech, Inc., Uppsala, Sweden) and following the manufacturer's recommendations.

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: .. For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences). .. GST fusion proteins were purified using glutathione-Sepharose beads (Amersham Biosciences) according to the manufacturer's protocol.

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen). .. Proteins were purified by glutathione-Sepharose 4B (Amersham Biosciences) (S. japonicum GST-tagged) or on Ni-affinity (Qiagen, Milan, Italy) (N-6His-tagged) column chromatography according to manufacturer's instructions.

Article Title: C-terminal Phosphorylation of LKB1 Is Not Required for Regulation of AMP-activated Protein Kinase, BRSK1, BRSK2, or Cell Cycle Arrest *
Article Snippet: .. After purification on glutathione-Sepharose, we obtained equal yields of full-length and truncated LKB1L , and both co-purified with FLAG-STRADα and myc -MO25α as expected ( ). ..

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: Paragraph title: Protein Expression and Purification ... GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Article Title: Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes
Article Snippet: .. The purification was performed using glutathione sepharose 4B according to the manufacturer’s instruction (Amersham Biosciences, Freiburg, Germany). ..

Article Title: Novel DNA Aptamers for Parkinson’s Disease Treatment Inhibit α-Synuclein Aggregation and Facilitate its Degradation
Article Snippet: .. Then the fusion protein GST-α-syn was purified on glutathione-sepharose 4B according to the manufacturer’s instructions (GE Healthcare, Boston, MA). .. The purified GST-fusion proteins were desalted on Vivaspin 6 column from GE Healthcare, followed by dialysis into binding buffer (PBS, 1 mM MgCI2 , pH 7.4) to remove the free glutathione.

Sequencing:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: Paragraph title: Characterization of genomic DNA: Southern hybridization, cloning, sequencing and sequence analysis ... Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity.

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Following sequence verification, DNA was transformed into AB1899 or DH5α strain of Escherichia coli . .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains. .. All mutations were introduced using the site-directed mutagenesis kit (Agilent Technologies) and verified by sequencing at the Iowa State University DNA synthesis and sequencing facility.

Recombinant:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences). .. The concentrations of recombinant GST fusion proteins were estimated by Coomassie blue staining of SDS-polyacrylamide gels using bovine serum albumin (BSA) as a standard.

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: .. Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen). .. Proteins were purified by glutathione-Sepharose 4B (Amersham Biosciences) (S. japonicum GST-tagged) or on Ni-affinity (Qiagen, Milan, Italy) (N-6His-tagged) column chromatography according to manufacturer's instructions.

Staining:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Equal loading of proteins was confirmed with Colloidal Coomassie staining or Ponceau.

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences). .. The concentrations of recombinant GST fusion proteins were estimated by Coomassie blue staining of SDS-polyacrylamide gels using bovine serum albumin (BSA) as a standard.

cDNA Library Assay:

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: To construct a plasmid expressing the large extracellular loop of CD81 (CD81 LEL), a part of CD81 gene corresponding to nucleotides 337–603 was amplified from a human liver cDNA library with a primer pair 5′- CGCGGATCCTTTGTCAACAAGGACCAGATCG-3′ (forward) and 5′-CCGGAATCC TCACTTCCCGGAGAAGAGGTCAT-3′ (reverse). .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

SDS Page:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

Article Title: The Mediator subunit MED1/TRAP220 is required for optimal glucocorticoid receptor-mediated transcription activation
Article Snippet: In vitro protein binding assay The assay was performed with GST-fusion proteins (5 µg) immobilized on glutathione-Sepharose beads (Amersham Pharmacia) and in vitro -translated 35 S-labeled proteins (TNT kit, Promega). .. After incubating at 4°C for 4 h and washing with buffer A (20 mM Tris, pH 7.9, 10% glycerol, 0.2 mM EDTA, 300 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1% NP-40), bound proteins were eluted by boiling in SDS sample buffer, resolved by SDS-PAGE and visualized by autoradiography.

Plasmid Preparation:

Article Title: Hsp40 Couples with the CSP? Chaperone Complex upon Induction of the Heat Shock Response
Article Snippet: Hsp40HPD→AAA , Hsp401-80 , Hsp401-80 HPD→AAA mutants were prepared by subcloning restriction or PCR fragments into the bacterial expression plasmid pGEX-KG. .. Bacteria were suspended in PBS, 0.05% (v/v) Tween 20, 2 mM EDTA, 0.5 mM PMSF and 0.1% (v/v) β-mercaptoethanol and lysed by two passages through a French press (Spectronics Instruments Inc.) GST fusion proteins were recovered by binding to glutathione-sepharose beads (GE Healthcare Biosciences).

