Structured Review

TaKaRa pgad gh
The matrix protein of VSV interacts with LMP2. (A) cDNAs encoding pre-LMP2, mature LMP2, and the 20-amino-acid N-terminal propeptide were constructed in <t>pGAD</t> and used in <t>Y2H</t> assays against a pLEX VSV M construct. The empty pGAD (AD) or pLEX (LEX BD) vector was used as a negative control. The interaction was evaluated by quantification of β-galactosidase activity in liquid yeast cultures as described in the Materials and Methods section. Bars represent standard deviations of the mean from three independent experiments performed in triplicate. *, P < 0.05 compared to the control. (B) Coimmunoprecipitation of M and LMP2. N2A cells were transfected or not transfected (Non TF) for 24 h with plasmids carrying pre-LMP2-myc, myc-pre-LMP2, myc-mature-LMP2, or myc-dystonin as a negative control and then infected with VSV (4 h; MOI, 3) before preparation of cell lysates. Following immunoprecipitation with an anti-M antibody or anti-myc antibody 9E10, cell extracts (inputs) and immune complexes (immunoprecipitates [IP]) were separated by SDS-PAGE and analyzed by Western blotting (WB) using anti-myc antibody 9E10 or anti-M antibody to reveal the presence of the different myc-LMP2 and myc-dystonin constructs and M. Non Inf, noninfected. (C) N2A cells were transfected with plasmids carrying myc-tagged versions of VSV M, CHAV M, SVCV M, and LMP2-HA, followed by immunoprecipitation with an anti-HA antibody. The immunoprecipitates were analyzed by Western blotting using a myc-specific antibody to reveal the presence of VSV M.
Pgad Gh, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgad gh/product/TaKaRa
Average 87 stars, based on 16 article reviews
Price from $9.99 to $1999.99
pgad gh - by Bioz Stars, 2019-10
87/100 stars

Images

1) Product Images from "Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2"

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2

Journal:

doi: 10.1128/JVI.01753-15

The matrix protein of VSV interacts with LMP2. (A) cDNAs encoding pre-LMP2, mature LMP2, and the 20-amino-acid N-terminal propeptide were constructed in pGAD and used in Y2H assays against a pLEX VSV M construct. The empty pGAD (AD) or pLEX (LEX BD) vector was used as a negative control. The interaction was evaluated by quantification of β-galactosidase activity in liquid yeast cultures as described in the Materials and Methods section. Bars represent standard deviations of the mean from three independent experiments performed in triplicate. *, P < 0.05 compared to the control. (B) Coimmunoprecipitation of M and LMP2. N2A cells were transfected or not transfected (Non TF) for 24 h with plasmids carrying pre-LMP2-myc, myc-pre-LMP2, myc-mature-LMP2, or myc-dystonin as a negative control and then infected with VSV (4 h; MOI, 3) before preparation of cell lysates. Following immunoprecipitation with an anti-M antibody or anti-myc antibody 9E10, cell extracts (inputs) and immune complexes (immunoprecipitates [IP]) were separated by SDS-PAGE and analyzed by Western blotting (WB) using anti-myc antibody 9E10 or anti-M antibody to reveal the presence of the different myc-LMP2 and myc-dystonin constructs and M. Non Inf, noninfected. (C) N2A cells were transfected with plasmids carrying myc-tagged versions of VSV M, CHAV M, SVCV M, and LMP2-HA, followed by immunoprecipitation with an anti-HA antibody. The immunoprecipitates were analyzed by Western blotting using a myc-specific antibody to reveal the presence of VSV M.
Figure Legend Snippet: The matrix protein of VSV interacts with LMP2. (A) cDNAs encoding pre-LMP2, mature LMP2, and the 20-amino-acid N-terminal propeptide were constructed in pGAD and used in Y2H assays against a pLEX VSV M construct. The empty pGAD (AD) or pLEX (LEX BD) vector was used as a negative control. The interaction was evaluated by quantification of β-galactosidase activity in liquid yeast cultures as described in the Materials and Methods section. Bars represent standard deviations of the mean from three independent experiments performed in triplicate. *, P < 0.05 compared to the control. (B) Coimmunoprecipitation of M and LMP2. N2A cells were transfected or not transfected (Non TF) for 24 h with plasmids carrying pre-LMP2-myc, myc-pre-LMP2, myc-mature-LMP2, or myc-dystonin as a negative control and then infected with VSV (4 h; MOI, 3) before preparation of cell lysates. Following immunoprecipitation with an anti-M antibody or anti-myc antibody 9E10, cell extracts (inputs) and immune complexes (immunoprecipitates [IP]) were separated by SDS-PAGE and analyzed by Western blotting (WB) using anti-myc antibody 9E10 or anti-M antibody to reveal the presence of the different myc-LMP2 and myc-dystonin constructs and M. Non Inf, noninfected. (C) N2A cells were transfected with plasmids carrying myc-tagged versions of VSV M, CHAV M, SVCV M, and LMP2-HA, followed by immunoprecipitation with an anti-HA antibody. The immunoprecipitates were analyzed by Western blotting using a myc-specific antibody to reveal the presence of VSV M.

Techniques Used: Construct, Plasmid Preparation, Negative Control, Activity Assay, Transfection, Infection, Immunoprecipitation, SDS Page, Western Blot, Hemagglutination Assay

Related Articles

Clone Assay:

Article Title: Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages
Article Snippet: In order to verify physical interactions among CBLs and CIPKs in a non-angiosperm plant, we cloned the CDS of each full-length CBL and CIPK transcript identified in Physcomitrella and tested interactions among PpCBLs and PpCIPKs in yeast two-hybrid (Y2H) assays using the yeast strain AH109 (Clontech Inc.). .. The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech). .. These vectors were transformed into yeast cells using the G-Biosciences FastYeast Transformation Kit and used to express CBL and CIPK fusions to the DNA-binding domain (BD) and activation domain (AD) of a split transcription factor.

Article Title: Live-Cell Imaging Reveals Multiple Interactions between Epstein-Barr Virus Nuclear Antigen 1 and Cellular Chromatin during Interphase and Mitosis
Article Snippet: A premade HeLa cell random cDNA library fused with GAL4 AD in pGAD-GH (Clontech) was used. .. The transformed yeasts were selected on agar plates with a double (−Leu/−Trp) or a triple (−Leu/−Trp/−His) dropout of the essential amino acids.

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: For yeast two-hybrid assays, full-length human COMMD1 cDNA was subcloned in pDNR3 (Clontech, BD Biosciences, San Jose, CA, U.S.A.) and subsequently subcloned in pLP-GBKT7 and pLP-GADT7 using the creator cloning kit (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: Biochemical characterization of androgen receptor-interacting protein 4
Article Snippet: A Gal4 fusion to full-length wild-type ARIP4 was used to screen a human HeLa cDNA library in pGAD-GH (Clontech) according to the manufacturer's instructions. .. A Gal4 fusion to full-length wild-type ARIP4 was used to screen a human HeLa cDNA library in pGAD-GH (Clontech) according to the manufacturer's instructions.

