pgem t easy vector promega  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pGEM T Easy Vector Systems
    Description:
    PCR cloning vectors with 3 options for insert excision
    Catalog Number:
    a1360
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR PCR Cloning
    Buy from Supplier


    Structured Review

    Promega pgem t easy vector promega
    PCR cloning vectors with 3 options for insert excision
    https://www.bioz.com/result/pgem t easy vector promega/product/Promega
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector promega - by Bioz Stars, 2020-08
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Amplification:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Agarose Gel Electrophoresis:

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Purification:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Polymerase Chain Reaction:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
    Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Activity Assay:

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    DNA Sequencing:

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Sequencing:

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Plasmid Preparation:

    Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
    Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

    Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
    Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

    Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
    Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

    Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
    Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

    Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
    Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
    Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Promega pgem t easy cloning vector
    (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through <t>PCR</t> driven by primer pair malG _F/ malG _R (C+, probe positive control represented by <t>pGEM-T-</t> malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.
    Pgem T Easy Cloning Vector, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 282 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy cloning vector/product/Promega
    Average 93 stars, based on 282 article reviews
    Price from $9.99 to $1999.99
    pgem t easy cloning vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Promega pax2 1 expression vector
    Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), <t>pax2.1</t> −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24
    Pax2 1 Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pax2 1 expression vector/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pax2 1 expression vector - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Promega β globin genes
    Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and <t>β-globin</t> primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.
    β Globin Genes, supplied by Promega, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β globin genes/product/Promega
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β globin genes - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    99
    Promega pgem t easy vector
    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of <t>vlhA</t> promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of <t>pGEM-T</t> Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.
    Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 6915 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 99 stars, based on 6915 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through PCR driven by primer pair malG _F/ malG _R (C+, probe positive control represented by pGEM-T- malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.

    Journal: Applied and Environmental Microbiology

    Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale

    doi: 10.1128/AEM.03123-18

    Figure Lengend Snippet: (A) Southern blotting of EcoRI-digested total DNA from FD-C-infected and FD-D-infected and healthy (H) periwinkles probed with a DIG-labeled malG gene amplicon obtained through PCR driven by primer pair malG _F/ malG _R (C+, probe positive control represented by pGEM-T- malG1 plasmid). (B) Electrophoresis separation of amplicons obtained following PCR of total DNA from FD-C-infected and FD-D-infected periwinkles with copy-specific primer pairs (002 and 005), according to the draft genome of FD92, and from healthy periwinkle. *, nonspecific PCR product.

    Article Snippet: In the case of mixed infections (presence of double peaks in the analyzed pherograms from the sequencing of the original PCR amplicon), purified PCR products were ligated into pGEM-T easy cloning vector following the manufacturer's instructions (pGEM-T clone kit; Promega, Madison, WI) and transformed into Escherichia coli DH5α competent cells by heat shock.

    Techniques: Southern Blot, Infection, Labeling, Amplification, Polymerase Chain Reaction, Positive Control, Plasmid Preparation, Electrophoresis

    Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), pax2.1 −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Expression of fadd is down-regulated in noi mutant zebrafish. ( A–F ) fadd expression in wild-type (wt), pax2.1 −/− coloboma mutant ( noi ) and lamb1 −/− coloboma mutant ( gup ). Gene expression tested at either 24 (24

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Expressing, Mutagenesis

    Rescue of the pax2.1 -deficient phenotype by mRNA injection. ( A – E ) Wild-type embryos (wt) were injected with pax2.1 mRNA. ( F – J ) Uninjected pax2.1 -deficient (mt) embryos ( K – O ) pax2.1 -deficient embryos injected with pax2.1 mRNA. (

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Rescue of the pax2.1 -deficient phenotype by mRNA injection. ( A – E ) Wild-type embryos (wt) were injected with pax2.1 mRNA. ( F – J ) Uninjected pax2.1 -deficient (mt) embryos ( K – O ) pax2.1 -deficient embryos injected with pax2.1 mRNA. (

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Injection

    Pax2.1 binds to the fadd promoter. ( A ) EMSA using fadd oligonucleotide probe containing the second pax2 -binding site. Fadd probe bound to the pax2.1 protein (lane 2), which was displaced by unlabelled competitor (lane 3) and in the presence of pax2 antibody