Article Title: p21-activated kinase 4 interacts with integrin ?v?5 and regulates ?v?5-mediated cell migration
Article Snippet: .. To make GST fusion proteins, PAK4 KD (aa 324–591) and β5 (aa 753–799) cytoplasmic domains were cloned separately into the GST fusion protein expression vector pGEM-1λT (Amersham Biosciences). .. GST fusion proteins were purified using glutathione-Sepharose beads (Amersham Biosciences) according to the manufacturer's protocol.

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: 5′GGGG ACCACTTTGTACAAGAAAGCTGGGT CTCACTGTTTCCCGTTGCCATTGATGGG-3′ To facilitate GSTP1 cloning into the Gateway Entry vector pDONR201 (Invitrogen, Carlsbad, CA), AttB1 and AttB2 tails (indicated in boldface) were added to the 5′ end of both FW and RV primers. .. Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen).

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: To construct a plasmid expressing the large extracellular loop of CD81 (CD81 LEL), a part of CD81 gene corresponding to nucleotides 337–603 was amplified from a human liver cDNA library with a primer pair 5′- CGCGGATCCTTTGTCAACAAGGACCAGATCG-3′ (forward) and 5′-CCGGAATCC TCACTTCCCGGAGAAGAGGTCAT-3′ (reverse). .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs.

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains. .. The murine BTK SH3 domain (E215-S275), BTK SH2 domain (W281-S378), and BTK SH3-SH2 domain (E215-S378) were used for HDX-MS experiments and cloned into the pGEX-4T vector (GE Healthcare).

Article Title: Novel DNA Aptamers for Parkinson’s Disease Treatment Inhibit α-Synuclein Aggregation and Facilitate its Degradation
Article Snippet: Preparation of α-Synuclein The α-syn gene was subcloned into the pGEX-4T-1 vector, and the fusion protein GST-α-syn was expressed in Escherichia coli BL21 (DE3), which was induced by the addition of 0.2 mM isopropyl-1-thiob-D-galactopyranoside (IPTG) at 28°C. .. Then the fusion protein GST-α-syn was purified on glutathione-sepharose 4B according to the manufacturer’s instructions (GE Healthcare, Boston, MA).

Positron Emission Tomography:

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: The BTK PHTH domain (M1-K176, murine) and BTK PHTH-PRR-SH3 domain (M1-S270, murine) were cloned into the pET 20b vector (EMD Millipore) with an N-terminal 6X-His and GB1 tag followed by a Factor Xa cleavage site. .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains.

Agarose Gel Electrophoresis:

Article Title: Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae)
Article Snippet: .. Genomic DNA was digested with different restriction enzymes (Mbo I and Dde I), separated by electrophoresis in 1.5% agarose gel, and the DNA fragments were transferred onto a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden) by capillarity. .. The Mbo I purified band (called GuMbo I family) was used as a probe and hybridized under conditions of high stringency, using the non-radioactive ECL method (Enhanced Chemioluminescent Kit, Amersham Bioscences) while the Dde I 350-bp isolated band (called GuDde I family) was cloned in the One Shot Top 10 competent E. coli (Invitrogen Life Technologies, Carlsbad, CA, USA) using the Ready To Go pUC18 BAP+ligase kit (Amersham Biotech, Inc., Uppsala, Sweden) and following the manufacturer's recommendations.

In Vitro:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: .. For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

Article Title: The Mediator subunit MED1/TRAP220 is required for optimal glucocorticoid receptor-mediated transcription activation
Article Snippet: .. In vitro protein binding assay The assay was performed with GST-fusion proteins (5 µg) immobilized on glutathione-Sepharose beads (Amersham Pharmacia) and in vitro -translated 35 S-labeled proteins (TNT kit, Promega). .. After incubating at 4°C for 4 h and washing with buffer A (20 mM Tris, pH 7.9, 10% glycerol, 0.2 mM EDTA, 300 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1% NP-40), bound proteins were eluted by boiling in SDS sample buffer, resolved by SDS-PAGE and visualized by autoradiography.

