pentr topo vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pENTR D TOPO Cloning Kit
    Description:
    The pENTR D TOPO Cloning Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for entry into the Gateway System or the MultiSite Gateway System Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required The kit comes with everything necessary to clone and select your PCR amplified gene of interest • Gateway System Ready Rapidly shuttle cloned genes between multiple vector systems• Fast and Easy Go from PCR to Gateway Entry clone in just 3 steps and as little as 5 minutes hands on time• Efficient Achieve over 90 clones with correct insert in the right direction• Proven Reliable performance for over a decade pENTR D TOPO Cloning Kits Overview VECTOR pENTR D TOPO Vector Directional cloning vector for entry to the Gateway System CLONING METHOD Directional TOPO Cloning Topoisomerase I based 5 minute directional ligation of blunt end proofreading polymerase amplified PCR products to the vector COMPETENT CELLS Two Options Choose from kits with either high efficiency or fast growing competent cells Simple Access to the Gateway SystemFor access to the Gateway System just PCR amplify your gene of interest and add the product straight to the provided topoisomerase charged pENTR D TOPO vector incubate 5 minutes and transform the provided competent E coli cells The resulting attL containing Gateway Entry clones are ready for efficient recombination with your choice of Gateway Destination vectors Optimized pENTR D TOPO VectorThe pENTR D TOPO vector Figure 1 includes M13 and T7 primer sequencing sites and attL recombination sites flanking the PCR product insertion site This allows clones to be easily sequence verified and recombined into your choice of attR containing Gateway destination vectors A Kanamycin resistance gene and a pUC origin are used for selection and high copy propagation in E coli Simplified Directional CloningWith Directional TOPO cloning technology there is no need for PCR clean up vector preparation or other time intensive DNA manipulation steps Just add your PCR reaction straight to the provided topoisomerase charged vector incubate 5 minutes transform and obtain up to 90 directionally inserted clones A four base overhang on the vector pairs with a four base sequence designed into the forward primer used in your PCR reaction to provide directionality to the topoisomerase ligation reaction Figure 2 The Power of Gateway Recombination Cloning TechnologyGateway recombination cloning technology circumvents the limitations of restriction mediated cloning enabling you to access virtually any expression system in a simple one hour 99 efficient and reversible Gateway recombination reaction The ability to move the same sequence of DNA between different vectors without using restriction enzymes ligase subcloning steps screening of countless colonies or re sequencing will help save you time money and effort Leading Cloning TechnologiesWhen it comes to cloning TOPO cloning technology and Gateway recombination cloning technology have been a reliable partner for thousands of scientists for over ten years Fast simple to use and efficient TOPO cloning and Gateway recombination allow for rapid cloning and subsequent transferring of genes between a wide assortment of Gateway expression vectors Kit OptionsThe pENTR D TOPO Cloning Kit can be purchased with either TOP10 competent cells for standard cloning or Mach1 T1R competent cells for fast growth For Research Use Only Not intended for use in animal or human therapeutic or diagnostic use
    Catalog Number:
    k240020
    Price:
    None
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Applications:
    Cloning|Entry Vectors & Kits|Gateway Cloning|pENTR Vectors & Kits
    Buy from Supplier