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Pax2.1 binds to the fadd promoter. ( A ) EMSA using fadd oligonucleotide probe containing the second pax2 -binding site. Fadd probe bound to the pax2.1 protein (lane 2), which was displaced by unlabelled competitor (lane 3) and in the presence of pax2 antibody

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Binding Assay

    pax2.1 responsive elements in the fadd promoter. ( A ) Diagram at top depicts symbols used for transcription factor-binding sites. p, pax2.1 site; v, vax2 site; rxr, rxr site. Hatched box, exon 1 of fadd . L, luciferase gene. Reporter constructs transfected

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: pax2.1 responsive elements in the fadd promoter. ( A ) Diagram at top depicts symbols used for transcription factor-binding sites. p, pax2.1 site; v, vax2 site; rxr, rxr site. Hatched box, exon 1 of fadd . L, luciferase gene. Reporter constructs transfected

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Binding Assay, Luciferase, Construct, Transfection

    Spatiotemporal RIP3 localization and rescue of eye phenotype using necrostatin-1. ( A – C ) RIP3 immunohistochemistry (red) in wild-type (wt) eyes counterstained with DAPI. ( D and E ) High-level RIP3 labelling in pax2.1 -deficient eyes (mt). White arrow

    Journal: Human Molecular Genetics

    Article Title: Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development

    doi: 10.1093/hmg/dds056

    Figure Lengend Snippet: Spatiotemporal RIP3 localization and rescue of eye phenotype using necrostatin-1. ( A – C ) RIP3 immunohistochemistry (red) in wild-type (wt) eyes counterstained with DAPI. ( D and E ) High-level RIP3 labelling in pax2.1 -deficient eyes (mt). White arrow

    Article Snippet: Full-length zebrafish pax2.1 protein was synthesized by in vitro translation from a pax2.1 expression vector (pGEM-T Easy) using the TNT T7-coupled reticulocyte lysate system (Promega).

    Techniques: Immunohistochemistry

    Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and β-globin primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: Fractionation of VSV-infected 293T cells. 293T cells were infected with VSV at different MOI (0.0001 to 0.1) and incubated for 16 hr. The nuclear and cytoplasmic fractions were separated and subjected to real-time PCR using the VSV-N (left panel) and β-globin primers (right panel). The DNA copy number per cell was estimated using the VSV N gene or β-globin gene in the control plasmid and is indicated on the axis. The means ± SE of two independent experiments performed in duplicate are shown.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Fractionation, Infection, Incubation, Real-time Polymerase Chain Reaction, Plasmid Preparation

    LINE-1 transduction of the NP-2 cell line and its effect on VSV DNA formation. (a) LINE-1 transduction of the NP-2 cell line. The LINE-1 ORF1p and β-actin levels in the 293T, NP-2, NP-2/LINE-1 (L1.2), and NP-2/LINE-1 (L1.2 ORF2mut) cells were examined via Western blot using the anti-ORF1p IgY antibody. The ORF1p protein was observed at a molecular weight of ~41 kDa. The membrane was re-probed with an anti-β-actin antibody. The size marker at 38 kDa is indicated. Note that cropped western blots are shown and that full-length images are presented in the supplementary information . (b) The effect of LINE-1 transduction on VSV DNA production. The cells described above were infected with VSV, and the cell lysates were prepared. Real-time PCR was performed with either the N478-F/N681-R or β-globin primer pair. In addition, the VSV progeny produced by these cells were titrated and the VSV N mRNA expression levels were compared among these cells.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: LINE-1 transduction of the NP-2 cell line and its effect on VSV DNA formation. (a) LINE-1 transduction of the NP-2 cell line. The LINE-1 ORF1p and β-actin levels in the 293T, NP-2, NP-2/LINE-1 (L1.2), and NP-2/LINE-1 (L1.2 ORF2mut) cells were examined via Western blot using the anti-ORF1p IgY antibody. The ORF1p protein was observed at a molecular weight of ~41 kDa. The membrane was re-probed with an anti-β-actin antibody. The size marker at 38 kDa is indicated. Note that cropped western blots are shown and that full-length images are presented in the supplementary information . (b) The effect of LINE-1 transduction on VSV DNA production. The cells described above were infected with VSV, and the cell lysates were prepared. Real-time PCR was performed with either the N478-F/N681-R or β-globin primer pair. In addition, the VSV progeny produced by these cells were titrated and the VSV N mRNA expression levels were compared among these cells.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Transduction, Western Blot, Molecular Weight, Marker, Infection, Real-time Polymerase Chain Reaction, Produced, Expressing