Column Chromatography:

Article Title: Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival
Article Snippet: Recombinant HPV-16 E7 and human pRb were expressed in BL21 E. coli cells as S. japonicum GST fusions (pGEX-4T-1 and pGEX-2T, respectively; Amersham Biosciences, Piscataway, NJ), whereas human GSTP1 was expressed in BL21 E. coli cells as an N-terminally 6His-tagged protein (pDEST17; Gateway cloning system, Invitrogen). .. Proteins were purified by glutathione-Sepharose 4B (Amersham Biosciences) (S. japonicum GST-tagged) or on Ni-affinity (Qiagen, Milan, Italy) (N-6His-tagged) column chromatography according to manufacturer's instructions.

Protein Binding:

Article Title: The Mediator subunit MED1/TRAP220 is required for optimal glucocorticoid receptor-mediated transcription activation
Article Snippet: .. In vitro protein binding assay The assay was performed with GST-fusion proteins (5 µg) immobilized on glutathione-Sepharose beads (Amersham Pharmacia) and in vitro -translated 35 S-labeled proteins (TNT kit, Promega). .. After incubating at 4°C for 4 h and washing with buffer A (20 mM Tris, pH 7.9, 10% glycerol, 0.2 mM EDTA, 300 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1% NP-40), bound proteins were eluted by boiling in SDS sample buffer, resolved by SDS-PAGE and visualized by autoradiography.

Nuclear Magnetic Resonance:

Article Title: Achieving a Graded Immune Response: BTK Adopts Range of Active/Inactive Conformations Dictated by Multiple Interdomain Contacts
Article Snippet: .. The BTK SH3 domain (L216-S275, human) and BTK SH2 domain (T270-T387, human) (NMR resonances previously assigned ( ; )) were cloned into the pGEX-2T vector (GE Healthcare) to facilitate NMR assignments of the murine forms of these domains. .. The murine BTK SH3 domain (E215-S275), BTK SH2 domain (W281-S378), and BTK SH3-SH2 domain (E215-S378) were used for HDX-MS experiments and cloned into the pGEX-4T vector (GE Healthcare).

Produced:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: .. For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare). .. Kinase reactions were performed in the presence of 2 µCi (0.074 MBq) of [32 P] adenosine triphosphate (ATP) for 30 minutes at 30°C and stopped by boiling in Laemmli buffer for 10 min. Phosphorylated proteins were resolved in 8% SDS-PAGE, transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany) and analysed by autoradiography and Western blotting when needed.

FLAG-tag:

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs. .. PCR-amplified DNAs were treated with Nhe1/Hind3 and cloned into the corresponding sites of p425-GPD containing 6xHis and FLAG tag to construct p425-GPD-E2.

Lysis:

Article Title: KSHV Reactivation from Latency Requires Pim-1 and Pim-3 Kinases to Inactivate the Latency-Associated Nuclear Antigen LANA
Article Snippet: Immunocomplexes were coupled to protein-A or G Sepharose beads for an additional 1.5 hour at 4°C and washed 3 times with the lysis buffer followed by one wash with the kinase buffer (20 mM Tris-HCl, pH 7.5; 50 mM KCl; 7.5 mM MgCl2 ; 1 mM DTT; 25 mM ß-glycerophosphate; leupeptin 2 µg/ml; pepstatin 2 µg/ml; and aprotinin 1.5 µg/ml). .. For in vitro kinase assays, wild-type and kinase-dead Pim-1 proteins produced in bacteria as GST-fusion proteins were purified and cleaved by Precission protease (GE Healthcare).