Article Title: Hrs regulates multivesicular body formation via ESCRT recruitment to endosomes
Article Snippet: The cells were first transfected with siRNA for 3 d, then the cells were replated, and the transfection was repeated for another 3 d. .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (CLONTECH Laboratories, Inc.) as prey. .. The yeast reporter strain L40 ( ) was cotransformed ( ) with the indicated pLexA and pGAD plasmids, and β-galactosidase activities of transformants were determined as described previously ( ).

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: Large preparations of plasmid DNA for yeast transformation and plant cell bombardment were prepared using JetStar 2.0 maxipreps from Genomed. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker. .. For YFP fusion protein expression, fragments were cloned into a pUC derivative containing a LAT52 promoter and NOS polyadenylation signal as described ( ; ).

Article Title: Involvement of the intermediate filament protein cytokeratin-18 in actin pedestal formation during EPEC infection
Article Snippet: Oligo(dT)25 (dA/dC/dG) was used to prime first-strand cDNA synthesis by Moloney murine leukaemia virus reverse transcriptase, and second-strand synthesis utilized a mixture of T4DNA polymerase and RNaseH. .. The cDNAs were ligated to an Eco R1 adapted linker and cloned into pGAD-GH (Clontech). .. The pGAD-GH cDNA clones were amplified in E. coli SURE (Stratagene) before plasmid DNA was transformed into yeast (PJ69-4A).

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: For expression in mammalian cells with the T7 RNA polymerase vaccinia virus system, constructs were cloned behind the myc epitope of pGEM-myc4 ( ). .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey. .. For expression of GST fusion proteins in Escherichia coli , pGEX-Hrs or the deletion constructs indicated were obtained by subcloning the respective cDNAs into the polylinker sites of pGEX-6P (Amersham Pharmacia). pGEX-2T-clathrin1–579 was a gift from Dr Jim Keen ( ).

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Identification of E4-DBP as an HPV16 E1∧E4-associated protein indicates a possible role for E1∧E4 in virus synthesis. .. Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.). .. The 16 E1∧E4 gene was amplified from pMal.16 E1∧E4 ( ) using primers CGGGATCCGGAATTCATGGCTGATCCTGCAGCAGCAACG AAG (16E1∧E4forwardA) and GGGGATCCTTATGGGTGTAGTGTTACTATTACAGT (16E1∧E4reverseA) and was cloned between the Eco RI and Bam HI sites of pGBT9 or pGAD 424 (Clontech).

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: The complete ORFs of RAD18, RAD5, UBC13 and MMS2 were cloned into the two-hybrid vectors pGAD424 and pGBT9 (Clontech) by PCR from genomic DNA. .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech). .. Truncations of RAD18 and RAD5 were constructed using internal restriction sites.

Article Title: Characterization of PDZ-binding kinase, a mitotic kinase
Article Snippet: The bait, full-length hDlg cDNA, was subcloned in pGBT9 and used to screen a HeLa cell cDNA library in pGAD-GH (CLONTECH). .. Around 750,000 independent clones were screened, of which 2,000 were His+ and 240 were positive for β-galactosidase activity.

Amplification:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Full-length and partial coding sequences of COMMD1 and COMMD6 were amplified from human or canine liver cDNA and cloned in pCRII vector (Invitrogen, Breda, The Netherlands). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: Plasmid mms2 Δ ::HIS3 was constructed by amplifying 511 bp of the upstream and 420 bp of the downstream flanking regions of MMS2 by PCR from genomic DNA and combining the fragments with a HIS3 cassette in pBluescript-SK(+) (Stratagene). rad18 Δ ::TRP1 contains 464 bp of the RAD18 upstream flanking region and the C-terminal part of the open reading frame (ORF; 520 bp) interrupted by the TRP1 locus in pBluescript-SK(+). rad30 Δ ::HIS 3 was constructed by inserting a 3076 bp PCR fragment containing the RAD30 gene with flanking regions into pBluescript-SK(+) and replacing the Stu I– Ehe I fragment, containing the entire ORF, with the HIS3 marker. rad5 Δ ::HIS3 was constructed similarly by amplification of the RAD5 ORF, insertion into pBluescript-SK(+) and replacement of the internal Bcl I– Bgl II fragment with HIS3 . .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech).

Construct:

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2
Article Snippet: The following antibodies (all from Santa Cruz) against proteasome subunits were used: the sc-373689 and sc-28809 antibodies for LMP2, the sc-374405 antibody for PSMB6, and the sc-1666205 antibody for PSMA3. .. To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ). .. Plasmids carrying Chandipura virus (CHAV) M and spring viremia of carp virus (SVCV) M were provided by J. Petersen, L. Her, and J. E. Dahlberg (University of Wisconsin).

Article Title: Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages
Article Snippet: The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech). .. The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech).

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Paragraph title: Constructs ... Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: Hrs regulates multivesicular body formation via ESCRT recruitment to endosomes
Article Snippet: The cells were first transfected with siRNA for 3 d, then the cells were replated, and the transfection was repeated for another 3 d. .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (CLONTECH Laboratories, Inc.) as prey. .. The yeast reporter strain L40 ( ) was cotransformed ( ) with the indicated pLexA and pGAD plasmids, and β-galactosidase activities of transformants were determined as described previously ( ).

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Article Title: Z-DNA-binding proteins can act as potent effectors of gene expression invivo
Article Snippet: Vector constructs were modified from the vectors used in the MATCHMAKER yeast hybrid system (CLONTECH). .. Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH). .. Target sequences were inserted into the reporter vectors by using duplex DNA oligomers.

Article Title: The trans-Golgi network GRIP-domain proteins form ?-helical homodimers
Article Snippet: pHybLex-GCC88, pHybLex-GCC88aa1-330 , pHybLex-GCC88aa331-775 , pGAD-GCC88 and pGAD-GCC88aa441-775 were obtained by subcloning the full-length [ ] and partial GCC88 cDNAs, isolated from full-length GCC88 cDNA by digestion with restriction enzymes, into the polylinker sites of pHybLex/Zeo (LexA-binding domain; Invitrogen) and pGAD GH (GAL4 activation domain; Clontech, Palo Alto, CA, U.S.A.) respectively. .. HIS3 reporter gene activation was detected by analysing growth on a medium lacking histidine and leucine and containing zeocin and 7.5 mM 3-aminotriazole.

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: For expression in mammalian cells with the T7 RNA polymerase vaccinia virus system, constructs were cloned behind the myc epitope of pGEM-myc4 ( ). .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey. .. For expression of GST fusion proteins in Escherichia coli , pGEX-Hrs or the deletion constructs indicated were obtained by subcloning the respective cDNAs into the polylinker sites of pGEX-6P (Amersham Pharmacia). pGEX-2T-clathrin1–579 was a gift from Dr Jim Keen ( ).

