Structured Review

TaKaRa pegfp n3
MmHSP90ab1 was involved in RGNNV internalization. (A) RT-PCR analysis of CP (-) sequence. HEK293T cells were transfected with <t>pEGFP-N3</t> empty vector (1, 5, and 9), pEGFP-MmHSP90ab1 (2, 6, and 10), pEGFP-MmHSC70 (3, 7 and 11), or both pEGFP-MmHSP90ab1 and pEGFP-MmHSC70 (4, 8, and 12) plasmids for 24 h, respectively. Then cells were infected with RGNNV (MOI = 5) for 4 h. Next, the cells were washed to remove any unbound viruses and incubated for 24 h (1–4), 48 h (5–8) and 72 h (9–12). Cells were harvested and total RNA was extracted for CP (-) detection by qRT-PCR. Human 18S rRNA was detected as reference. (B) Transmission electron micrograph of RGNNV-infected hMMES1 cells and HEK293T cells transfected with pEGFP-N3 empty vector, pEGFP-MmHSP90ab1 or pEGFP-MmHSC70 with 80,000 magnifications. Bar = 200 nm. (C) Immunofluorescence analysis of MmHSP90ab1 and CP proteins. HEK293T cells transfected with pCMV-Flag empty vector or pCMV-Flag-MmHSP90ab1 were infected with RGNNV (MOI = 5) for 24 h, CP (Green) and MmHSP90ab1 (Red) were detected by immunofluorescence staining. Cell nuclei were stained with Hoechst 33342. Bar = 10 μm.
Pegfp N3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 239 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pegfp n3/product/TaKaRa
Average 94 stars, based on 239 article reviews
Price from $9.99 to $1999.99
pegfp n3 - by Bioz Stars, 2020-09
94/100 stars

Images

1) Product Images from "Marine medaka heat shock protein 90ab1 is a receptor for red-spotted grouper nervous necrosis virus and promotes virus internalization through clathrin-mediated endocytosis"

Article Title: Marine medaka heat shock protein 90ab1 is a receptor for red-spotted grouper nervous necrosis virus and promotes virus internalization through clathrin-mediated endocytosis

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1008668

MmHSP90ab1 was involved in RGNNV internalization. (A) RT-PCR analysis of CP (-) sequence. HEK293T cells were transfected with pEGFP-N3 empty vector (1, 5, and 9), pEGFP-MmHSP90ab1 (2, 6, and 10), pEGFP-MmHSC70 (3, 7 and 11), or both pEGFP-MmHSP90ab1 and pEGFP-MmHSC70 (4, 8, and 12) plasmids for 24 h, respectively. Then cells were infected with RGNNV (MOI = 5) for 4 h. Next, the cells were washed to remove any unbound viruses and incubated for 24 h (1–4), 48 h (5–8) and 72 h (9–12). Cells were harvested and total RNA was extracted for CP (-) detection by qRT-PCR. Human 18S rRNA was detected as reference. (B) Transmission electron micrograph of RGNNV-infected hMMES1 cells and HEK293T cells transfected with pEGFP-N3 empty vector, pEGFP-MmHSP90ab1 or pEGFP-MmHSC70 with 80,000 magnifications. Bar = 200 nm. (C) Immunofluorescence analysis of MmHSP90ab1 and CP proteins. HEK293T cells transfected with pCMV-Flag empty vector or pCMV-Flag-MmHSP90ab1 were infected with RGNNV (MOI = 5) for 24 h, CP (Green) and MmHSP90ab1 (Red) were detected by immunofluorescence staining. Cell nuclei were stained with Hoechst 33342. Bar = 10 μm.
Figure Legend Snippet: MmHSP90ab1 was involved in RGNNV internalization. (A) RT-PCR analysis of CP (-) sequence. HEK293T cells were transfected with pEGFP-N3 empty vector (1, 5, and 9), pEGFP-MmHSP90ab1 (2, 6, and 10), pEGFP-MmHSC70 (3, 7 and 11), or both pEGFP-MmHSP90ab1 and pEGFP-MmHSC70 (4, 8, and 12) plasmids for 24 h, respectively. Then cells were infected with RGNNV (MOI = 5) for 4 h. Next, the cells were washed to remove any unbound viruses and incubated for 24 h (1–4), 48 h (5–8) and 72 h (9–12). Cells were harvested and total RNA was extracted for CP (-) detection by qRT-PCR. Human 18S rRNA was detected as reference. (B) Transmission electron micrograph of RGNNV-infected hMMES1 cells and HEK293T cells transfected with pEGFP-N3 empty vector, pEGFP-MmHSP90ab1 or pEGFP-MmHSC70 with 80,000 magnifications. Bar = 200 nm. (C) Immunofluorescence analysis of MmHSP90ab1 and CP proteins. HEK293T cells transfected with pCMV-Flag empty vector or pCMV-Flag-MmHSP90ab1 were infected with RGNNV (MOI = 5) for 24 h, CP (Green) and MmHSP90ab1 (Red) were detected by immunofluorescence staining. Cell nuclei were stained with Hoechst 33342. Bar = 10 μm.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Sequencing, Transfection, Plasmid Preparation, Infection, Incubation, Quantitative RT-PCR, Transmission Assay, Immunofluorescence, Staining