Article Title: Discovery of Cellular Proteins Required for the Early Steps of HCV Infection Using Integrative Genomics
Article Snippet: .. GST-fusion proteins were allowed to bind to glutathione Sepharose 4B resin (Amersham-Pharmacia Biotech) in lysis buffer at 4°C for 2 hrs. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    GE Healthcare gst
    Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) <t>GST–syndapin</t> I, II, and III specifically precipitate <t>GFP-ProSAP1</t> expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).
    Gst, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst/product/GE Healthcare
    Average 99 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    gst - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    GE Healthcare gst syndapin i sh3 domain
    <t>Syndapin</t> I depletion reduces the frequencies of mEPSCs. (A and F) Sample traces of whole-cell patch clamp recordings of mEPSCs from individual primary rat hippocampal neurons transfected at DIV 12 and analyzed 48 h later. (B) The frequency of mEPSCs was reduced in syndapin I RNAi neurons when compared with pRNAT and scrambled RNAi, respectively (B and D), whereas the mEPSC amplitudes did not differ (C and E). (F–J) Syndapin I RNAi rescue experiments with coexpression of mCherry–syndapin I and mutants thereof showing that both <t>SH3</t> domain protein interactions and F-BAR domain–mediated membrane interactions are crucial for syndapin I functions in postsynaptic neurotransmission. *, P
    Gst Syndapin I Sh3 Domain, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst syndapin i sh3 domain/product/GE Healthcare
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst syndapin i sh3 domain - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    92
    GE Healthcare expression vector pgex 2t
    Recombinant HMT antigens used for immunizations. a Recombinant human and porcine GST-HMT fusion proteins cloned in the bacterial expression vector <t>pGEX-2T.</t> b 12.5 % Silver-stained polyacrylamide gel of the purified human ( lane 1 ) and porcine ( lane 3 ) GST-HMT fusion proteins used for the immunization of mice and the HMT and GST products resulting from cleavage with thrombin protease ( lanes 2 and 4 ). The sizes of molecular weight markers ( M ) are given on the left in kilodalton. c Sequence alignment and percent sequence identity of the HMT proteins from man, pig, mouse and rat obtained with the NCBI Constrained-based Multiple Alignment Tool ( www.ncbi.nlm.nih.gov/tools/cobalt/cobalt.cgi?link_loc=BlastHomeLink ). Residues identical in all four proteins are shaded black , residues identical in three proteins are shaded gray , and residues that have been shown to interact with histamine and S-adenosylhomocysteine in human HMT [ 7 ] are shaded red (indicated by plus symbol on top) and blue (indicated by hash on top), respectively. Antigenicity plots of human ( d ) and porcine ( e ) HMT produced with the BepiPred Linear Epitope Prediction Tool ( www.tools.immuneepitope.org/bcell ) [ 32 ] show similar predicted B-cell epitopes ( yellow peaks on top of the threshold line with reference to amino acid positions) for both protein sequences
    Expression Vector Pgex 2t, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pgex 2t/product/GE Healthcare
    Average 92 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    expression vector pgex 2t - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    95
    GE Healthcare gst vector control
    <t>Drp1</t> binds to the Arp2/3 complex in a p-Drp1S600–dependent manner. ( A ) Cultured podocytes with empty vector, FLAG-tagged WT Drp1 (WT), FLAG-tagged Drp1S600A (SA), and FLAG-tagged Drp1S600D (SD) were used. Cells were also transiently transfected with GFP-Arp3. Top panels show anti-FLAG IP material and immunoblotting against GFP and FLAG. Bottom panels show the WCLs. ( B ) Bacterially expressed <t>GST,</t> GST-Drp1S600A, GST-S600D, and GST-S600 WT proteins on GST-sepharose were mixed with purified Arp2/3 complex in the GST-pulldown assay. Coomassie staining of SDS-PAGE gel is shown on the right. Top 2 left blots show recovered materials that were immunoblotted to detect the binding of Arp2 and Arp3 to Drp1. Third blot on the left shows immunoblotting with p-Drp1S600 (p-Drp1), illustrating good mimicry of the phosphorylation epitope by the aspartate mutation. The bottom blot on the left shows immunoblotting for the total level of input Drp1 from the GST-pulldown assay. ( C ) Top panels show control podocyte cells cultured under HG conditions after being treated with vehicle, nontargeting (NT) shRNA, shRNA-1 against Arp3, or shRNA-2 against Arp3. Cells were fixed and stained for mitochondria with an antibody against Tomm20. Mitochondria are shown in grayscale. Bottom panels show podocytes expressing Drp1S600D cultured under NG conditions after being treated as indicated above and stained for mitochondria as before. Mitochondria are shown in grayscale. Scale bars: 25 μm. ( D ) Quantification of mitochondrial length and AR for native podocytes for the images shown in C (top). ( E ) Quantification of mitochondrial length and AR for podocytes stably expressing Drp1S600D for the images shown in C (bottom). Representative images are from a sampling of 3 to 5 separate cell cultures. **** P
    Gst Vector Control, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst vector control/product/GE Healthcare
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst vector control - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: Binding Assay, Mutagenesis, In Vitro, Purification

    Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: In Vivo, Immunolabeling, Mouse Assay, Transfection, Staining, Marker