    Structured Review

    Thermo Fisher pentr topo vector
    The pENTR D TOPO Cloning Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for entry into the Gateway System or the MultiSite Gateway System Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required The kit comes with everything necessary to clone and select your PCR amplified gene of interest • Gateway System Ready Rapidly shuttle cloned genes between multiple vector systems• Fast and Easy Go from PCR to Gateway Entry clone in just 3 steps and as little as 5 minutes hands on time• Efficient Achieve over 90 clones with correct insert in the right direction• Proven Reliable performance for over a decade pENTR D TOPO Cloning Kits Overview VECTOR pENTR D TOPO Vector Directional cloning vector for entry to the Gateway System CLONING METHOD Directional TOPO Cloning Topoisomerase I based 5 minute directional ligation of blunt end proofreading polymerase amplified PCR products to the vector COMPETENT CELLS Two Options Choose from kits with either high efficiency or fast growing competent cells Simple Access to the Gateway SystemFor access to the Gateway System just PCR amplify your gene of interest and add the product straight to the provided topoisomerase charged pENTR D TOPO vector incubate 5 minutes and transform the provided competent E coli cells The resulting attL containing Gateway Entry clones are ready for efficient recombination with your choice of Gateway Destination vectors Optimized pENTR D TOPO VectorThe pENTR D TOPO vector Figure 1 includes M13 and T7 primer sequencing sites and attL recombination sites flanking the PCR product insertion site This allows clones to be easily sequence verified and recombined into your choice of attR containing Gateway destination vectors A Kanamycin resistance gene and a pUC origin are used for selection and high copy propagation in E coli Simplified Directional CloningWith Directional TOPO cloning technology there is no need for PCR clean up vector preparation or other time intensive DNA manipulation steps Just add your PCR reaction straight to the provided topoisomerase charged vector incubate 5 minutes transform and obtain up to 90 directionally inserted clones A four base overhang on the vector pairs with a four base sequence designed into the forward primer used in your PCR reaction to provide directionality to the topoisomerase ligation reaction Figure 2 The Power of Gateway Recombination Cloning TechnologyGateway recombination cloning technology circumvents the limitations of restriction mediated cloning enabling you to access virtually any expression system in a simple one hour 99 efficient and reversible Gateway recombination reaction The ability to move the same sequence of DNA between different vectors without using restriction enzymes ligase subcloning steps screening of countless colonies or re sequencing will help save you time money and effort Leading Cloning TechnologiesWhen it comes to cloning TOPO cloning technology and Gateway recombination cloning technology have been a reliable partner for thousands of scientists for over ten years Fast simple to use and efficient TOPO cloning and Gateway recombination allow for rapid cloning and subsequent transferring of genes between a wide assortment of Gateway expression vectors Kit OptionsThe pENTR D TOPO Cloning Kit can be purchased with either TOP10 competent cells for standard cloning or Mach1 T1R competent cells for fast growth For Research Use Only Not intended for use in animal or human therapeutic or diagnostic use
    https://www.bioz.com/result/pentr topo vector/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pentr topo vector - by Bioz Stars, 2021-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Earthworm symbiont Verminephrobacter eiseniae mediates natural transformation within host egg capsules using type IV pili
    Article Snippet: DNA fragments, upstream and downstream of the pilT gene, ∼1 Kb in size were amplified from EF05-2r genomic DNA, using primers pilTsec1FwdGD (5′-GCC CTA GGT CGC TCG CTC CGG TAT GCG GCG C-3′), pilTsec1RevGD (5′-GCA AGC TTG GCG CGC TTT CGC GTC AAC GCC-3′), Xho1pilTFwd (5′-GCC TCG AGC CCT CCA TCG TTG CGG GTG A-3′) and Xba1pilTRev (5′-GCT CTA GAA AGG CCG CAT CAG CGT GCA G-3′). .. Fragments were cloned into pENTR/D-Topo-MCS:kan (Invitrogen Life Technologies, USA) flanking the kanamycin resistance gene to create pENTR/D-Topo-MCS:kanpilT . .. NT of V. eiseniae EF05-2r was performed, described below, and mutants were screened for marker insertion.

    Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system
    Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the pENTR_D-TOPO cloning vector (Invitrogen), released from the vector by digesting with Sma I, and inserted into the plasmid pMSG1.1MG to yield pFeIFN-α15/MSG1.1MG for generation of transgenic silkworms [ , ]. .. pFeIFN-α15/MSG1.1MG was injected, along with the helper vector pHA3PIG [ ], into pre-blastoderm silkworm embryos as described [ ].

    Article Title: An Entry/Gateway® cloning system for general expression of genes with molecular tags in Drosophila melanogaster
    Article Snippet: .. We compared the pGWS result with other LR reactions we performed with pENTR/D-TOPO (Invitrogen) entry clones, and the LR reaction efficiencies are very similar between pGWS-based and pENTR/D-TOPO-based entry clones (data not shown). .. A set of P-element based Gateway® destination vectors for general expression of epitope-tagged fusion protein in flies In addition to the entry vector, we also created a set of P-element destination vectors (P-DESTs) for expressing tagged fusion proteins in Drosophila melanogaster .