Marine medaka HSP90ab1 (MmHSP90ab1) interacts with RGNNV capsid protein (CP). (A) The lysates of hMMES1 cells transfected with pEGFP-N3 (Lane 1) or pEGFP-CP (Lane 2) plasmids. The precipitated cell proteins with affinity to GFP (lane 3) or GFP-CP (lane 4) were separated by 10% SDS-PAGE and stained with Coomassie blue. Lane M, protein marker. Black arrows indicated the specific bands for mass spectrometry. (B) HEK293T cells were cotransfected with pCMV-Flag-MmHSP90ab1 and pCMV-Myc-CP plasmids. MmHSP90ab1 (Green) and CP (Red) were detected by immunofluorescence staining with anti-Flag or anti-Myc abs, respectively. Nucleus were stained by Hoechst 33342, Bar = 10 μm. (C) Lysates from HEK293T cells transfected with pCMV-Flag-MmHSP90ab1 and pEGFP-C P or pEGFP-N3 were subjected to immunoprecipitation with anti-GFP abs. Immunoprecipitates and whole-cell lysate (Input) were immunoblotted with anti-GFP and anti-Flag abs. (D) The lysates of HEK293T cells transfected with indicated plasmids were pulled down with purified His-CP or His proteins. The proteins bound to CP and the input were immunoblotted with anti-His and anti-Flag abs. (E) pCMV-Flag-LjHSP90ab1 or pCMV-Flag-BsHSP90ab1 and pCMV-Myc-CP were cotransfected into HEK293T cells. The cell lysates were immunoprecipitated with anti-Flag abs. The immunoprecipitates and input were immunoblotted with indicated antibodies.
Figure Legend Snippet: Marine medaka HSP90ab1 (MmHSP90ab1) interacts with RGNNV capsid protein (CP). (A) The lysates of hMMES1 cells transfected with pEGFP-N3 (Lane 1) or pEGFP-CP (Lane 2) plasmids. The precipitated cell proteins with affinity to GFP (lane 3) or GFP-CP (lane 4) were separated by 10% SDS-PAGE and stained with Coomassie blue. Lane M, protein marker. Black arrows indicated the specific bands for mass spectrometry. (B) HEK293T cells were cotransfected with pCMV-Flag-MmHSP90ab1 and pCMV-Myc-CP plasmids. MmHSP90ab1 (Green) and CP (Red) were detected by immunofluorescence staining with anti-Flag or anti-Myc abs, respectively. Nucleus were stained by Hoechst 33342, Bar = 10 μm. (C) Lysates from HEK293T cells transfected with pCMV-Flag-MmHSP90ab1 and pEGFP-C P or pEGFP-N3 were subjected to immunoprecipitation with anti-GFP abs. Immunoprecipitates and whole-cell lysate (Input) were immunoblotted with anti-GFP and anti-Flag abs. (D) The lysates of HEK293T cells transfected with indicated plasmids were pulled down with purified His-CP or His proteins. The proteins bound to CP and the input were immunoblotted with anti-His and anti-Flag abs. (E) pCMV-Flag-LjHSP90ab1 or pCMV-Flag-BsHSP90ab1 and pCMV-Myc-CP were cotransfected into HEK293T cells. The cell lysates were immunoprecipitated with anti-Flag abs. The immunoprecipitates and input were immunoblotted with indicated antibodies.

