pentr 1a vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Gateway pENTR 1A Dual Selection Vector
    Description:
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    Catalog Number:
    a10462
    Price:
    None
    Applications:
    Cloning|Entry Vectors & Kits|Gateway Cloning
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier


    Structured Review

    Thermo Fisher pentr 1a vector
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    https://www.bioz.com/result/pentr 1a vector/product/Thermo Fisher
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    pentr 1a vector - by Bioz Stars, 2021-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: PKA phosphorylation underlies functional recruitment of sarcolemmal SK2 channels in ventricular myocytes from hypertrophic hearts
    Article Snippet: .. Briefly, the coding region of rat SK2 sequence was cloned into pENTR™ 1A vector, and then recombined into pAd/CMV/V5‐DEST™ with the LR recombination reaction. .. Sequence‐verified plasmid was digested with restriction enzyme Pac I, before transfection into HEK293A cells (RRID:CVCL_6910) using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host
    Article Snippet: .. The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service. .. To study the timing of SP removal, the 24 bp DDK tag sequence (also referred to as FLAG) was inserted downstream the SP by a PCR site-direct mutagenesis approach.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Synthesized:

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host
    Article Snippet: .. The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service. .. To study the timing of SP removal, the 24 bp DDK tag sequence (also referred to as FLAG) was inserted downstream the SP by a PCR site-direct mutagenesis approach.

    Isolation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Ligation:

    Article Title: Viral-mediated noisy gene expression reveals biphasic E2f1 response to MYC
    Article Snippet: .. A BamHI/XhoI fragment from either EYFP-TOPO or MYC-EYFP-TOPO was subcloned into the corresponding sites of the Gateway pENTR1A vector (Cat. no. 11813-011; Invitrogen). pENTR1A construct containing native c -Myc was generated by XhoI/AgeI digestion of MYC-EYFP-TOPO followed by blunt-ending with Klenow and ligation of the formerly cohesive ends. .. For construction of E2f1 based adenoviral vectors, a BamHI/EcoRI fragment from pS65LHA-E2F1 (Addgene plasmid 10736) ( ) was subcloned into pENTR1A.

    Construct:

    Article Title: Viral-mediated noisy gene expression reveals biphasic E2f1 response to MYC
    Article Snippet: .. A BamHI/XhoI fragment from either EYFP-TOPO or MYC-EYFP-TOPO was subcloned into the corresponding sites of the Gateway pENTR1A vector (Cat. no. 11813-011; Invitrogen). pENTR1A construct containing native c -Myc was generated by XhoI/AgeI digestion of MYC-EYFP-TOPO followed by blunt-ending with Klenow and ligation of the formerly cohesive ends. .. For construction of E2f1 based adenoviral vectors, a BamHI/EcoRI fragment from pS65LHA-E2F1 (Addgene plasmid 10736) ( ) was subcloned into pENTR1A.

    Sequencing:

    Article Title: PKA phosphorylation underlies functional recruitment of sarcolemmal SK2 channels in ventricular myocytes from hypertrophic hearts
    Article Snippet: .. Briefly, the coding region of rat SK2 sequence was cloned into pENTR™ 1A vector, and then recombined into pAd/CMV/V5‐DEST™ with the LR recombination reaction. .. Sequence‐verified plasmid was digested with restriction enzyme Pac I, before transfection into HEK293A cells (RRID:CVCL_6910) using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host
    Article Snippet: .. The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service. .. To study the timing of SP removal, the 24 bp DDK tag sequence (also referred to as FLAG) was inserted downstream the SP by a PCR site-direct mutagenesis approach.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Generated:

    Article Title: Viral-mediated noisy gene expression reveals biphasic E2f1 response to MYC
    Article Snippet: .. A BamHI/XhoI fragment from either EYFP-TOPO or MYC-EYFP-TOPO was subcloned into the corresponding sites of the Gateway pENTR1A vector (Cat. no. 11813-011; Invitrogen). pENTR1A construct containing native c -Myc was generated by XhoI/AgeI digestion of MYC-EYFP-TOPO followed by blunt-ending with Klenow and ligation of the formerly cohesive ends. .. For construction of E2f1 based adenoviral vectors, a BamHI/EcoRI fragment from pS65LHA-E2F1 (Addgene plasmid 10736) ( ) was subcloned into pENTR1A.

    Modification:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Plasmid Preparation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: PKA phosphorylation underlies functional recruitment of sarcolemmal SK2 channels in ventricular myocytes from hypertrophic hearts
    Article Snippet: .. Briefly, the coding region of rat SK2 sequence was cloned into pENTR™ 1A vector, and then recombined into pAd/CMV/V5‐DEST™ with the LR recombination reaction. .. Sequence‐verified plasmid was digested with restriction enzyme Pac I, before transfection into HEK293A cells (RRID:CVCL_6910) using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA).

    Article Title: Viral-mediated noisy gene expression reveals biphasic E2f1 response to MYC
    Article Snippet: .. A BamHI/XhoI fragment from either EYFP-TOPO or MYC-EYFP-TOPO was subcloned into the corresponding sites of the Gateway pENTR1A vector (Cat. no. 11813-011; Invitrogen). pENTR1A construct containing native c -Myc was generated by XhoI/AgeI digestion of MYC-EYFP-TOPO followed by blunt-ending with Klenow and ligation of the formerly cohesive ends. .. For construction of E2f1 based adenoviral vectors, a BamHI/EcoRI fragment from pS65LHA-E2F1 (Addgene plasmid 10736) ( ) was subcloned into pENTR1A.