    Article Title: Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana
    Article Snippet: Cloning of single RNAi plasmids and controls Single GSTs were amplified from an A. thaliana Col-0 cDNA template using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific Inc.,) and primers listed in Additional file : Table S1 according to the manufacturer’s protocols. .. 5′-CACC-3′ overhangs were introduced with the PCR primers to facilitate directional cloning into pENTR™/D-TOPO (Life Technologies). .. Gel purified PCR products were subcloned into pENTR™/D-TOPO and resulting pENTR clones were verified by sequencing.

    Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato
    Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the pENTR/D-TOPO vector by Gateway recombination-based cloning (TOPO cloning kit, Invitrogen). .. The cDNAs in the resulting pENTR-AtASAT1, pENTR-SlASAT1, and pENTR-SlPSAT1 plasmids were sequenced to exclude the presence of amplification mutations.

    Article Title: Overexpression of SRS5 improves grain size of brassinosteroid-related dwarf mutants in rice (Oryza sativa L.)
    Article Snippet: The amplicon was subcloned into an entry vector pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA). .. The DNA fragment containing the full-length SRS5 cDNA in pENTER/D-TOPO was inserted into a binary vector p2KG by the gateway method described in the manual of the pENTR/D-TOPO cloning kit (Invitrogen, USA). .. The SRS5 cDNA, controlled by the ubiquitin promoter in p2KG, was introduced into the Agrobacterium tumefaciens strain EHA105 ( ) by electroporation and transformed into the WT, d2-2 , and d61-2 as reported previously ( ).

    Plasmid Preparation:

    Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system
    Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the pENTR_D-TOPO cloning vector (Invitrogen), released from the vector by digesting with Sma I, and inserted into the plasmid pMSG1.1MG to yield pFeIFN-α15/MSG1.1MG for generation of transgenic silkworms [ , ]. .. pFeIFN-α15/MSG1.1MG was injected, along with the helper vector pHA3PIG [ ], into pre-blastoderm silkworm embryos as described [ ].

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: .. The blunt-end PCR products were then TOPO-cloned into pENTR TOPO/D vector according to the manufacturer’s protocol (Invitrogen, USA). ..

    Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato
    Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the pENTR/D-TOPO vector by Gateway recombination-based cloning (TOPO cloning kit, Invitrogen). .. The cDNAs in the resulting pENTR-AtASAT1, pENTR-SlASAT1, and pENTR-SlPSAT1 plasmids were sequenced to exclude the presence of amplification mutations.

    Article Title: Overexpression of SRS5 improves grain size of brassinosteroid-related dwarf mutants in rice (Oryza sativa L.)
    Article Snippet: The amplicon was subcloned into an entry vector pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA). .. The DNA fragment containing the full-length SRS5 cDNA in pENTER/D-TOPO was inserted into a binary vector p2KG by the gateway method described in the manual of the pENTR/D-TOPO cloning kit (Invitrogen, USA). .. The SRS5 cDNA, controlled by the ubiquitin promoter in p2KG, was introduced into the Agrobacterium tumefaciens strain EHA105 ( ) by electroporation and transformed into the WT, d2-2 , and d61-2 as reported previously ( ).

    Article Title: Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity. Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity
    Article Snippet: Insert DNA was amplified from the genomic DNA of KaB01 via PCR, using Prime Star polymerase (Takara Bio, Shiga, Japan) and primers 5′‐CACCATGAAGACACTTTCCAGCGC‐3′ and 5′‐TGGCAAATGCCTCTCAAGG‐3′. .. Subcloned PCR products in the vector pENTR/D‐TOPO (Life Technologies, Carlsbad, CA) were then transferred to a binary vector pGWB502omega (Nakagawa et al., ), via the LR reaction. .. The transformation of rice was mediated by an agrobacterium, as described by Toki et al. , using the Agrobacterium tumefaciens strain EHA105.