Techniques Used: Transfection, SDS Page, Staining, Marker, Mass Spectrometry, Immunofluorescence, Immunoprecipitation, Purification

Blocking assay of RGNNV entry. (A and B) hMMES1 cells were incubated with commercial anti-human HSP90β abs (1:50) for 4 h and then infected with RGNNV (MOI = 5) for 2 or 4 h at 4°C. After washed with PBS for three times, cells were harvested for CP (A) and RDRP (B) expression detection. (C-F) RGNNV was incubated with purified His-MmHSP90ab1 (100 or 500 ng) (C and D) or His-MmHSP90ab1-NM (100 or 500 ng) proteins (E and F) for 4 h at 4°C, then was added to hMMES1 cells which were further incubated for 4 h at 4°C. Cells were washed with PBS for three times and harvested for CP (C and E) and RDRP (D and F) expression detection. (G) Recombinant expression and purification of His-MmHSP90ab1and His-MmHSP90ab1-NM. Total proteins from E . coli with His-MmHSP90ab1 (Lane 1) or His-MmHSP90ab1-NM (Lane 2) after IPTG induction; purified recombinant His-MmHSP90ab1 (Lane 3) or His-MmHSP90ab1-NM (Lane 4); lane M, protein marker. (H) HEK293T cells were transfected with pEGFP-MmHSP90ab1 (MmHSP90ab1), pEGFP-MmHSC70 (MmHSC70) or pEGFP-N3 plasmids (C), respectively. Then, transfected cells were infected with RGNNV (MOI = 10) for 4 h at 4°C. Next, the cells were washed to remove any unbound viruses and total RNA was extracted for CP detection by qRT-PCR. (I) Survival rates of marine medaka infected with RGNNV and MmHSP90ab1 or His protein mixtures. RGNNV (100 TCID 50 ) was mixed with purified His-tagged MmHSP90ab1 recombinant protein or His protein and incubated for 4 h at 4°C. Then fish were intraperitoneally injected with mixtures, respectively. The same volume of PBS was injected as negative control. The cumulative survival rate was determined from 1 to 10 days post-infection. *, ( p
Figure Legend Snippet: Blocking assay of RGNNV entry. (A and B) hMMES1 cells were incubated with commercial anti-human HSP90β abs (1:50) for 4 h and then infected with RGNNV (MOI = 5) for 2 or 4 h at 4°C. After washed with PBS for three times, cells were harvested for CP (A) and RDRP (B) expression detection. (C-F) RGNNV was incubated with purified His-MmHSP90ab1 (100 or 500 ng) (C and D) or His-MmHSP90ab1-NM (100 or 500 ng) proteins (E and F) for 4 h at 4°C, then was added to hMMES1 cells which were further incubated for 4 h at 4°C. Cells were washed with PBS for three times and harvested for CP (C and E) and RDRP (D and F) expression detection. (G) Recombinant expression and purification of His-MmHSP90ab1and His-MmHSP90ab1-NM. Total proteins from E . coli with His-MmHSP90ab1 (Lane 1) or His-MmHSP90ab1-NM (Lane 2) after IPTG induction; purified recombinant His-MmHSP90ab1 (Lane 3) or His-MmHSP90ab1-NM (Lane 4); lane M, protein marker. (H) HEK293T cells were transfected with pEGFP-MmHSP90ab1 (MmHSP90ab1), pEGFP-MmHSC70 (MmHSC70) or pEGFP-N3 plasmids (C), respectively. Then, transfected cells were infected with RGNNV (MOI = 10) for 4 h at 4°C. Next, the cells were washed to remove any unbound viruses and total RNA was extracted for CP detection by qRT-PCR. (I) Survival rates of marine medaka infected with RGNNV and MmHSP90ab1 or His protein mixtures. RGNNV (100 TCID 50 ) was mixed with purified His-tagged MmHSP90ab1 recombinant protein or His protein and incubated for 4 h at 4°C. Then fish were intraperitoneally injected with mixtures, respectively. The same volume of PBS was injected as negative control. The cumulative survival rate was determined from 1 to 10 days post-infection. *, ( p

Techniques Used: Blocking Assay, Incubation, Infection, Expressing, Purification, Recombinant, Marker, Transfection, Quantitative RT-PCR, Fluorescence In Situ Hybridization, Injection, Negative Control

Related Articles

Clone Assay:

Article Title: CENPV Is a CYLD-Interacting Molecule Regulating Ciliary Acetylated α-Tubulin.
Article Snippet: .. GFP- CENPV and CENPV-mCherry were constructed by cloning full-length CENPV cDNA into pEGFP-N3 or pLVX-EF1a-mCherry_N1 vector (Clontech, Mountain View, CA). .. Immunohistochemistry Immunohistochemistry was performed on 5 mm thick formalin-fixed paraffin-embedded sections mounted on Superfrost Plus slides (Thermo Fisher Scientific, Waltham, MA).