    Syndapin I depletion reduces the frequencies of mEPSCs. (A and F) Sample traces of whole-cell patch clamp recordings of mEPSCs from individual primary rat hippocampal neurons transfected at DIV 12 and analyzed 48 h later. (B) The frequency of mEPSCs was reduced in syndapin I RNAi neurons when compared with pRNAT and scrambled RNAi, respectively (B and D), whereas the mEPSC amplitudes did not differ (C and E). (F–J) Syndapin I RNAi rescue experiments with coexpression of mCherry–syndapin I and mutants thereof showing that both SH3 domain protein interactions and F-BAR domain–mediated membrane interactions are crucial for syndapin I functions in postsynaptic neurotransmission. *, P

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Syndapin I depletion reduces the frequencies of mEPSCs. (A and F) Sample traces of whole-cell patch clamp recordings of mEPSCs from individual primary rat hippocampal neurons transfected at DIV 12 and analyzed 48 h later. (B) The frequency of mEPSCs was reduced in syndapin I RNAi neurons when compared with pRNAT and scrambled RNAi, respectively (B and D), whereas the mEPSC amplitudes did not differ (C and E). (F–J) Syndapin I RNAi rescue experiments with coexpression of mCherry–syndapin I and mutants thereof showing that both SH3 domain protein interactions and F-BAR domain–mediated membrane interactions are crucial for syndapin I functions in postsynaptic neurotransmission. *, P

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: Patch Clamp, Transfection

    Impaired spine and synapse formation upon syndapin I loss-of-function is caused by a loss of SH3 domain-dependent syndapin I functions in the postsynaptic compartment. (A and H) PM-mCherry signals of dendrites of neurons transfected as indicated at DIV 12 and fixed at DIV 14. Bars, 5 µm. (B–D) Quantitative analyses of general spine density (B) and of individual morphology groups (C and D) upon syndapin I RNAi. (E) Anti–PSD-95 (postsynaptic) and anti–synapsin 1 (presynaptic) immunolabeling along dendrites of transfected neurons. Bar, 5 µm. (F and G) Quantitation of PSD-95– (F) and synapsin 1–positive puncta (G) spatially overlapping with transfected neurons. (I–K) Quantitative analyses of general spine density (I) and of individual morphology groups (J and K) of syndapin I–depleted cells expressing Sdp I ΔSH3 compared with pRNAT control cells transfected in parallel. **, P

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Impaired spine and synapse formation upon syndapin I loss-of-function is caused by a loss of SH3 domain-dependent syndapin I functions in the postsynaptic compartment. (A and H) PM-mCherry signals of dendrites of neurons transfected as indicated at DIV 12 and fixed at DIV 14. Bars, 5 µm. (B–D) Quantitative analyses of general spine density (B) and of individual morphology groups (C and D) upon syndapin I RNAi. (E) Anti–PSD-95 (postsynaptic) and anti–synapsin 1 (presynaptic) immunolabeling along dendrites of transfected neurons. Bar, 5 µm. (F and G) Quantitation of PSD-95– (F) and synapsin 1–positive puncta (G) spatially overlapping with transfected neurons. (I–K) Quantitative analyses of general spine density (I) and of individual morphology groups (J and K) of syndapin I–depleted cells expressing Sdp I ΔSH3 compared with pRNAT control cells transfected in parallel. **, P

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: Transfection, Immunolabeling, Quantitation Assay, Expressing

    ProSAP1-mediated functions in spine head enlargement rely on complex formation with syndapin I. (A–G) Absence of ProSAP1-mediated spine head enlargement upon coexpression of the syndapin I SH3 domain blocking the syndapin I binding site of ProSAP1 (A and B), upon use of ProSAP1* (C–E), and upon concomitant syndapin I RNAi (F and G), respectively. (A, D, and F) Representative images of neurons transfected as indicated (cotransfected with PM-mCherry for morphological analysis). (B, E, and G) Quantification of head width of mushroom spines. (C) Coprecipitation studies with immobilized syndapin I and Abp1 SH3 domains and GFP-ProSAP1 versus GFP-ProSAP1* showing specific disruption of syndapin I interaction. (H–J) Quantitative analysis of head width of mushroom spines. Neither syndapin I RNAi nor overexpression of syndapin I modulate head sizes of mushroom spines. (J) ProSAP RNAi causes a decrease in head width not seen upon syndapin I RNAi and not rescued by syndapin I coexpression. *, P