    Cell-based differences in VSV DNA production. Various human cells were infected with VSV at an MOI of 0.1. The DNA was extracted 16 hr later and subjected to PCR amplification. Real-time PCR was performed using the N478-F/N681-R or β-globin primer pair. The copy numbers of the VSV N and β-globin genes in each cell line are shown in closed and open bars, respectively. The arrows indicate that the copy number per cell was below the detection limit. The positive cells are ordered according to the VSV N DNA level, followed by the VSV DNA-negative adherent cells. Subsequently, the VSV DNA-negative suspension cells are arranged in alphabetical order. The means ± SE of two independent experiments performed in duplicate are shown.

    Journal: Scientific Reports

    Article Title: Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    doi: 10.1038/srep05074

    Figure Lengend Snippet: Cell-based differences in VSV DNA production. Various human cells were infected with VSV at an MOI of 0.1. The DNA was extracted 16 hr later and subjected to PCR amplification. Real-time PCR was performed using the N478-F/N681-R or β-globin primer pair. The copy numbers of the VSV N and β-globin genes in each cell line are shown in closed and open bars, respectively. The arrows indicate that the copy number per cell was below the detection limit. The positive cells are ordered according to the VSV N DNA level, followed by the VSV DNA-negative adherent cells. Subsequently, the VSV DNA-negative suspension cells are arranged in alphabetical order. The means ± SE of two independent experiments performed in duplicate are shown.

    Article Snippet: The copy number of each product was estimated using standard curves that were obtained using serial dilutions of the plasmids containing the VSV N and β-globin genes (pGEM®-T Easy vector) (Promega).

    Techniques: Infection, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.

    Journal: PLoS ONE

    Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics

    doi: 10.1371/journal.pone.0194528

    Figure Lengend Snippet: Construction of pKS-VOTL plasmid. (A) Organisation of spo0B operon in B . subtilis and putative obg operon in M . synoviae has been shown. Putative –10 promoter region, transcription start site, ribosome binding site (RBS) of vlhA promoter region, and initiation codon for vlhA gene have been indicated. Length (bp) of each CDS is indicated inside the arrows. Identified stem loop structures in B . subtilis spo0B operon and putative stem loop in M . synoviae ‘ obg operon’ have also been indicated. (B) Schematic presentation of splicing by overlap extension (SOE) PCR to join vlhA gene promoter with obg CDS. Using PCR#1 and PCR#2, vlhA promoter (solid lines) and obg CDS (dotted lines) were amplified using indicated primers. Intermediate products with overlapping fragments (shown by horizontal bars) from both PCRs were amplified by SOE-PCR (PCR#3) using primers vlhA-ExtF and obg-ExtR. (C) Agarose gel electrophoresis of amplification products of vlhA promoter region PCR, obg CDS PCR and SOE-PCR. MW, DNA molecular weight marker (PCR Marker, Sigma, Missouri, USA). (D) Final product of SOE-PCR was first cloned at T-site of pGEM-T Easy Vector and then Pst I- Sac II fragment containing vlhA - obg was inserted between Pst I and Sac II sites of pBluescript II KS (+) vector. Apa I- Sal I restriction fragment containing LoriC and tetM , from pMAS-LoriC plasmid, was cloned at respective sites in pBluescript II KS (+) vector, harboring vlhA - obg , to generate pKS-VOTL plasmid.

    Article Snippet: Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia).

    Techniques: Plasmid Preparation, Binding Assay, Overlap Extension Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Molecular Weight, Marker, Clone Assay