Article Title: Marine medaka heat shock protein 90ab1 is a receptor for red-spotted grouper nervous necrosis virus and promotes virus internalization through clathrin-mediated endocytosis
Article Snippet: .. Coding regions of RGNNV CP (KP455642) were cloned into pCMV-Flag , pCMV-Myc (Clontech), pEGFP-N3 , and pET-32a (+) (Clontech) vectors, respectively. .. Clathrin heavy chain of marine medaka (Ensomet00000024422.1) was cloned into pCMV-Flag .

Article Title: Fluorescent TAP as a Platform for Virus-Induced Degradation of the Antigenic Peptide Transporter
Article Snippet: .. Fragments of TAP1 and TAP2 sequences were ordered as synthetic genes designed for cloning in pEGFP-N3 or pEGFP-C1 (Takara/Clontech). ..

Article Title: Cobalt ion interaction with TMEM16A calcium-activated chloride channel: Inhibition and potentiation
Article Snippet: .. Reagents and cDNA clones The cDNA of the “a ” alternative splice variant [ ] of the TMEM16A (NCBI reference sequence: NM_001242349.1), subcloned in the pEGFP-N3 or pIRES expression vector (Clontech/Takara Bio), was used throughout the study. .. The cDNA constructs produced channels with (from the pEGFP-N3 construct) or without (from the pIRES construct) a green fluorescent protein (GFP) attached to the C terminus of the channel proteins.

Article Title: Pathophysiology of protein aggregation and extended phenotyping in filaminopathy
Article Snippet: .. Full-length FLNC complementary DNA clones in pEGFP-N3 or pEGFP-C2 (Clontech) were obtained as described ( ). .. The c.2997_3008del (p.V930_T933del, d7ΔVKYT) mutation was introduced in the complementary DNA encoding full-length FLNC in pEGFP-N3 using the QuikChange® Lightning Site-Directed Mutagenesis Kit (Stratagene) and the following oligonucleotides: ACAACCATGACTACTCCTACACTGCTGTCCAGCAG and CTGCTGGACAGCAGTGTAGGAGTAGTCATGGTTGT.

Amplification:

Article Title: Optimization of gene delivery methods in Xenopus laevis kidney (A6) and Chinese hamster ovary (CHO) cell lines for heterologous expression of Xenopus inner ear genes
Article Snippet: .. Fluorescent constructs pmCherry-N1, pEGFP-N3, and pEYFP-Tub as well as the SMART™ RACE cDNA Amplification Kit were purchased from Clontech Laboratories, Inc. (Mountain View, CA). .. Alexa Fluor® 568 phalloidin, Alexa Fluor® 488 phalloidin, 10 mg/ml Hoechst 33342 solution, SlowFade® Antifade kit, Lipofectamine™ 2000, pCR®-XL-TOPO® vector, and Cellular Lights™ Tubulin-RFP (a BacMam virus) were obtained from Invitrogen (Eugene, OR).

Mutagenesis:

Article Title: Comparison of ion transport determinants between a TMEM16 chloride channel and phospholipid scramblase
Article Snippet: .. The WT TMEM16A (abbreviated as WT16A ) and the mCherry-removed WT TMEM16F (WT16F ) cDNAs, as well as their mutant cDNA constructs, were subcloned in pEGFP-N3 or pIRES2 expression vectors (Takara Bio). .. Mutations of cDNAs were made using the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were verified by commercial DNA sequencing services.

Construct:

Article Title: CENPV Is a CYLD-Interacting Molecule Regulating Ciliary Acetylated α-Tubulin.
Article Snippet: .. GFP- CENPV and CENPV-mCherry were constructed by cloning full-length CENPV cDNA into pEGFP-N3 or pLVX-EF1a-mCherry_N1 vector (Clontech, Mountain View, CA). .. Immunohistochemistry Immunohistochemistry was performed on 5 mm thick formalin-fixed paraffin-embedded sections mounted on Superfrost Plus slides (Thermo Fisher Scientific, Waltham, MA).