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: ProSAP1-mediated functions in spine head enlargement rely on complex formation with syndapin I. (A–G) Absence of ProSAP1-mediated spine head enlargement upon coexpression of the syndapin I SH3 domain blocking the syndapin I binding site of ProSAP1 (A and B), upon use of ProSAP1* (C–E), and upon concomitant syndapin I RNAi (F and G), respectively. (A, D, and F) Representative images of neurons transfected as indicated (cotransfected with PM-mCherry for morphological analysis). (B, E, and G) Quantification of head width of mushroom spines. (C) Coprecipitation studies with immobilized syndapin I and Abp1 SH3 domains and GFP-ProSAP1 versus GFP-ProSAP1* showing specific disruption of syndapin I interaction. (H–J) Quantitative analysis of head width of mushroom spines. Neither syndapin I RNAi nor overexpression of syndapin I modulate head sizes of mushroom spines. (J) ProSAP RNAi causes a decrease in head width not seen upon syndapin I RNAi and not rescued by syndapin I coexpression. *, P

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: Blocking Assay, Binding Assay, Transfection, Over Expression

    Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Identification of ProSAP1/Shank2 and ProSAP2/Shank3 as postsynaptically enriched Syndapin I interaction partners. (A) GST–syndapin I, II, and III specifically precipitate GFP-ProSAP1 expressed in HEK293 cells. (B) Coprecipitation analysis with GST–syndapin I and deletion mutants thereof. The SH3 domain is critical and sufficient for binding. A mutant SH3 domain (P434L; SH3*) did not bind. White lines indicate lanes omitted from blots (B and F). (C) Syndapin I SH3 precipitates GFP-ProSAP1 and GFP-ProSAP2 but not GFP-Shank1. (D) Alignment of +++APPPP motifs in ProSAP1 (NCBI Protein database accession no. NP_001004133 ), ProSAP2 (accession no. NP_067708 ), and Cobl (accession no. NP_766084 ; conserved amino acids are highlighted) and of corresponding residues in Shank1 (accession no. Q9WV48 ). (E) Scheme of rat ProSAP1b and deletion mutants used. Indicated are the N-terminal PDZ domain (medium grey), several proline-rich motifs (dark grey lines), and the C-terminal SAM (sterile alpha motif) domain (light grey). (F) GST–syndapin I precipitated GFP-ProSAP1 1–235 but none of the other ProSAP1 deletion mutants. (G) GFP fusion peptides encompassing the +++APPPP motifs of ProSAP1, ProSAP2, and Cobl associated with syndapin I SH3. (H and I) RKKAPPPPKR to GAGAAAAAAG mutation (amino acids 141–150 in ProSAP1; ProSAP1 1–235*) disrupted direct binding of ProSAP1 to syndapin I in both in vitro reconstitutions with purified proteins (H) and in coprecipitation analyses (I).

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: Binding Assay, Mutagenesis, In Vitro, Purification

    Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.

    Journal: The Journal of Cell Biology

    Article Title: ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function

    doi: 10.1083/jcb.201307088

    Figure Lengend Snippet: Syndapin I interacts with ProSAP1 in vivo. (A) Specific coimmunoprecipitation of GFP-ProSAP1 with anti-FLAG antibodies immunoprecipitating FLAG–syndapin I. (B) Consistently, FLAG–syndapin I (arrowhead) was specifically coimmunoprecipitated with GFP-ProSAP1. (C) Immobilized GST–syndapin I SH3 specifically precipitated endogenous ProSAP1 from mouse brain cytosol (MBC). (D) Endogenous syndapin I was precipitated from rat brain preparations (RBC) with immobilized GST-ProSAP1 139–153 comprising the RKKAPPPP motif. (E–H) Syndapin I constitutively targeted to outer mitochondrial membranes recruited GFP-ProSAP1 (E) and GFP-ProSAP1 1–235 (F) in intact COS-7 cells, whereas Sdp I ΔSH3 did not (G and H). Bars, 10 µm. (I) Syndapin I and ProSAP1 immunolabeling of brain sections from adult mice. Colocalization in synapses of mossy fibers with dendrites of pyramidal cells in the stratum lucidum in the hippocampus CA3 is shown. Blue signal in merge, DAPI. Insets, 2.5-fold enlargements of the boxed areas. Bars, 25 µm. (J) Immunolabeling of neurons transfected with Xpress–syndapin I at DIV 12 and stained for syndapin I, ProSAP1, and the dendritic marker MAP2 at DIV 14. Insets, 1.5-fold enlargements of boxed areas. Bar, 10 µm. (K) Endogenous syndapin I colocalized with ProSAP1 and synapsin 1 (DIV 21). Insets, twofold enlargements of boxed areas. Bars: (main panels) 5 µm; (insets) 2 µm.