    Transgenic Assay:

    Article Title: Novel recombinant feline interferon carrying N-glycans with reduced allergy risk produced by a transgenic silkworm system
    Article Snippet: The 5′-untranslated region (UTR) sequence of Bombyx mori nuclear polyhedrosis virus (BmNPV) polyhedrin [ , ] was inserted upstream of the cDNAs by this PCR amplification using the primers 5’-CAC CCCCGGG AAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCTGTGACCTGCCTCAGACCCACG-3′ (forward) and 5’- CCCGGG TTATTTCTCGCTCCTTAATCTTTTCTGC-3′ (reverse), where the bold letters indicate a restriction site for the enzyme Sma I. .. The resulting fragment was inserted into the pENTR_D-TOPO cloning vector (Invitrogen), released from the vector by digesting with Sma I, and inserted into the plasmid pMSG1.1MG to yield pFeIFN-α15/MSG1.1MG for generation of transgenic silkworms [ , ]. .. pFeIFN-α15/MSG1.1MG was injected, along with the helper vector pHA3PIG [ ], into pre-blastoderm silkworm embryos as described [ ].

    Polymerase Chain Reaction:

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: .. The blunt-end PCR products were then TOPO-cloned into pENTR TOPO/D vector according to the manufacturer’s protocol (Invitrogen, USA). ..

    Article Title: Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana
    Article Snippet: Cloning of single RNAi plasmids and controls Single GSTs were amplified from an A. thaliana Col-0 cDNA template using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific Inc.,) and primers listed in Additional file : Table S1 according to the manufacturer’s protocols. .. 5′-CACC-3′ overhangs were introduced with the PCR primers to facilitate directional cloning into pENTR™/D-TOPO (Life Technologies). .. Gel purified PCR products were subcloned into pENTR™/D-TOPO and resulting pENTR clones were verified by sequencing.

    Article Title: Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity. Overexpression of exogenous biuret hydrolase in rice plants confers tolerance to biuret toxicity
    Article Snippet: Insert DNA was amplified from the genomic DNA of KaB01 via PCR, using Prime Star polymerase (Takara Bio, Shiga, Japan) and primers 5′‐CACCATGAAGACACTTTCCAGCGC‐3′ and 5′‐TGGCAAATGCCTCTCAAGG‐3′. .. Subcloned PCR products in the vector pENTR/D‐TOPO (Life Technologies, Carlsbad, CA) were then transferred to a binary vector pGWB502omega (Nakagawa et al., ), via the LR reaction. .. The transformation of rice was mediated by an agrobacterium, as described by Toki et al. , using the Agrobacterium tumefaciens strain EHA105.

    Sequencing:

    Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato
    Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the pENTR/D-TOPO vector by Gateway recombination-based cloning (TOPO cloning kit, Invitrogen). .. The cDNAs in the resulting pENTR-AtASAT1, pENTR-SlASAT1, and pENTR-SlPSAT1 plasmids were sequenced to exclude the presence of amplification mutations.

    Amplification:

    Article Title: Identification and Characterization of Sterol Acyltransferases Responsible for Steryl Ester Biosynthesis in Tomato
    Article Snippet: RNA isolation and cDNA synthesis were performed as described previously ( ). .. The CACC sequence was added to the 5′ end of the forward primers to facilitate directional insertion of the amplified sequences into the pENTR/D-TOPO vector by Gateway recombination-based cloning (TOPO cloning kit, Invitrogen). .. The cDNAs in the resulting pENTR-AtASAT1, pENTR-SlASAT1, and pENTR-SlPSAT1 plasmids were sequenced to exclude the presence of amplification mutations.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pentr topo d vector
    A; Diagram of the construction of the entry and expression clones. The HepG2 cell line was used as a source of FVII cDNA. Blunt-end PCR product was TOPO-cloned into the <t>pENTR</t> <t>TOPO/D</t> vector. The construct was used to transform competent E. coli and positive clones were selected on LB medium containing an appropriate antibiotic. This construct is called the entry clone. Next, LR recombinant reaction was carried out between pENTR TOPO/D-FVII and pDEST26 vector to construct the expression clone. The resulting pDEST26-FVII, which is called the expression clone, was transfected into CHO cells. Stable clones expressing recombinant FVII were established in the presence of geneticin. B; pDEST26 vector. C; N-terminal sequence of the fusion protein.
    Pentr Topo D Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pentr topo d vector/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pentr topo d vector - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher pentr d topo gateway entry vector
    Wnt cloning scheme using WNT1 as an example. WNT1 cDNA was amplified by PCR using WNT1 -specific “STOP” and “Non-STOP” primers. The PCR product was then transferred, using <t>TOPO</t> cloning, into the <t>pENTR/D-TOPO</t> Gateway Entry
    Pentr D Topo Gateway Entry Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pentr d topo gateway entry vector/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pentr d topo gateway entry vector - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher pentr topo vector
    Wnt cloning scheme using WNT1 as an example. WNT1 cDNA was amplified by PCR using WNT1 -specific “STOP” and “Non-STOP” primers. The PCR product was then transferred, using <t>TOPO</t> cloning, into the <t>pENTR/D-TOPO</t> Gateway Entry
    Pentr Topo Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pentr topo vector/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pentr topo vector - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    Image Search Results


    A; Diagram of the construction of the entry and expression clones. The HepG2 cell line was used as a source of FVII cDNA. Blunt-end PCR product was TOPO-cloned into the pENTR TOPO/D vector. The construct was used to transform competent E. coli and positive clones were selected on LB medium containing an appropriate antibiotic. This construct is called the entry clone. Next, LR recombinant reaction was carried out between pENTR TOPO/D-FVII and pDEST26 vector to construct the expression clone. The resulting pDEST26-FVII, which is called the expression clone, was transfected into CHO cells. Stable clones expressing recombinant FVII were established in the presence of geneticin. B; pDEST26 vector. C; N-terminal sequence of the fusion protein.

    Journal: Blood Transfusion

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology

    doi: 10.2450/2009.0081-08

    Figure Lengend Snippet: A; Diagram of the construction of the entry and expression clones. The HepG2 cell line was used as a source of FVII cDNA. Blunt-end PCR product was TOPO-cloned into the pENTR TOPO/D vector. The construct was used to transform competent E. coli and positive clones were selected on LB medium containing an appropriate antibiotic. This construct is called the entry clone. Next, LR recombinant reaction was carried out between pENTR TOPO/D-FVII and pDEST26 vector to construct the expression clone. The resulting pDEST26-FVII, which is called the expression clone, was transfected into CHO cells. Stable clones expressing recombinant FVII were established in the presence of geneticin. B; pDEST26 vector. C; N-terminal sequence of the fusion protein.

    Article Snippet: The blunt-end PCR products were then TOPO-cloned into pENTR TOPO/D vector according to the manufacturer’s protocol (Invitrogen, USA).

    Techniques: Expressing, Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, Construct, Recombinant, Transfection, Sequencing

    Wnt cloning scheme using WNT1 as an example. WNT1 cDNA was amplified by PCR using WNT1 -specific “STOP” and “Non-STOP” primers. The PCR product was then transferred, using TOPO cloning, into the pENTR/D-TOPO Gateway Entry

    Journal: Differentiation; research in biological diversity

    Article Title: A uniform human Wnt expression library reveals a shared secretory pathway and unique signaling activities

    doi: 10.1016/j.diff.2012.06.004

    Figure Lengend Snippet: Wnt cloning scheme using WNT1 as an example. WNT1 cDNA was amplified by PCR using WNT1 -specific “STOP” and “Non-STOP” primers. The PCR product was then transferred, using TOPO cloning, into the pENTR/D-TOPO Gateway Entry

    Article Snippet: 4 μL of each PCR reaction were TOPO-cloned into the pENTR/D-TOPO Gateway Entry vector following the manufacturer’s protocol (pENTR Directional TOPO Cloning Kits, Invitrogen).

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction