pentr topo vector (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
|
Name:
pENTR D TOPO Cloning Kit
Description:
The pENTR D TOPO Cloning Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for entry into the Gateway System or the MultiSite Gateway System Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required The kit comes with everything necessary to clone and select your PCR amplified gene of interest • Gateway System Ready Rapidly shuttle cloned genes between multiple vector systems• Fast and Easy Go from PCR to Gateway Entry clone in just 3 steps and as little as 5 minutes hands on time• Efficient Achieve over 90 clones with correct insert in the right direction• Proven Reliable performance for over a decade pENTR D TOPO Cloning Kits Overview VECTOR pENTR D TOPO Vector Directional cloning vector for entry to the Gateway System CLONING METHOD Directional TOPO Cloning Topoisomerase I based 5 minute directional ligation of blunt end proofreading polymerase amplified PCR products to the vector COMPETENT CELLS Two Options Choose from kits with either high efficiency or fast growing competent cells Simple Access to the Gateway SystemFor access to the Gateway System just PCR amplify your gene of interest and add the product straight to the provided topoisomerase charged pENTR D TOPO vector incubate 5 minutes and transform the provided competent E coli cells The resulting attL containing Gateway Entry clones are ready for efficient recombination with your choice of Gateway Destination vectors Optimized pENTR D TOPO VectorThe pENTR D TOPO vector Figure 1 includes M13 and T7 primer sequencing sites and attL recombination sites flanking the PCR product insertion site This allows clones to be easily sequence verified and recombined into your choice of attR containing Gateway destination vectors A Kanamycin resistance gene and a pUC origin are used for selection and high copy propagation in E coli Simplified Directional CloningWith Directional TOPO cloning technology there is no need for PCR clean up vector preparation or other time intensive DNA manipulation steps Just add your PCR reaction straight to the provided topoisomerase charged vector incubate 5 minutes transform and obtain up to 90 directionally inserted clones A four base overhang on the vector pairs with a four base sequence designed into the forward primer used in your PCR reaction to provide directionality to the topoisomerase ligation reaction Figure 2 The Power of Gateway Recombination Cloning TechnologyGateway recombination cloning technology circumvents the limitations of restriction mediated cloning enabling you to access virtually any expression system in a simple one hour 99 efficient and reversible Gateway recombination reaction The ability to move the same sequence of DNA between different vectors without using restriction enzymes ligase subcloning steps screening of countless colonies or re sequencing will help save you time money and effort Leading Cloning TechnologiesWhen it comes to cloning TOPO cloning technology and Gateway recombination cloning technology have been a reliable partner for thousands of scientists for over ten years Fast simple to use and efficient TOPO cloning and Gateway recombination allow for rapid cloning and subsequent transferring of genes between a wide assortment of Gateway expression vectors Kit OptionsThe pENTR D TOPO Cloning Kit can be purchased with either TOP10 competent cells for standard cloning or Mach1 T1R competent cells for fast growth For Research Use Only Not intended for use in animal or human therapeutic or diagnostic use
Catalog Number:
k240020
Price:
None
Category:
DNA Vectors Clones Purified Nucleic Acids Libraries
Applications:
Cloning|Entry Vectors & Kits|Gateway Cloning|pENTR Vectors & Kits
|
Buy from Supplier |
Structured Review
Thermo Fisher
pentr topo vector
The pENTR D TOPO Cloning Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for entry into the Gateway System or the MultiSite Gateway System Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required The kit comes with everything necessary to clone and select your PCR amplified gene of interest • Gateway System Ready Rapidly shuttle cloned genes between multiple vector systems• Fast and Easy Go from PCR to Gateway Entry clone in just 3 steps and as little as 5 minutes hands on time• Efficient Achieve over 90 clones with correct insert in the right direction• Proven Reliable performance for over a decade pENTR D TOPO Cloning Kits Overview VECTOR pENTR D TOPO Vector Directional cloning vector for entry to the Gateway System CLONING METHOD Directional TOPO Cloning Topoisomerase I based 5 minute directional ligation of blunt end proofreading polymerase amplified PCR products to the vector COMPETENT CELLS Two Options Choose from kits with either high efficiency or fast growing competent cells Simple Access to the Gateway SystemFor access to the Gateway System just PCR amplify your gene of interest and add the product straight to the provided topoisomerase