    Article Snippet: DNA constructs Plasmids encoding for GFP (pEGFP-C1; Takara Bio Inc.)-, GST (pGEX-2T; GE Healthcare)-, Xpress (pcDNA 3.1/HisC; Invitrogen)-, and FLAG-tagged (pCMV-Tag2b; Agilent Technologies) full-length syndapin I as well as for GST–syndapin I SH3 domain (aa 376–441, pGEX-2T; aa 378–441, pGEX-5X-1; GE Healthcare), GST–syndapin I SH3P434L (GST-Sdp I SH3*; aa 376–441, pGEX-2T), and GST–syndapin IΔSH3 (aa 1–382, pGEX-2T) were described in , , and , respectively.

    Techniques: In Vivo, Immunolabeling, Mouse Assay, Transfection, Staining, Marker

    Recombinant HMT antigens used for immunizations. a Recombinant human and porcine GST-HMT fusion proteins cloned in the bacterial expression vector pGEX-2T. b 12.5 % Silver-stained polyacrylamide gel of the purified human ( lane 1 ) and porcine ( lane 3 ) GST-HMT fusion proteins used for the immunization of mice and the HMT and GST products resulting from cleavage with thrombin protease ( lanes 2 and 4 ). The sizes of molecular weight markers ( M ) are given on the left in kilodalton. c Sequence alignment and percent sequence identity of the HMT proteins from man, pig, mouse and rat obtained with the NCBI Constrained-based Multiple Alignment Tool ( www.ncbi.nlm.nih.gov/tools/cobalt/cobalt.cgi?link_loc=BlastHomeLink ). Residues identical in all four proteins are shaded black , residues identical in three proteins are shaded gray , and residues that have been shown to interact with histamine and S-adenosylhomocysteine in human HMT [ 7 ] are shaded red (indicated by plus symbol on top) and blue (indicated by hash on top), respectively. Antigenicity plots of human ( d ) and porcine ( e ) HMT produced with the BepiPred Linear Epitope Prediction Tool ( www.tools.immuneepitope.org/bcell ) [ 32 ] show similar predicted B-cell epitopes ( yellow peaks on top of the threshold line with reference to amino acid positions) for both protein sequences

    Journal: Inflammation Research

    Article Title: Monoclonal antibodies for human and porcine histamine N-methyltransferase (HMT) facilitate protein expression and localization studies

    doi: 10.1007/s00011-016-0987-1

    Figure Lengend Snippet: Recombinant HMT antigens used for immunizations. a Recombinant human and porcine GST-HMT fusion proteins cloned in the bacterial expression vector pGEX-2T. b 12.5 % Silver-stained polyacrylamide gel of the purified human ( lane 1 ) and porcine ( lane 3 ) GST-HMT fusion proteins used for the immunization of mice and the HMT and GST products resulting from cleavage with thrombin protease ( lanes 2 and 4 ). The sizes of molecular weight markers ( M ) are given on the left in kilodalton. c Sequence alignment and percent sequence identity of the HMT proteins from man, pig, mouse and rat obtained with the NCBI Constrained-based Multiple Alignment Tool ( www.ncbi.nlm.nih.gov/tools/cobalt/cobalt.cgi?link_loc=BlastHomeLink ). Residues identical in all four proteins are shaded black , residues identical in three proteins are shaded gray , and residues that have been shown to interact with histamine and S-adenosylhomocysteine in human HMT [ 7 ] are shaded red (indicated by plus symbol on top) and blue (indicated by hash on top), respectively. Antigenicity plots of human ( d ) and porcine ( e ) HMT produced with the BepiPred Linear Epitope Prediction Tool ( www.tools.immuneepitope.org/bcell ) [ 32 ] show similar predicted B-cell epitopes ( yellow peaks on top of the threshold line with reference to amino acid positions) for both protein sequences

    Article Snippet: Preparation of recombinant HMT proteins Full-length human and porcine HMT cDNAs [ , , ] were amplified by PCR with specific primers from total human and porcine kidney cDNA, respectively, and cloned in frame into the bacterial expression vector pGEX-2T (GE Healthcare, Vienna, Austria).