Article Title: Optimization of gene delivery methods in Xenopus laevis kidney (A6) and Chinese hamster ovary (CHO) cell lines for heterologous expression of Xenopus inner ear genes
Article Snippet: .. Fluorescent constructs pmCherry-N1, pEGFP-N3, and pEYFP-Tub as well as the SMART™ RACE cDNA Amplification Kit were purchased from Clontech Laboratories, Inc. (Mountain View, CA). .. Alexa Fluor® 568 phalloidin, Alexa Fluor® 488 phalloidin, 10 mg/ml Hoechst 33342 solution, SlowFade® Antifade kit, Lipofectamine™ 2000, pCR®-XL-TOPO® vector, and Cellular Lights™ Tubulin-RFP (a BacMam virus) were obtained from Invitrogen (Eugene, OR).

Article Title: Comparison of ion transport determinants between a TMEM16 chloride channel and phospholipid scramblase
Article Snippet: .. The WT TMEM16A (abbreviated as WT16A ) and the mCherry-removed WT TMEM16F (WT16F ) cDNAs, as well as their mutant cDNA constructs, were subcloned in pEGFP-N3 or pIRES2 expression vectors (Takara Bio). .. Mutations of cDNAs were made using the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were verified by commercial DNA sequencing services.

Positron Emission Tomography:

Article Title: Marine medaka heat shock protein 90ab1 is a receptor for red-spotted grouper nervous necrosis virus and promotes virus internalization through clathrin-mediated endocytosis
Article Snippet: .. Coding regions of RGNNV CP (KP455642) were cloned into pCMV-Flag , pCMV-Myc (Clontech), pEGFP-N3 , and pET-32a (+) (Clontech) vectors, respectively. .. Clathrin heavy chain of marine medaka (Ensomet00000024422.1) was cloned into pCMV-Flag .

Expressing:

Article Title: Cobalt ion interaction with TMEM16A calcium-activated chloride channel: Inhibition and potentiation
Article Snippet: .. Reagents and cDNA clones The cDNA of the “a ” alternative splice variant [ ] of the TMEM16A (NCBI reference sequence: NM_001242349.1), subcloned in the pEGFP-N3 or pIRES expression vector (Clontech/Takara Bio), was used throughout the study. .. The cDNA constructs produced channels with (from the pEGFP-N3 construct) or without (from the pIRES construct) a green fluorescent protein (GFP) attached to the C terminus of the channel proteins.

Article Title: Comparison of ion transport determinants between a TMEM16 chloride channel and phospholipid scramblase
Article Snippet: .. The WT TMEM16A (abbreviated as WT16A ) and the mCherry-removed WT TMEM16F (WT16F ) cDNAs, as well as their mutant cDNA constructs, were subcloned in pEGFP-N3 or pIRES2 expression vectors (Takara Bio). .. Mutations of cDNAs were made using the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were verified by commercial DNA sequencing services.

Sequencing:

Article Title: Cobalt ion interaction with TMEM16A calcium-activated chloride channel: Inhibition and potentiation
Article Snippet: .. Reagents and cDNA clones The cDNA of the “a ” alternative splice variant [ ] of the TMEM16A (NCBI reference sequence: NM_001242349.1), subcloned in the pEGFP-N3 or pIRES expression vector (Clontech/Takara Bio), was used throughout the study. .. The cDNA constructs produced channels with (from the pEGFP-N3 construct) or without (from the pIRES construct) a green fluorescent protein (GFP) attached to the C terminus of the channel proteins.

Variant Assay:

Article Title: Cobalt ion interaction with TMEM16A calcium-activated chloride channel: Inhibition and potentiation
Article Snippet: .. Reagents and cDNA clones The cDNA of the “a ” alternative splice variant [ ] of the TMEM16A (NCBI reference sequence: NM_001242349.1), subcloned in the pEGFP-N3 or pIRES expression vector (Clontech/Takara Bio), was used throughout the study. .. The cDNA constructs produced channels with (from the pEGFP-N3 construct) or without (from the pIRES construct) a green fluorescent protein (GFP) attached to the C terminus of the channel proteins.

Plasmid Preparation:

Article Title: CENPV Is a CYLD-Interacting Molecule Regulating Ciliary Acetylated α-Tubulin.
Article Snippet: .. GFP- CENPV and CENPV-mCherry were constructed by cloning full-length CENPV cDNA into pEGFP-N3 or pLVX-EF1a-mCherry_N1 vector (Clontech, Mountain View, CA). .. Immunohistochemistry Immunohistochemistry was performed on 5 mm thick formalin-fixed paraffin-embedded sections mounted on Superfrost Plus slides (Thermo Fisher Scientific, Waltham, MA).

Article Title: Cobalt ion interaction with TMEM16A calcium-activated chloride channel: Inhibition and potentiation
Article Snippet: .. Reagents and cDNA clones The cDNA of the “a ” alternative splice variant [ ] of the TMEM16A (NCBI reference sequence: NM_001242349.1), subcloned in the pEGFP-N3 or pIRES expression vector (Clontech/Takara Bio), was used throughout the study. .. The cDNA constructs produced channels with (from the pEGFP-N3 construct) or without (from the pIRES construct) a green fluorescent protein (GFP) attached to the C terminus of the channel proteins.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa pegfp n3
    Non-protein-coding features of Z38. (A) The expression of EGFP in MCF-7 cells after transfection with the following plasmids: <t>pEGFP-C1,</t> pEGFP-C1-Z38, pEGFP-C1-Z38(S), <t>pEGFP-N3,</t> pEGFP-N3-Z38, pEGFP-N3-Z38(S). (B) The transcription level of Z38 in the in vitro translation experiments, assayed by semi-quantitative PCR. PBSIIKS-Z38-P represents the circular plasmid, and PBSIIKS-Z38-F represents the linearized plasmid. +RT represents reverse transcription, and -RT represents non-reverse transcription. (C) The results of in vitro translation assays. Arrow 1 indicates the positive control provided in reagent kit, arrow 2 indicates the nonspecific bands detailed by manufacturer, and arrow 3 indicates the target protein. PstI represents a kind of endonuclease. (D) The expression of fusion proteins of FLAG and CLDND1, assayed by western blotting. (E) The expression of CLDND1 proteins in MDA-MB-231 cells, assayed by immunofluorescence. The normal rabbit IgG was used as the negative control. (F) The expression of CLDND1 proteins in cancer cells, assayed by western blotting.
    Pegfp N3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp n3/product/TaKaRa
    Average 94 stars, based on 240 article reviews
    Price from $9.99 to $1999.99
    pegfp n3 - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    85
    TaKaRa 5ht6 gfp
    <t>5HT6-G-GECO1.0</t> targets primary cilia and detects changes in ciliary Ca 2+ . (a) Schematic of 5HT 6 -G-GECO1.0. G-GECO1.0 contains M13 (a skeletal muscle light-chain kinase), a circularly permuted <t>GFP</t> (cpGFP), and Calmodulin (CaM). (b) A primary cilium from a NIH-3T3 cell expressing 5HT 6 -G-GECO1.0 stained with antibody against acetylated α-tubulin. Bar represents 3 μm. (c) Time-lapse imaging of a NIH-3T3 primary cilium expressing 5HT 6 -G-GECO1.0 treated with ionomycin (Iono). AFU stands for arbitrary fluorescence unit. Bar represents 5 μm.
    5ht6 Gfp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5ht6 gfp/product/TaKaRa
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    5ht6 gfp - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results


    Non-protein-coding features of Z38. (A) The expression of EGFP in MCF-7 cells after transfection with the following plasmids: pEGFP-C1, pEGFP-C1-Z38, pEGFP-C1-Z38(S), pEGFP-N3, pEGFP-N3-Z38, pEGFP-N3-Z38(S). (B) The transcription level of Z38 in the in vitro translation experiments, assayed by semi-quantitative PCR. PBSIIKS-Z38-P represents the circular plasmid, and PBSIIKS-Z38-F represents the linearized plasmid. +RT represents reverse transcription, and -RT represents non-reverse transcription. (C) The results of in vitro translation assays. Arrow 1 indicates the positive control provided in reagent kit, arrow 2 indicates the nonspecific bands detailed by manufacturer, and arrow 3 indicates the target protein. PstI represents a kind of endonuclease. (D) The expression of fusion proteins of FLAG and CLDND1, assayed by western blotting. (E) The expression of CLDND1 proteins in MDA-MB-231 cells, assayed by immunofluorescence. The normal rabbit IgG was used as the negative control. (F) The expression of CLDND1 proteins in cancer cells, assayed by western blotting.