charged pENTR D TOPO vector incubate 5 minutes and transform the provided competent E coli cells The resulting attL containing Gateway Entry clones are ready for efficient recombination with your choice of Gateway Destination vectors Optimized pENTR D TOPO VectorThe pENTR D TOPO vector Figure 1 includes M13 and T7 primer sequencing sites and attL recombination sites flanking the PCR product insertion site This allows clones to be easily sequence verified and recombined into your choice of attR containing Gateway destination vectors A Kanamycin resistance gene and a pUC origin are used for selection and high copy propagation in E coli Simplified Directional CloningWith Directional TOPO cloning technology there is no need for PCR clean up vector preparation or other time intensive DNA manipulation steps Just add your PCR reaction straight to the provided topoisomerase charged vector incubate 5 minutes transform and obtain up to 90 directionally inserted clones A four base overhang on the vector pairs with a four base sequence designed into the forward primer used in your PCR reaction to provide directionality to the topoisomerase ligation reaction Figure 2 The Power of Gateway Recombination Cloning TechnologyGateway recombination cloning technology circumvents the limitations of restriction mediated cloning enabling you to access virtually any expression system in a simple one hour 99 efficient and reversible Gateway recombination reaction The ability to move the same sequence of DNA between different vectors without using restriction enzymes ligase subcloning steps screening of countless colonies or re sequencing will help save you time money and effort Leading Cloning TechnologiesWhen it comes to cloning TOPO cloning technology and Gateway recombination cloning technology have been a reliable partner for thousands of scientists for over ten years Fast simple to use and efficient TOPO cloning and Gateway recombination allow for rapid cloning and subsequent transferring of genes between a wide assortment of Gateway expression vectors Kit OptionsThe pENTR D TOPO Cloning Kit can be purchased with either TOP10 competent cells for standard cloning or Mach1 T1R competent cells for fast growth For Research Use Only Not intended for use in animal or human therapeutic or diagnostic use
https://www.bioz.com/result/pentr topo vector/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
The pENTR D TOPO Cloning Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for entry into the Gateway System or the MultiSite Gateway System Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required The kit comes with everything necessary to clone and select your PCR amplified gene of interest • Gateway System Ready Rapidly shuttle cloned genes between multiple vector systems• Fast and Easy Go from PCR to Gateway Entry clone in just 3 steps and as little as 5 minutes hands on time• Efficient Achieve over 90 clones with correct insert in the right direction• Proven Reliable performance for over a decade pENTR D TOPO Cloning Kits Overview VECTOR pENTR D TOPO Vector Directional cloning vector for entry to the Gateway System CLONING METHOD Directional TOPO Cloning Topoisomerase I based 5 minute directional ligation of blunt end proofreading polymerase amplified PCR products to the vector COMPETENT CELLS Two Options Choose from kits with either high efficiency or fast growing competent cells Simple Access to the Gateway SystemFor access to the Gateway System just PCR amplify your gene of interest and add the product straight to the provided topoisomerase charged pENTR D TOPO vector incubate 5 minutes and transform the provided competent E coli cells The resulting attL containing Gateway Entry clones are ready for efficient recombination with your choice of Gateway Destination vectors Optimized pENTR D TOPO VectorThe pENTR D TOPO vector Figure 1 includes M13 and T7 primer sequencing sites and attL recombination sites flanking the PCR product insertion site This allows clones to be easily sequence verified and recombined into your choice of attR containing Gateway destination vectors A Kanamycin resistance gene and a pUC origin are used for selection and high copy propagation in E coli Simplified Directional CloningWith Directional TOPO cloning technology there is no need for PCR clean up vector preparation or other time intensive DNA manipulation steps Just add your PCR reaction straight to the provided topoisomerase charged vector incubate 5 minutes transform and obtain up to 90 directionally inserted clones A four base overhang on the vector pairs with a four base sequence designed into the forward primer used in your PCR reaction to provide directionality to the topoisomerase ligation reaction Figure 2 The Power of Gateway Recombination Cloning TechnologyGateway recombination cloning technology circumvents the limitations of restriction mediated cloning enabling you to access virtually any expression system in a simple one hour 99 efficient and reversible Gateway