Article Title: The 14-kDa Dynein Light Chain-Family Protein Dlc1 Is Required for Regular Oscillatory Nuclear Movement and Efficient Recombination during Meiotic Prophase in Fission Yeast
Article Snippet: A commercially supplied yeast two-hybrid system (Matchmaker two-hybrid system 2; CLONTECH , Palo Alto, CA) was used according to the manufacturer's protocol. .. A bait plasmid containing a segment of Kms1 protein (amino acid residues 202–607) fused to the Gal4 DNA-binding domain (Gal4BD) in pAS2.1 was used to screen an S. pombe cDNA library constructed with pGAD GH ( CLONTECH ). .. Various parts of Kms1 protein as well as Dlc1 were fused to the activation domain on pACT2 by using PCR-generated fragments.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: Yeast strain L40 was used as a host for the two-hybrid screening ( ). .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. Transformants were screened for growth on SD plate media lacking tryptophan, leucine, and histidine prototrophy.

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: Plasmid mms2 Δ ::HIS3 was constructed by amplifying 511 bp of the upstream and 420 bp of the downstream flanking regions of MMS2 by PCR from genomic DNA and combining the fragments with a HIS3 cassette in pBluescript-SK(+) (Stratagene). rad18 Δ ::TRP1 contains 464 bp of the RAD18 upstream flanking region and the C-terminal part of the open reading frame (ORF; 520 bp) interrupted by the TRP1 locus in pBluescript-SK(+). rad30 Δ ::HIS 3 was constructed by inserting a 3076 bp PCR fragment containing the RAD30 gene with flanking regions into pBluescript-SK(+) and replacing the Stu I– Ehe I fragment, containing the entire ORF, with the HIS3 marker. rad5 Δ ::HIS3 was constructed similarly by amplification of the RAD5 ORF, insertion into pBluescript-SK(+) and replacement of the internal Bcl I– Bgl II fragment with HIS3 . .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech).

Electrophoresis:

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: DNA cloning, analysis, and electrophoresis were performed as described ( ). .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Plasmid Purification:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: For yeast two-hybrid assays, full-length human COMMD1 cDNA was subcloned in pDNR3 (Clontech, BD Biosciences, San Jose, CA, U.S.A.) and subsequently subcloned in pLP-GBKT7 and pLP-GADT7 using the creator cloning kit (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Expressing:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Article Title: Z-DNA-binding proteins can act as potent effectors of gene expression invivo
Article Snippet: Vector constructs were modified from the vectors used in the MATCHMAKER yeast hybrid system (CLONTECH). .. Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH). .. Target sequences were inserted into the reporter vectors by using duplex DNA oligomers.

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: For expression in mammalian cells with the T7 RNA polymerase vaccinia virus system, constructs were cloned behind the myc epitope of pGEM-myc4 ( ). .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey.

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Paragraph title: Two-hybrid library screening and manipulation of plasmids expressing HPV E1∧E4 proteins. ... Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.).

Article Title: A Chimeric Protein Containing the N Terminus of the Adeno-Associated Virus Rep Protein Recognizes Its Target Site in an In Vivo Assay
Article Snippet: For high-level expression of the chimeric proteins, the ORFs of the plasmids presented above were subcloned under control of the full-length yeast ADH1 promoter. .. An Aat II- Hin dIII fragment of pGAD GH (Clontech) containing the full-length promoter was subcloned into the pG expression plasmid series to replace a corresponding fragment containing a truncated version of the ADH1 promoter, giving rise to pADH.Rep68, pADH.Rep78, pADH.Rep.AD, pADH.Rep.LZ.AD, pADH.Rep.TZ.AD, and pADH.Rep.TZ. .. Plasmid pADH.Keratin was kindly provided by Jeanette Ducut.

Modification:

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: Large preparations of plasmid DNA for yeast transformation and plant cell bombardment were prepared using JetStar 2.0 maxipreps from Genomed. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker. .. For YFP fusion protein expression, fragments were cloned into a pUC derivative containing a LAT52 promoter and NOS polyadenylation signal as described ( ; ).

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker. .. This resulted in a Gal4 activation domain AD-EED hybrid.

Article Title: Z-DNA-binding proteins can act as potent effectors of gene expression invivo
Article Snippet: Vector constructs were modified from the vectors used in the MATCHMAKER yeast hybrid system (CLONTECH). .. Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH).

Transformation Assay:

Article Title: Pex3 and Atg37 compete to regulate the interaction between the pexophagy receptor, Atg30, and the Hrr25 kinase
Article Snippet: Full-length open reading frames or truncated forms were inserted in pGAD-GH (Clontech Laboratories, 638853), pGADT7-AD (Clontech Laboratories, 630442) or pDEST-GADT7 (Arabidopsis Biological Resource Center, CD3-763; Shaw Laboratory) (AD) and pGBT9 (Clontech Laboratories, K1605-A), pGBKT7 (Clontech Laboratories, 630443), pDEST-GBKT7 (Arabidopsis Biological Resource Center, CD3-764; Shaw Laboratory) (BD) plasmids. .. Full-length open reading frames or truncated forms were inserted in pGAD-GH (Clontech Laboratories, 638853), pGADT7-AD (Clontech Laboratories, 630442) or pDEST-GADT7 (Arabidopsis Biological Resource Center, CD3-763; Shaw Laboratory) (AD) and pGBT9 (Clontech Laboratories, K1605-A), pGBKT7 (Clontech Laboratories, 630443), pDEST-GBKT7 (Arabidopsis Biological Resource Center, CD3-764; Shaw Laboratory) (BD) plasmids.

Article Title: Live-Cell Imaging Reveals Multiple Interactions between Epstein-Barr Virus Nuclear Antigen 1 and Cellular Chromatin during Interphase and Mitosis
Article Snippet: A premade HeLa cell random cDNA library fused with GAL4 AD in pGAD-GH (Clontech) was used. .. Briefly, Saccharomyces cerevisiae CG-1945 strain was cotransformed with cDNA HeLa/pGAD-GH and 1-90/327-410 EBNA-1/pAS2.1 or pAS2.1 control.

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: Large preparations of plasmid DNA for yeast transformation and plant cell bombardment were prepared using JetStar 2.0 maxipreps from Genomed. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: Yeast strain L40 was used as a host for the two-hybrid screening ( ). .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. Transformants were screened for growth on SD plate media lacking tryptophan, leucine, and histidine prototrophy.

Over Expression:

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech). .. The point mutation in the RING finger of RAD5 was created by PCR mutagenesis.

Derivative Assay:

Article Title: Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages
Article Snippet: In order to verify physical interactions among CBLs and CIPKs in a non-angiosperm plant, we cloned the CDS of each full-length CBL and CIPK transcript identified in Physcomitrella and tested interactions among PpCBLs and PpCIPKs in yeast two-hybrid (Y2H) assays using the yeast strain AH109 (Clontech Inc.). .. The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech). .. These vectors were transformed into yeast cells using the G-Biosciences FastYeast Transformation Kit and used to express CBL and CIPK fusions to the DNA-binding domain (BD) and activation domain (AD) of a split transcription factor.

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech). .. The point mutation in the RING finger of RAD5 was created by PCR mutagenesis.

Electroporation:

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: Yeast strain L40 was used as a host for the two-hybrid screening ( ). .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. Transformants were screened for growth on SD plate media lacking tryptophan, leucine, and histidine prototrophy.

Library Screening:

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Paragraph title: Two-hybrid library screening and manipulation of plasmids expressing HPV E1∧E4 proteins. ... Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.).

Cell Culture:

Article Title: Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages
Article Snippet: The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech). .. As negative controls, we verified that CBL-BD or CIPK-BD fusion proteins did not interact with the pGAD-GH empty vector (EV).

Hemagglutination Assay:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech). .. For production of recombinant COMMD6, COMMD6 coding sequence was subcloned in pQE-30 (Qiagen, Venlo, The Netherlands).

Generated:

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2
Article Snippet: To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ). .. To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ).

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: The Hrs constructs indicated were generated by PCR with mouse Hrs ( ) as the template. .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey.

DNA Sequencing:

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Y2H Assay:

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2
Article Snippet: The following antibodies (all from Santa Cruz) against proteasome subunits were used: the sc-373689 and sc-28809 antibodies for LMP2, the sc-374405 antibody for PSMB6, and the sc-1666205 antibody for PSMA3. .. To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ). .. Plasmids carrying Chandipura virus (CHAV) M and spring viremia of carp virus (SVCV) M were provided by J. Petersen, L. Her, and J. E. Dahlberg (University of Wisconsin).

Sequencing:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation.

Recombinant:

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Nucleic Acid Electrophoresis:

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker.

Mutagenesis:

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.). .. Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.).

Article Title: The 14-kDa Dynein Light Chain-Family Protein Dlc1 Is Required for Regular Oscillatory Nuclear Movement and Efficient Recombination during Meiotic Prophase in Fission Yeast
Article Snippet: A bait plasmid containing a segment of Kms1 protein (amino acid residues 202–607) fused to the Gal4 DNA-binding domain (Gal4BD) in pAS2.1 was used to screen an S. pombe cDNA library constructed with pGAD GH ( CLONTECH ). .. Various parts of Kms1 protein as well as Dlc1 were fused to the activation domain on pACT2 by using PCR-generated fragments.

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech). .. Truncations of RAD18 and RAD5 were constructed using internal restriction sites.

Isolation:

Article Title: Live-Cell Imaging Reveals Multiple Interactions between Epstein-Barr Virus Nuclear Antigen 1 and Cellular Chromatin during Interphase and Mitosis
Article Snippet: A premade HeLa cell random cDNA library fused with GAL4 AD in pGAD-GH (Clontech) was used. .. The transformed yeasts were selected on agar plates with a double (−Leu/−Trp) or a triple (−Leu/−Trp/−His) dropout of the essential amino acids.

Article Title: Involvement of the intermediate filament protein cytokeratin-18 in actin pedestal formation during EPEC infection
Article Snippet: Polyadenylated RNAs were selected using the poly(A) Quik mRNA isolation kit (Stratagene). .. The cDNAs were ligated to an Eco R1 adapted linker and cloned into pGAD-GH (Clontech).

Article Title: The trans-Golgi network GRIP-domain proteins form ?-helical homodimers
Article Snippet: Bound proteins were eluted by boiling the beads in SDS/PAGE loading buffer and analysed by immunoblotting with either anti-Myc or anti-FLAG antibodies. .. pHybLex-GCC88, pHybLex-GCC88aa1-330 , pHybLex-GCC88aa331-775 , pGAD-GCC88 and pGAD-GCC88aa441-775 were obtained by subcloning the full-length [ ] and partial GCC88 cDNAs, isolated from full-length GCC88 cDNA by digestion with restriction enzymes, into the polylinker sites of pHybLex/Zeo (LexA-binding domain; Invitrogen) and pGAD GH (GAL4 activation domain; Clontech, Palo Alto, CA, U.S.A.) respectively. .. The pHybLex/Zeo and pGAD GH constructs were co-transformed in to the Saccharomyces cerevisiae reporter stain L40 [ ] using a lithium acetate method [ ].

Subcloning:

Article Title: The trans-Golgi network GRIP-domain proteins form ?-helical homodimers
Article Snippet: Bound proteins were eluted by boiling the beads in SDS/PAGE loading buffer and analysed by immunoblotting with either anti-Myc or anti-FLAG antibodies. .. pHybLex-GCC88, pHybLex-GCC88aa1-330 , pHybLex-GCC88aa331-775 , pGAD-GCC88 and pGAD-GCC88aa441-775 were obtained by subcloning the full-length [ ] and partial GCC88 cDNAs, isolated from full-length GCC88 cDNA by digestion with restriction enzymes, into the polylinker sites of pHybLex/Zeo (LexA-binding domain; Invitrogen) and pGAD GH (GAL4 activation domain; Clontech, Palo Alto, CA, U.S.A.) respectively. .. The pHybLex/Zeo and pGAD GH constructs were co-transformed in to the Saccharomyces cerevisiae reporter stain L40 [ ] using a lithium acetate method [ ].

Purification:

Article Title: Z-DNA-binding proteins can act as potent effectors of gene expression invivo
Article Snippet: Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH). .. Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH).

Polymerase Chain Reaction:

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2
Article Snippet: To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ). .. Mutants were generated in pLEX for M and in pGAD for LMP2.

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: The Hrs constructs indicated were generated by PCR with mouse Hrs ( ) as the template. .. For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey.

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: The complete ORFs of RAD18, RAD5, UBC13 and MMS2 were cloned into the two-hybrid vectors pGAD424 and pGBT9 (Clontech) by PCR from genomic DNA. .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech).

cDNA Library Assay:

Article Title: Live-Cell Imaging Reveals Multiple Interactions between Epstein-Barr Virus Nuclear Antigen 1 and Cellular Chromatin during Interphase and Mitosis
Article Snippet: A cDNA encoding EBNA-1 truncated form 8-410Δ95-314 was fused with the region encoding GAL4 DB domain into pAS2.1 (Clontech) between EcoRI and BamHI sites. .. A premade HeLa cell random cDNA library fused with GAL4 AD in pGAD-GH (Clontech) was used. .. A yeast two-hybrid assay was performed according to the manufacturer's protocol.

Article Title: Biochemical characterization of androgen receptor-interacting protein 4
Article Snippet: Gels were dried and exposed to Fuji X-ray films overnight at −70 °C. .. A Gal4 fusion to full-length wild-type ARIP4 was used to screen a human HeLa cDNA library in pGAD-GH (Clontech) according to the manufacturer's instructions. .. Positive clones were analysed by digestion and sequenced.

Article Title: Involvement of the intermediate filament protein cytokeratin-18 in actin pedestal formation during EPEC infection
Article Snippet: Preparation of cDNA library and yeast two-hybrid screen. .. The cDNAs were ligated to an Eco R1 adapted linker and cloned into pGAD-GH (Clontech).

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Identification of E4-DBP as an HPV16 E1∧E4-associated protein indicates a possible role for E1∧E4 in virus synthesis. .. Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.). .. The 16 E1∧E4 gene was amplified from pMal.16 E1∧E4 ( ) using primers CGGGATCCGGAATTCATGGCTGATCCTGCAGCAGCAACG AAG (16E1∧E4forwardA) and GGGGATCCTTATGGGTGTAGTGTTACTATTACAGT (16E1∧E4reverseA) and was cloned between the Eco RI and Bam HI sites of pGBT9 or pGAD 424 (Clontech).