    Techniques: Recombinant, HMT Assay, Clone Assay, Expressing, Plasmid Preparation, Staining, Purification, Mouse Assay, Molecular Weight, Sequencing, Produced

    Drp1 binds to the Arp2/3 complex in a p-Drp1S600–dependent manner. ( A ) Cultured podocytes with empty vector, FLAG-tagged WT Drp1 (WT), FLAG-tagged Drp1S600A (SA), and FLAG-tagged Drp1S600D (SD) were used. Cells were also transiently transfected with GFP-Arp3. Top panels show anti-FLAG IP material and immunoblotting against GFP and FLAG. Bottom panels show the WCLs. ( B ) Bacterially expressed GST, GST-Drp1S600A, GST-S600D, and GST-S600 WT proteins on GST-sepharose were mixed with purified Arp2/3 complex in the GST-pulldown assay. Coomassie staining of SDS-PAGE gel is shown on the right. Top 2 left blots show recovered materials that were immunoblotted to detect the binding of Arp2 and Arp3 to Drp1. Third blot on the left shows immunoblotting with p-Drp1S600 (p-Drp1), illustrating good mimicry of the phosphorylation epitope by the aspartate mutation. The bottom blot on the left shows immunoblotting for the total level of input Drp1 from the GST-pulldown assay. ( C ) Top panels show control podocyte cells cultured under HG conditions after being treated with vehicle, nontargeting (NT) shRNA, shRNA-1 against Arp3, or shRNA-2 against Arp3. Cells were fixed and stained for mitochondria with an antibody against Tomm20. Mitochondria are shown in grayscale. Bottom panels show podocytes expressing Drp1S600D cultured under NG conditions after being treated as indicated above and stained for mitochondria as before. Mitochondria are shown in grayscale. Scale bars: 25 μm. ( D ) Quantification of mitochondrial length and AR for native podocytes for the images shown in C (top). ( E ) Quantification of mitochondrial length and AR for podocytes stably expressing Drp1S600D for the images shown in C (bottom). Representative images are from a sampling of 3 to 5 separate cell cultures. **** P

    Journal: The Journal of Clinical Investigation

    Article Title: Drp1S600 phosphorylation regulates mitochondrial fission and progression of nephropathy in diabetic mice

    doi: 10.1172/JCI127277

    Figure Lengend Snippet: Drp1 binds to the Arp2/3 complex in a p-Drp1S600–dependent manner. ( A ) Cultured podocytes with empty vector, FLAG-tagged WT Drp1 (WT), FLAG-tagged Drp1S600A (SA), and FLAG-tagged Drp1S600D (SD) were used. Cells were also transiently transfected with GFP-Arp3. Top panels show anti-FLAG IP material and immunoblotting against GFP and FLAG. Bottom panels show the WCLs. ( B ) Bacterially expressed GST, GST-Drp1S600A, GST-S600D, and GST-S600 WT proteins on GST-sepharose were mixed with purified Arp2/3 complex in the GST-pulldown assay. Coomassie staining of SDS-PAGE gel is shown on the right. Top 2 left blots show recovered materials that were immunoblotted to detect the binding of Arp2 and Arp3 to Drp1. Third blot on the left shows immunoblotting with p-Drp1S600 (p-Drp1), illustrating good mimicry of the phosphorylation epitope by the aspartate mutation. The bottom blot on the left shows immunoblotting for the total level of input Drp1 from the GST-pulldown assay. ( C ) Top panels show control podocyte cells cultured under HG conditions after being treated with vehicle, nontargeting (NT) shRNA, shRNA-1 against Arp3, or shRNA-2 against Arp3. Cells were fixed and stained for mitochondria with an antibody against Tomm20. Mitochondria are shown in grayscale. Bottom panels show podocytes expressing Drp1S600D cultured under NG conditions after being treated as indicated above and stained for mitochondria as before. Mitochondria are shown in grayscale. Scale bars: 25 μm. ( D ) Quantification of mitochondrial length and AR for native podocytes for the images shown in C (top). ( E ) Quantification of mitochondrial length and AR for podocytes stably expressing Drp1S600D for the images shown in C (bottom). Representative images are from a sampling of 3 to 5 separate cell cultures. **** P

    Article Snippet: Briefly, GST-tagged Drp1 isoforms (WT, S600A, and S600D) or GST vector control (pGEX-2T, GE Healthcare) were transformed into BL21 (DE3) (New England BioLabs) and induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (MilliporeSigma, catalog I6758) at 25°C overnight (18 h).

    Techniques: Cell Culture, Plasmid Preparation, Transfection, Purification, GST Pulldown Assay, Staining, SDS Page, Binding Assay, Mutagenesis, shRNA, Expressing, Stable Transfection, Sampling