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation
    Article Snippet: .. The pCMV6-Entry vector without the Men1 insert was used as a control. .. Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host
    Article Snippet: .. The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service. .. To study the timing of SP removal, the 24 bp DDK tag sequence (also referred to as FLAG) was inserted downstream the SP by a PCR site-direct mutagenesis approach.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pcmv6 entry vector
    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with <t>pCMV6-MEN1</t> vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P
    Pcmv6 Entry Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6 entry vector/product/Thermo Fisher
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    pcmv6 entry vector - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Article Snippet: The pCMV6-Entry vector without the Men1 insert was used as a control.

    Techniques: Expressing, Plasmid Preparation, Marker, Real-time Polymerase Chain Reaction, Flow Cytometry, Migration, Wound Healing Assay, Boyden Chamber Assay

    Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Article Snippet: The pCMV6-Entry vector without the Men1 insert was used as a control.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Knock-Out

    Time-course analysis of UL144 gtA and gtB intracellular trafficking. HeLa cells were transfected with pCMV6-UL144 gtA and pCMV6-UL144 gtB and fixed at different time points. Three, four and five hours post transfection cells were immunostained with anti-DDK (green) and anti-Sec61A (red) Abs ( A ) or with anti-DDK (green) and anti-Calreticulin (red) Abs ( B ). Nuclei were counterstained with DAPI. Yellow indicates co-localization. Scale bar: 10 μm. Pearson’s correlation coefficients for DDK/Sec61A and DDK/Calreticulin co-localization are reported in the graphs as mean ± SEM (two way ANOVA; n > 25) (*, P

    Journal: PLoS Pathogens

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host

    doi: 10.1371/journal.ppat.1008476

    Figure Lengend Snippet: Time-course analysis of UL144 gtA and gtB intracellular trafficking. HeLa cells were transfected with pCMV6-UL144 gtA and pCMV6-UL144 gtB and fixed at different time points. Three, four and five hours post transfection cells were immunostained with anti-DDK (green) and anti-Sec61A (red) Abs ( A ) or with anti-DDK (green) and anti-Calreticulin (red) Abs ( B ). Nuclei were counterstained with DAPI. Yellow indicates co-localization. Scale bar: 10 μm. Pearson’s correlation coefficients for DDK/Sec61A and DDK/Calreticulin co-localization are reported in the graphs as mean ± SEM (two way ANOVA; n > 25) (*, P

    Article Snippet: The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service.

    Techniques: Transfection

    Functional analysis of positively selected sites in the UL144 SP. HeLa cells were transfected with pCMV6-UL144 gtA and pCMV6-UL144 gtB. Twenty-four hours later, cells were fixed and immunostained. (A) Localization at the plasma membrane. Cells were stained with antibodies against the DDK tag (green) and the plasma membrane protein sodium potassium ATPase (red). Nuclei were counterstained with DAPI. Arrows indicates localization at the plasma membrane. Scale bar: 10 μm. (B) Localization in the endo-lysosomal compartment. Cells were immunostained with antibodies against the DDK tag (green), the lysosomal marker LAMP1 (red) and the early endosomal marker EEA1 (blue). Co-localization of DDK with LAMP1 (yellow) or EEA1 (light blue) is shown in the merge images. The small panels show an higher magnification of the area indicated in the squares. Scale bar: 10 μm. Pearson’s correlation coefficients for DDK/LAMP1 and DDK/EEA1 co-localization are reported in the graphs as mean ± SEM ( t test; n > 30) (**, P

    Journal: PLoS Pathogens

    Article Title: Past and ongoing adaptation of human cytomegalovirus to its host

    doi: 10.1371/journal.ppat.1008476

    Figure Lengend Snippet: Functional analysis of positively selected sites in the UL144 SP. HeLa cells were transfected with pCMV6-UL144 gtA and pCMV6-UL144 gtB. Twenty-four hours later, cells were fixed and immunostained. (A) Localization at the plasma membrane. Cells were stained with antibodies against the DDK tag (green) and the plasma membrane protein sodium potassium ATPase (red). Nuclei were counterstained with DAPI. Arrows indicates localization at the plasma membrane. Scale bar: 10 μm. (B) Localization in the endo-lysosomal compartment. Cells were immunostained with antibodies against the DDK tag (green), the lysosomal marker LAMP1 (red) and the early endosomal marker EEA1 (blue). Co-localization of DDK with LAMP1 (yellow) or EEA1 (light blue) is shown in the merge images. The small panels show an higher magnification of the area indicated in the squares. Scale bar: 10 μm. Pearson’s correlation coefficients for DDK/LAMP1 and DDK/EEA1 co-localization are reported in the graphs as mean ± SEM ( t test; n > 30) (**, P

    Article Snippet: The sequence of UL144 (gtB) was synthesized and cloned in pCMV6-Entry vector by Origene custom service.

    Techniques: Functional Assay, Transfection, Staining, Marker