Article Title: The 14-kDa Dynein Light Chain-Family Protein Dlc1 Is Required for Regular Oscillatory Nuclear Movement and Efficient Recombination during Meiotic Prophase in Fission Yeast
Article Snippet: A commercially supplied yeast two-hybrid system (Matchmaker two-hybrid system 2; CLONTECH , Palo Alto, CA) was used according to the manufacturer's protocol. .. A bait plasmid containing a segment of Kms1 protein (amino acid residues 202–607) fused to the Gal4 DNA-binding domain (Gal4BD) in pAS2.1 was used to screen an S. pombe cDNA library constructed with pGAD GH ( CLONTECH ). .. Various parts of Kms1 protein as well as Dlc1 were fused to the activation domain on pACT2 by using PCR-generated fragments.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: Yeast strain L40 was used as a host for the two-hybrid screening ( ). .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. Transformants were screened for growth on SD plate media lacking tryptophan, leucine, and histidine prototrophy.

Article Title: Characterization of PDZ-binding kinase, a mitotic kinase
Article Snippet: The two-hybrid screen was performed by using the MatchMaker system (CLONTECH). .. The bait, full-length hDlg cDNA, was subcloned in pGBT9 and used to screen a HeLa cell cDNA library in pGAD-GH (CLONTECH). .. Around 750,000 independent clones were screened, of which 2,000 were His+ and 240 were positive for β-galactosidase activity.

Plasmid Preparation:

Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2
Article Snippet: The following antibodies (all from Santa Cruz) against proteasome subunits were used: the sc-373689 and sc-28809 antibodies for LMP2, the sc-374405 antibody for PSMB6, and the sc-1666205 antibody for PSMA3. .. To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ). .. Plasmids carrying Chandipura virus (CHAV) M and spring viremia of carp virus (SVCV) M were provided by J. Petersen, L. Her, and J. E. Dahlberg (University of Wisconsin).

Article Title: Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages
Article Snippet: The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech). .. The CDSs of PpCBLs and PpCIPKs were cloned by Gateway LR reaction into yeast two-hybrid gateway-compatible vectors (pGBT9-BS-GW and pGAD-GH-GW) derived from pGBT9-BS and pGAD-GH (Clontech).

Article Title: Characterization of COMMD protein-protein interactions in NF-?B signalling
Article Snippet: Full-length and partial coding sequences of COMMD1 and COMMD6 were amplified from human or canine liver cDNA and cloned in pCRII vector (Invitrogen, Breda, The Netherlands). .. Partial coding sequences of human or canine COMMD1, and full-length COMMD6 , were subcloned in pGBT9 or pGAD-GH (Clontech).

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: Paragraph title: DNA Techniques and Plasmid Construction ... For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker. .. This resulted in a Gal4 activation domain AD-EED hybrid.

Article Title: Z-DNA-binding proteins can act as potent effectors of gene expression invivo
Article Snippet: Vector constructs were modified from the vectors used in the MATCHMAKER yeast hybrid system (CLONTECH). .. Reporter vectors were constructed by using the pLacZi vector as a template and expression vectors were constructed by using either pACT2 or pGAD-GH (CLONTECH). .. Target sequences were inserted into the reporter vectors by using duplex DNA oligomers.

Article Title: Hrs recruits clathrin to early endosomes
Article Snippet: Paragraph title: Plasmid constructs ... For use in the two-hybrid system, constructs were cloned into pLexA/pBTM116 ( ) as bait and pGAD GH (Clontech) as prey.

Article Title: The 14-kDa Dynein Light Chain-Family Protein Dlc1 Is Required for Regular Oscillatory Nuclear Movement and Efficient Recombination during Meiotic Prophase in Fission Yeast
Article Snippet: A commercially supplied yeast two-hybrid system (Matchmaker two-hybrid system 2; CLONTECH , Palo Alto, CA) was used according to the manufacturer's protocol. .. A bait plasmid containing a segment of Kms1 protein (amino acid residues 202–607) fused to the Gal4 DNA-binding domain (Gal4BD) in pAS2.1 was used to screen an S. pombe cDNA library constructed with pGAD GH ( CLONTECH ). .. Various parts of Kms1 protein as well as Dlc1 were fused to the activation domain on pACT2 by using PCR-generated fragments.

Article Title: The Cell Cycle-Regulatory CDC25A Phosphatase Inhibits Apoptosis Signal-Regulating Kinase 1
Article Snippet: The entire coding region of human CDC25A cDNA was fused in frame to the GAL4 DNA-binding domain by using the pTBG2 vector ( ) to produce a fusion protein with CDC25A as the amino terminus. .. A rat ovary cDNA library in pGAD-GH (Clontech) was screened with this bait vector in Y190 yeast ( Saccharomyces cerevisiae ) by standard two-hybrid procedures as described previously. .. Library plasmids recovered from the positive (His 3+ LacZ+ ) clones were reexamined by cotransformation of SFY526 yeast with the bait plasmid followed by a β-galactosidase assay.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation. .. An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation.

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: Plasmid mms2 Δ ::HIS3 was constructed by amplifying 511 bp of the upstream and 420 bp of the downstream flanking regions of MMS2 by PCR from genomic DNA and combining the fragments with a HIS3 cassette in pBluescript-SK(+) (Stratagene). rad18 Δ ::TRP1 contains 464 bp of the RAD18 upstream flanking region and the C-terminal part of the open reading frame (ORF; 520 bp) interrupted by the TRP1 locus in pBluescript-SK(+). rad30 Δ ::HIS 3 was constructed by inserting a 3076 bp PCR fragment containing the RAD30 gene with flanking regions into pBluescript-SK(+) and replacing the Stu I– Ehe I fragment, containing the entire ORF, with the HIS3 marker. rad5 Δ ::HIS3 was constructed similarly by amplification of the RAD5 ORF, insertion into pBluescript-SK(+) and replacement of the internal Bcl I– Bgl II fragment with HIS3 . .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech).

Article Title: A Chimeric Protein Containing the N Terminus of the Adeno-Associated Virus Rep Protein Recognizes Its Target Site in an In Vivo Assay
Article Snippet: For high-level expression of the chimeric proteins, the ORFs of the plasmids presented above were subcloned under control of the full-length yeast ADH1 promoter. .. An Aat II- Hin dIII fragment of pGAD GH (Clontech) containing the full-length promoter was subcloned into the pG expression plasmid series to replace a corresponding fragment containing a truncated version of the ADH1 promoter, giving rise to pADH.Rep68, pADH.Rep78, pADH.Rep.AD, pADH.Rep.LZ.AD, pADH.Rep.TZ.AD, and pADH.Rep.TZ. .. Plasmid pADH.Keratin was kindly provided by Jeanette Ducut.

Two Hybrid Screening:

Article Title: Live-Cell Imaging Reveals Multiple Interactions between Epstein-Barr Virus Nuclear Antigen 1 and Cellular Chromatin during Interphase and Mitosis
Article Snippet: Paragraph title: Yeast two-hybrid screening. ... A premade HeLa cell random cDNA library fused with GAL4 AD in pGAD-GH (Clontech) was used.

Article Title: Biochemical characterization of androgen receptor-interacting protein 4
Article Snippet: Paragraph title: Yeast two-hybrid screening ... A Gal4 fusion to full-length wild-type ARIP4 was used to screen a human HeLa cDNA library in pGAD-GH (Clontech) according to the manufacturer's instructions.

Article Title: Involvement of the intermediate filament protein cytokeratin-18 in actin pedestal formation during EPEC infection
Article Snippet: Preparation of cDNA library and yeast two-hybrid screen. .. The cDNAs were ligated to an Eco R1 adapted linker and cloned into pGAD-GH (Clontech).

Article Title: The E1?E4 Protein of Human Papillomavirus Type 16 Associates with a Putative RNA Helicase through Sequences in Its C Terminus
Article Snippet: Identification of E4-DBP as an HPV16 E1∧E4-associated protein indicates a possible role for E1∧E4 in virus synthesis. .. Two-hybrid screening was carried out as described previously ( ) with yeast strain Hfc7 and a HeLa S3 cell cDNA library cloned between the Eco RI and Xho I sites of pGAD GH (insert size, 0.4 to 2.0 kb; Clontech, Palo Alto, Calif.). .. The 16 E1∧E4 gene was amplified from pMal.16 E1∧E4 ( ) using primers CGGGATCCGGAATTCATGGCTGATCCTGCAGCAGCAACG AAG (16E1∧E4forwardA) and GGGGATCCTTATGGGTGTAGTGTTACTATTACAGT (16E1∧E4reverseA) and was cloned between the Eco RI and Bam HI sites of pGBT9 or pGAD 424 (Clontech).

Article Title: The Cell Cycle-Regulatory CDC25A Phosphatase Inhibits Apoptosis Signal-Regulating Kinase 1
Article Snippet: Paragraph title: Yeast two-hybrid screening. ... A rat ovary cDNA library in pGAD-GH (Clontech) was screened with this bait vector in Y190 yeast ( Saccharomyces cerevisiae ) by standard two-hybrid procedures as described previously.

Article Title: Zyxin, a Regulator of Actin Filament Assembly, Targets the Mitotic Apparatus by Interacting with H-Warts/Lats1 Tumor Suppressor
Article Snippet: Paragraph title: Yeast Two-Hybrid Screening ... An L40 strain carrying pBTM116HA/h-warts (amino acids 394–675) was transformed with the HeLa cDNA library constructed in pGAD-GH (Clontech) by electroporation.

Article Title: Characterization of PDZ-binding kinase, a mitotic kinase
Article Snippet: Paragraph title: Two-Hybrid Screen. ... The bait, full-length hDlg cDNA, was subcloned in pGBT9 and used to screen a HeLa cell cDNA library in pGAD-GH (CLONTECH).

Produced:

Article Title: Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
Article Snippet: For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker. .. For yeast two-hybrid analysis, protein encoding fragments were cloned into a derivative of pGAD-GH and pGBK-T7 (Clontech) with a modified polylinker.

Activation Assay:

Article Title: The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1
Article Snippet: The sequence of the construct was verified by DNA sequencing, and the expression of recombinant fusion protein in yeast was confirmed by gel electrophoresis and immunoblot analysis with anti-IN polyclonal antibody as described below. (ii) Generation of the pGAD-EED (Fig. ). .. The cDNA of wild-type (WT) EED ( ) was inserted into the Eco RI and Not I sites of the Gal4 transcription activation domain vector pGAD3S2X, a modified version of the pGAD GH (Clontech) containing a Not I site in its polylinker. .. This resulted in a Gal4 activation domain AD-EED hybrid.

Article Title: The trans-Golgi network GRIP-domain proteins form ?-helical homodimers
Article Snippet: Bound proteins were eluted by boiling the beads in SDS/PAGE loading buffer and analysed by immunoblotting with either anti-Myc or anti-FLAG antibodies. .. pHybLex-GCC88, pHybLex-GCC88aa1-330 , pHybLex-GCC88aa331-775 , pGAD-GCC88 and pGAD-GCC88aa441-775 were obtained by subcloning the full-length [ ] and partial GCC88 cDNAs, isolated from full-length GCC88 cDNA by digestion with restriction enzymes, into the polylinker sites of pHybLex/Zeo (LexA-binding domain; Invitrogen) and pGAD GH (GAL4 activation domain; Clontech, Palo Alto, CA, U.S.A.) respectively. .. The pHybLex/Zeo and pGAD GH constructs were co-transformed in to the Saccharomyces cerevisiae reporter stain L40 [ ] using a lithium acetate method [ ].

Marker:

Article Title: Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair
Article Snippet: Plasmid mms2 Δ ::HIS3 was constructed by amplifying 511 bp of the upstream and 420 bp of the downstream flanking regions of MMS2 by PCR from genomic DNA and combining the fragments with a HIS3 cassette in pBluescript-SK(+) (Stratagene). rad18 Δ ::TRP1 contains 464 bp of the RAD18 upstream flanking region and the C-terminal part of the open reading frame (ORF; 520 bp) interrupted by the TRP1 locus in pBluescript-SK(+). rad30 Δ ::HIS 3 was constructed by inserting a 3076 bp PCR fragment containing the RAD30 gene with flanking regions into pBluescript-SK(+) and replacing the Stu I– Ehe I fragment, containing the entire ORF, with the HIS3 marker. rad5 Δ ::HIS3 was constructed similarly by amplification of the RAD5 ORF, insertion into pBluescript-SK(+) and replacement of the internal Bcl I– Bgl II fragment with HIS3 . .. RAD6 was cloned into pAS2-1 and a derivative of pGAD GH (Clontech).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    TaKaRa pgad gh
    HES6 binds TLE1 in mammalian cells. (a) C2C12 myoblasts were cotransfected with expression vectors for GST epitope–tagged TLE1 and 6xHis epitope–tagged HES6. Cell extracts were precipitated with glutathione-Sepharose beads and analyzed by Western blotting using anti-GST (lanes 1–4) or anti-6xHis (lanes 5–8) antibodies. HES6, but not HES6-Δ, was coprecipitated with GST–TLE1. The empty GST expression <t>vector</t> (lanes 1 and 5) and empty HES6 expression vector, pEBVHis (lanes 2 and 6), served as negative controls for the specificity of the interaction. (b) Mammalian <t>two-hybrid</t> <t>assay.</t> 293 cells were cotransfected with the p5xGAL4UAS-SV40-luc reporter and pcDNA3-GAL4bd, pcDNA 3-GAL4bd–HES6, pcDNA3-GAL4bd–HES6-Δ, or pTLE1–VP16, alone or in combination, as indicated below the graph. Cells were collected 24 h after transfection and luciferase activity was assayed. Results are expressed as a percentage of expression relative to cells transfected with the reporter and empty vector alone. Means ± SD of three experiments are shown.
    Pgad Gh, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgad gh/product/TaKaRa
    Average 80 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    pgad gh - by Bioz Stars, 2019-10
    80/100 stars
      Buy from Supplier

