perfect real time kit  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Premix Ex Taq
    Description:
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    Catalog Number:
    rr390w
    Price:
    None
    Size:
    1 000 Rxns
    Category:
    Premix Ex Taq Probe qPCR qPCR with probe detection Real time PCR kits Real time PCR
    Buy from Supplier


    Structured Review

    TaKaRa perfect real time kit
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    https://www.bioz.com/result/perfect real time kit/product/TaKaRa
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    perfect real time kit - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Amplification:

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    TA Cloning:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer
    Article Snippet: .. According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ). .. The 25 μl mixture of PCR consisted of 12.5 μl SYBR Green supermix, 8.5 μl RNase-free water, 1 μl forward primers, 1 μl reverse primers and 2 μl reverse transcribed product.

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
    Article Snippet: .. The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions. .. Cells were lysed in RIPA buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) containing protease inhibitors.

    Expressing:

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Sequencing:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Transformation Assay:

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Plasmid Preparation:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa one step rt pcr kit
    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible <t>RNA</t> ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ <t>PCR</t> analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P
    One Step Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 359 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr kit/product/TaKaRa
    Average 99 stars, based on 359 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock

    doi: 10.1111/jcmm.12756

    Figure Lengend Snippet: PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Article Snippet: Then, 1 μg of DNA‐free total RNA was reverse transcribed by use of a one‐step RT‐PCR kit (TaKaRa Bio, Shiga, Japan).

    Techniques: Injection, Enzyme-linked Immunosorbent Assay, Western Blot, RNA Binding Assay, Mouse Assay, Staining, Quantitative RT-PCR

    Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways

    doi: 10.1155/2017/3159358

    Figure Lengend Snippet: Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Article Snippet: Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan).

    Techniques: Polymerase Chain Reaction

    Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Journal: PLoS ONE

    Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus

    doi: 10.1371/journal.pone.0110911

    Figure Lengend Snippet: Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Article Snippet: One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China).

    Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Fluorescence, Cell Culture

    20(S)‐Rg3 inhibits the expression of O 6 ‐methylguanine DNA ‐methyltransferase ( MGMT ) in glioma cell lines. T98G, U118 and GBM ‐ XX cells were seeded in 96‐well flat‐bottom plates at 5000 cells/well, cultured in DMEM supplemented with 10% FBS , and then treated with increasing concentrations of 20(S)‐Rg3 or temozolomide ( TMZ ), or DMSO as a control; 72 h later, 10 μL of cell counting kit‐8 mix reagent was added to 100 μL of media per well, and the cells were incubated at 37°C for 2 h. The optical density ( OD ) was measured at 450 nm with a spectrophotometer. A,B, The half maximal inhibitory concentration of 20(S)‐Rg3 and TMZ on glioma cells is approximately 200 and 250 μmol/L. C, T98G, U118 and GBM ‐ XX were treated with 20(S)‐Rg3 (100 μmol/L) for 72 h, and the total RNA was extracted with TRI zol; then the expression of MGMT mRNA level was determined by quantitative real‐time PCR (n = 4). *** P

    Journal: Cancer Science

    Article Title: 20(S)‐ginsenoside‐Rg3 reverses temozolomide resistance and restrains epithelial‐mesenchymal transition progression in glioblastoma. 20(S)‐ginsenoside‐Rg3 reverses temozolomide resistance and restrains epithelial‐mesenchymal transition progression in glioblastoma

    doi: 10.1111/cas.13881

    Figure Lengend Snippet: 20(S)‐Rg3 inhibits the expression of O 6 ‐methylguanine DNA ‐methyltransferase ( MGMT ) in glioma cell lines. T98G, U118 and GBM ‐ XX cells were seeded in 96‐well flat‐bottom plates at 5000 cells/well, cultured in DMEM supplemented with 10% FBS , and then treated with increasing concentrations of 20(S)‐Rg3 or temozolomide ( TMZ ), or DMSO as a control; 72 h later, 10 μL of cell counting kit‐8 mix reagent was added to 100 μL of media per well, and the cells were incubated at 37°C for 2 h. The optical density ( OD ) was measured at 450 nm with a spectrophotometer. A,B, The half maximal inhibitory concentration of 20(S)‐Rg3 and TMZ on glioma cells is approximately 200 and 250 μmol/L. C, T98G, U118 and GBM ‐ XX were treated with 20(S)‐Rg3 (100 μmol/L) for 72 h, and the total RNA was extracted with TRI zol; then the expression of MGMT mRNA level was determined by quantitative real‐time PCR (n = 4). *** P

    Article Snippet: For mRNA analysis, the Primer‐Script one step RT‐PCR kit (TaKaRa) was used to reverse transcribe RNA into cDNA.

    Techniques: Expressing, Cell Culture, Cell Counting, Incubation, Spectrophotometry, Concentration Assay, Real-time Polymerase Chain Reaction