recombination reaction The ability to move the same sequence of DNA between different vectors without using restriction enzymes ligase subcloning steps screening of countless colonies or re sequencing will help save you time money and effort Leading Cloning TechnologiesWhen it comes to cloning TOPO cloning technology and Gateway recombination cloning technology have been a reliable partner for thousands of scientists for over ten years Fast simple to use and efficient TOPO cloning and Gateway recombination allow for rapid cloning and subsequent transferring of genes between a wide assortment of Gateway expression vectors Kit OptionsThe pENTR D TOPO Cloning Kit can be purchased with either TOP10 competent cells for standard cloning or Mach1 T1R competent cells for fast growth For Research Use Only Not intended for use in animal or human therapeutic or diagnostic use
https://www.bioz.com/result/pentr topo vector/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
pentr topo vector - by Bioz Stars,
2021-03
99/100 stars
Images
Related Articles
Clone Assay:Article Title: Earthworm symbiont Verminephrobacter eiseniae mediates natural transformation within host egg capsules using type IV pili Article Snippet: DNA fragments, upstream and downstream of the pilT gene, ∼1 Kb in size were amplified from EF05-2r genomic DNA, using primers pilTsec1FwdGD (5′-GCC CTA GGT CGC TCG CTC CGG TAT GCG GCG C-3′), pilTsec1RevGD (5′-GCA AGC TTG GCG CGC TTT CGC GTC AAC GCC-3′), Xho1pilTFwd (5′-GCC TCG AGC CCT CCA TCG TTG CGG GTG A-3′) and Xba1pilTRev (5′-GCT CTA GAA AGG CCG CAT CAG CGT GCA G-3′). .. Fragments were cloned into Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the Article Title: An Entry/Gateway® cloning system for general expression of genes with molecular tags in Drosophila melanogaster Article Snippet: .. We compared the pGWS result with other LR reactions we performed with Article Title: Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana Article Snippet: Cloning of single RNAi plasmids and controls Single GSTs were amplified from an A. thaliana Col-0 cDNA template using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific Inc.,) and primers listed in Additional file : Table S1 according to the manufacturer’s protocols. .. 5′-CACC-3′ overhangs were introduced with the PCR primers to facilitate directional cloning into Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the Article Title: Overexpression of SRS5 improves grain size of brassinosteroid-related dwarf mutants in rice (Oryza sativa L.) Article Snippet: The amplicon was subcloned into an entry vector pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA). .. The DNA fragment containing the full-length SRS5 cDNA in pENTER/D-TOPO was inserted into a binary vector p2KG by the gateway method described in the manual of the Plasmid Preparation:Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology Article Snippet: .. The blunt-end PCR products were then TOPO-cloned into Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the Article Title: Overexpression of SRS5 improves grain size of brassinosteroid-related dwarf mutants in rice (Oryza sativa L.) Article Snippet: The amplicon was subcloned into an entry vector pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA). .. The DNA fragment containing the full-length SRS5 cDNA in pENTER/D-TOPO was inserted into a binary vector p2KG by the gateway method described in the manual of the Article Title: Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity. Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity Article Snippet: Insert DNA was amplified from the genomic DNA of KaB01 via PCR, using Prime Star polymerase (Takara Bio, Shiga, Japan) and primers 5′‐CACCATGAAGACACTTTCCAGCGC‐3′ and 5′‐TGGCAAATGCCTCTCAAGG‐3′. .. Subcloned PCR products in the Transgenic Assay:Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the Polymerase Chain Reaction:Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology Article Snippet: .. The blunt-end PCR products were then TOPO-cloned into Article Title: Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana Article Snippet: Cloning of single RNAi plasmids and controls Single GSTs were amplified from an A. thaliana Col-0 cDNA template using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific Inc.,) and primers listed in Additional file : Table S1 according to the manufacturer’s protocols. .. 5′-CACC-3′ overhangs were introduced with the PCR primers to facilitate directional cloning into Article Title: Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity. Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity Article Snippet: Insert DNA was amplified from the genomic DNA of KaB01 via PCR, using Prime Star polymerase (Takara Bio, Shiga, Japan) and primers 5′‐CACCATGAAGACACTTTCCAGCGC‐3′ and 5′‐TGGCAAATGCCTCTCAAGG‐3′. .. Subcloned PCR products in the Sequencing:Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the Amplification:Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the |