    Image Search Results


    HES6 binds TLE1 in mammalian cells. (a) C2C12 myoblasts were cotransfected with expression vectors for GST epitope–tagged TLE1 and 6xHis epitope–tagged HES6. Cell extracts were precipitated with glutathione-Sepharose beads and analyzed by Western blotting using anti-GST (lanes 1–4) or anti-6xHis (lanes 5–8) antibodies. HES6, but not HES6-Δ, was coprecipitated with GST–TLE1. The empty GST expression vector (lanes 1 and 5) and empty HES6 expression vector, pEBVHis (lanes 2 and 6), served as negative controls for the specificity of the interaction. (b) Mammalian two-hybrid assay. 293 cells were cotransfected with the p5xGAL4UAS-SV40-luc reporter and pcDNA3-GAL4bd, pcDNA 3-GAL4bd–HES6, pcDNA3-GAL4bd–HES6-Δ, or pTLE1–VP16, alone or in combination, as indicated below the graph. Cells were collected 24 h after transfection and luciferase activity was assayed. Results are expressed as a percentage of expression relative to cells transfected with the reporter and empty vector alone. Means ± SD of three experiments are shown.

    Journal: The Journal of Cell Biology

    Article Title: HES6 acts as a transcriptional repressor in myoblasts and can induce the myogenic differentiation program

    doi: 10.1083/jcb.200104058

    Figure Lengend Snippet: HES6 binds TLE1 in mammalian cells. (a) C2C12 myoblasts were cotransfected with expression vectors for GST epitope–tagged TLE1 and 6xHis epitope–tagged HES6. Cell extracts were precipitated with glutathione-Sepharose beads and analyzed by Western blotting using anti-GST (lanes 1–4) or anti-6xHis (lanes 5–8) antibodies. HES6, but not HES6-Δ, was coprecipitated with GST–TLE1. The empty GST expression vector (lanes 1 and 5) and empty HES6 expression vector, pEBVHis (lanes 2 and 6), served as negative controls for the specificity of the interaction. (b) Mammalian two-hybrid assay. 293 cells were cotransfected with the p5xGAL4UAS-SV40-luc reporter and pcDNA3-GAL4bd, pcDNA 3-GAL4bd–HES6, pcDNA3-GAL4bd–HES6-Δ, or pTLE1–VP16, alone or in combination, as indicated below the graph. Cells were collected 24 h after transfection and luciferase activity was assayed. Results are expressed as a percentage of expression relative to cells transfected with the reporter and empty vector alone. Means ± SD of three experiments are shown.

    Article Snippet: The HES6 cDNA, lacking the first 16 amino acids, was then subcloned into a yeast two-hybrid assay vector (pGAD-GH; CLONTECH Laboratories, Inc.) or mammalian expression vectors (pEBVHis and pcDNA4/TO/myc-His; Invitrogen) using conventional methodology.

    Techniques: Expressing, Western Blot, Plasmid Preparation, Two Hybrid Assay, Transfection, Luciferase, Activity Assay

    HES6 interacts with TLE1 in yeast cells. Yeast two- hybrid protein interaction assay. (a) Immunoblots of extracts from yeast cells transfected with pAD–HES6 (w.t.) or pAD–HES6-Δ (Δ) confirmed that both fusion proteins are produced in yeast cells. Left lane, molecular size markers in kiloDaltons. (b) Bait and target plasmids used to cotransfect yeast. BD, binding domain of GAL4; AD, activation domain of GAL4. The positive controls, pBD-p53 and pAD-T, were supplied with Stratagene's HybriZAP kit. (c) Growth on Leu − , Trp − plates. (d) Growth on Leu − , Trp − , and His − plates. The ability of the transformed cells to grow on His − medium indicates that a transcriptionally competent GAL4 complex was reconstituted due to the interaction between TLE1 and HES6. Note that the interaction requires the WRPW motif, as the HES6-Δ deletion mutant, deprived of this motif, did not interact with TLE1 to support growth on His − plates.

    Journal: The Journal of Cell Biology

    Article Title: HES6 acts as a transcriptional repressor in myoblasts and can induce the myogenic differentiation program

    doi: 10.1083/jcb.200104058

    Figure Lengend Snippet: HES6 interacts with TLE1 in yeast cells. Yeast two- hybrid protein interaction assay. (a) Immunoblots of extracts from yeast cells transfected with pAD–HES6 (w.t.) or pAD–HES6-Δ (Δ) confirmed that both fusion proteins are produced in yeast cells. Left lane, molecular size markers in kiloDaltons. (b) Bait and target plasmids used to cotransfect yeast. BD, binding domain of GAL4; AD, activation domain of GAL4. The positive controls, pBD-p53 and pAD-T, were supplied with Stratagene's HybriZAP kit. (c) Growth on Leu − , Trp − plates. (d) Growth on Leu − , Trp − , and His − plates. The ability of the transformed cells to grow on His − medium indicates that a transcriptionally competent GAL4 complex was reconstituted due to the interaction between TLE1 and HES6. Note that the interaction requires the WRPW motif, as the HES6-Δ deletion mutant, deprived of this motif, did not interact with TLE1 to support growth on His − plates.

    Article Snippet: The HES6 cDNA, lacking the first 16 amino acids, was then subcloned into a yeast two-hybrid assay vector (pGAD-GH; CLONTECH Laboratories, Inc.) or mammalian expression vectors (pEBVHis and pcDNA4/TO/myc-His; Invitrogen) using conventional methodology.

    Techniques: Protein Interaction Assay, Western Blot, Transfection, Produced, Binding Assay, Activation Assay, Transformation Assay, Mutagenesis

    The matrix protein of VSV interacts with LMP2. (A) cDNAs encoding pre-LMP2, mature LMP2, and the 20-amino-acid N-terminal propeptide were constructed in pGAD and used in Y2H assays against a pLEX VSV M construct. The empty pGAD (AD) or pLEX (LEX BD) vector was used as a negative control. The interaction was evaluated by quantification of β-galactosidase activity in liquid yeast cultures as described in the Materials and Methods section. Bars represent standard deviations of the mean from three independent experiments performed in triplicate. *, P < 0.05 compared to the control. (B) Coimmunoprecipitation of M and LMP2. N2A cells were transfected or not transfected (Non TF) for 24 h with plasmids carrying pre-LMP2-myc, myc-pre-LMP2, myc-mature-LMP2, or myc-dystonin as a negative control and then infected with VSV (4 h; MOI, 3) before preparation of cell lysates. Following immunoprecipitation with an anti-M antibody or anti-myc antibody 9E10, cell extracts (inputs) and immune complexes (immunoprecipitates [IP]) were separated by SDS-PAGE and analyzed by Western blotting (WB) using anti-myc antibody 9E10 or anti-M antibody to reveal the presence of the different myc-LMP2 and myc-dystonin constructs and M. Non Inf, noninfected. (C) N2A cells were transfected with plasmids carrying myc-tagged versions of VSV M, CHAV M, SVCV M, and LMP2-HA, followed by immunoprecipitation with an anti-HA antibody. The immunoprecipitates were analyzed by Western blotting using a myc-specific antibody to reveal the presence of VSV M.

    Journal:

    Article Title: Characterization of the Interaction between the Matrix Protein of Vesicular Stomatitis Virus and the Immunoproteasome Subunit LMP2

    doi: 10.1128/JVI.01753-15

    Figure Lengend Snippet: The matrix protein of VSV interacts with LMP2. (A) cDNAs encoding pre-LMP2, mature LMP2, and the 20-amino-acid N-terminal propeptide were constructed in pGAD and used in Y2H assays against a pLEX VSV M construct. The empty pGAD (AD) or pLEX (LEX BD) vector was used as a negative control. The interaction was evaluated by quantification of β-galactosidase activity in liquid yeast cultures as described in the Materials and Methods section. Bars represent standard deviations of the mean from three independent experiments performed in triplicate. *, P < 0.05 compared to the control. (B) Coimmunoprecipitation of M and LMP2. N2A cells were transfected or not transfected (Non TF) for 24 h with plasmids carrying pre-LMP2-myc, myc-pre-LMP2, myc-mature-LMP2, or myc-dystonin as a negative control and then infected with VSV (4 h; MOI, 3) before preparation of cell lysates. Following immunoprecipitation with an anti-M antibody or anti-myc antibody 9E10, cell extracts (inputs) and immune complexes (immunoprecipitates [IP]) were separated by SDS-PAGE and analyzed by Western blotting (WB) using anti-myc antibody 9E10 or anti-M antibody to reveal the presence of the different myc-LMP2 and myc-dystonin constructs and M. Non Inf, noninfected. (C) N2A cells were transfected with plasmids carrying myc-tagged versions of VSV M, CHAV M, SVCV M, and LMP2-HA, followed by immunoprecipitation with an anti-HA antibody. The immunoprecipitates were analyzed by Western blotting using a myc-specific antibody to reveal the presence of VSV M.

    Article Snippet: To obtain the plasmid constructs used in the yeast two-hybrid (Y2H) assay, cDNAs encoding premature or mature LMP2 (obtained from the Y2H screen) and PSMB6 (synthetic gene obtained from Biovalley) were constructed in pGAD-GH (Clontech), a derivative of pGAD-GE. cDNAs coding for VSV M (serotype Indiana, strain Orsay) as well as all VSV M mutants were constructed in LexA (Clontech) ( ).

    Techniques: Construct, Plasmid Preparation, Negative Control, Activity Assay, Transfection, Infection, Immunoprecipitation, SDS Page, Western Blot, Hemagglutination Assay

    The RNA-supplemented two-hybrid system. ( A ) The DNA-binding-domain hybrid is composed of the GAL4 DNA binding domain (DBD) fused to the ΔC27 mutant of human SLBP. The RNA component contains the RNase P leader at the 5′ end and two MS2-binding sites in the center, followed by the histone stem–loop. In the diagram only one MS2-binding site is depicted, and the RNase P leader is omitted. Protein X fused to the GAL4 activation domain (AD) interacts with the SLBP/RNA complex. The interaction brings the GAL4 AD into proximity to the promoter, resulting in activation of the HIS3 and LacZ reporter genes controlled by the GAL4-binding site. ( B ) Clones isolated in the RNA-supplemented two-hybrid system interact with the SLBP/SL complex but not with SLBP. Expression of two reporter genes, HIS3 and LacZ , was determined by testing the ability of yeast cells to grow on selective medium and by assaying β-galactosidase activity. To determine expression of the HIS3 gene, a suspension of yeast containing the library plasmid pGAD GH with the indicated cDNA insert, and the bait plasmid expressing SLBP with ( left , lanes 1 – 3 ) or without stem–loop RNA ( right , lanes 4 – 6 ), was spotted on medium with histidine (lanes 1,4 ) and on medium lacking histidine containing 10 mM 3-AT (lanes 2,5 ). hZFP100 and two other clones (8 and 22) isolated by the RNA-supplemented two-hybrid system are shown. Clone 8 is a putative 36-kD protein and clone 22 is ribosomal protein S15a. The ability of each clone to interact with the SLBP/RNA complex (lane 3 ) and free SLBP (lane 6 ) was confirmed by analysis of expression of the LacZ gene using a qualitative blue/white assay. After a 2-h incubation, cell suspensions were spotted on a white background and photographed. ( C ) The hSLBP was replaced in the bait construct shown in A with the Drosophila SLBP, and the ability of the three clones isolated in the initial screen to grow in the presence of 10 mM 3-AT was determined.

    Journal:

    Article Title: A novel zinc finger protein is associated with U7 snRNP and interacts with the stem-loop binding protein in the histone pre-mRNP to stimulate 3?-end processing

    doi: 10.1101/gad.932302

    Figure Lengend Snippet: The RNA-supplemented two-hybrid system. ( A ) The DNA-binding-domain hybrid is composed of the GAL4 DNA binding domain (DBD) fused to the ΔC27 mutant of human SLBP. The RNA component contains the RNase P leader at the 5′ end and two MS2-binding sites in the center, followed by the histone stem–loop. In the diagram only one MS2-binding site is depicted, and the RNase P leader is omitted. Protein X fused to the GAL4 activation domain (AD) interacts with the SLBP/RNA complex. The interaction brings the GAL4 AD into proximity to the promoter, resulting in activation of the HIS3 and LacZ reporter genes controlled by the GAL4-binding site. ( B ) Clones isolated in the RNA-supplemented two-hybrid system interact with the SLBP/SL complex but not with SLBP. Expression of two reporter genes, HIS3 and LacZ , was determined by testing the ability of yeast cells to grow on selective medium and by assaying β-galactosidase activity. To determine expression of the HIS3 gene, a suspension of yeast containing the library plasmid pGAD GH with the indicated cDNA insert, and the bait plasmid expressing SLBP with ( left , lanes 1 – 3 ) or without stem–loop RNA ( right , lanes 4 – 6 ), was spotted on medium with histidine (lanes 1,4 ) and on medium lacking histidine containing 10 mM 3-AT (lanes 2,5 ). hZFP100 and two other clones (8 and 22) isolated by the RNA-supplemented two-hybrid system are shown. Clone 8 is a putative 36-kD protein and clone 22 is ribosomal protein S15a. The ability of each clone to interact with the SLBP/RNA complex (lane 3 ) and free SLBP (lane 6 ) was confirmed by analysis of expression of the LacZ gene using a qualitative blue/white assay. After a 2-h incubation, cell suspensions were spotted on a white background and photographed. ( C ) The hSLBP was replaced in the bait construct shown in A with the Drosophila SLBP, and the ability of the three clones isolated in the initial screen to grow in the presence of 10 mM 3-AT was determined.

    Article Snippet: This strain harboring the pGBT/SLBP/SLWT plasmid was used to screen a GAL4 AD/HeLa cDNA fusion library constructed in the pGAD GH vector (Clontech).

    Techniques: Binding Assay, Mutagenesis, Activation Assay, Clone Assay, Isolation, Expressing, Activity Assay, Plasmid Preparation, Incubation, Construct