    Journal: Journal of Cancer

    Article Title: High Expression of the Newly Found Long Noncoding RNA Z38 Promotes Cell Proliferation and Oncogenic Activity in Breast Cancer

    doi: 10.7150/jca.13117

    Figure Lengend Snippet: Non-protein-coding features of Z38. (A) The expression of EGFP in MCF-7 cells after transfection with the following plasmids: pEGFP-C1, pEGFP-C1-Z38, pEGFP-C1-Z38(S), pEGFP-N3, pEGFP-N3-Z38, pEGFP-N3-Z38(S). (B) The transcription level of Z38 in the in vitro translation experiments, assayed by semi-quantitative PCR. PBSIIKS-Z38-P represents the circular plasmid, and PBSIIKS-Z38-F represents the linearized plasmid. +RT represents reverse transcription, and -RT represents non-reverse transcription. (C) The results of in vitro translation assays. Arrow 1 indicates the positive control provided in reagent kit, arrow 2 indicates the nonspecific bands detailed by manufacturer, and arrow 3 indicates the target protein. PstI represents a kind of endonuclease. (D) The expression of fusion proteins of FLAG and CLDND1, assayed by western blotting. (E) The expression of CLDND1 proteins in MDA-MB-231 cells, assayed by immunofluorescence. The normal rabbit IgG was used as the negative control. (F) The expression of CLDND1 proteins in cancer cells, assayed by western blotting.

    Article Snippet: Recombinant plasmids pEGFP-C1-Z38, pEGFP-N3-Z38, pCMV-Tag2B-Z38, and PBSIIKS-Z38 were constructed through inserting the 762 nucleotides length double-stranded DNA (dsDNA) into the control plasmids pEGFP-C1 (endonucleases: 5'BglII 3'KpnI) (Clontech, CA, USA), pEGFP-N3 (endonucleases: 5'BglII 3'KpnI) (Clontech), pCMV-Tag2B (endonucleases: 5'BamH1 3'XhoI) (Stratagene, CA, USA), and PBSIIKS (endonucleases: 5'XhoI 3'KpnI) (Promega, WI, USA).

    Techniques: Expressing, Transfection, In Vitro, Real-time Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Western Blot, Multiple Displacement Amplification, Immunofluorescence, Negative Control

    Roles of degradation and surface downregulation in Vpu-induced tetherin dysfunction. (A) 293T cells were co-transfected with 1 µg pNL4-3 WT or pNL4-3ΔVpu and 50 ng HA-tetherin or empty vector. At 48 h, the cells were examined for tetherin expression, and the pelleted virions were analyzed for p24 content. Pr55Gag was examined to exclude variations in transfection efficiencies. Tubulin was detected as a loading control. (B) The relative infectivity of virus released in (A) was assayed by infecting MAGI cells. Virus release of NL4-3 WT in the absence of tetherin was set to 100%. (C) 293T cells were co-transfected with 1 µg pNL4-3ΔVpu, 50 ng HA-tetherin and increasing doses of Vpu. HA-tetherin and Vpu-cmyc were detected in the cells. (D) The cellular tetherin levels and virus released were plotted in a line graph. The tetherin level in the absence of Vpu was set to 100%. Viral output was scored by titration of the supernatants on MAGI cells, and that without tetherin was set to 100%. (E) HeLa cells were co-transfected with 1 µg pNL4-3ΔVpu or WT, along with 500 ng pEGFP-N3, and increasing doses of Vpu. Vpu was detected in the cells with Vpu antiserum, and the pelleted virions were analyzed for p24 content. (F) Surface tetherin of cells in (E) were stained with tetherin antibodies and analyzed by flow cytometry. Cells only transfected pEGFP-N3 was used as a negative control. The samples were gated on EGFP+ cells, and surface tetherin levels are shown in histograms with median values at the top right corner. (G) The levels of surface tetherin and virus released are shown in a line graph. The tetherin level in the negative control was set to 100%. Viral output was scored by titration of the supernatants on MAGI cells, and that of NL4-3 WT was set to 100%. All values are representative of three independent experiments.

    Journal: PLoS ONE

    Article Title: Polarity Changes in the Transmembrane Domain Core of HIV-1 Vpu Inhibits Its Anti-Tetherin Activity

    doi: 10.1371/journal.pone.0020890

    Figure Lengend Snippet: Roles of degradation and surface downregulation in Vpu-induced tetherin dysfunction. (A) 293T cells were co-transfected with 1 µg pNL4-3 WT or pNL4-3ΔVpu and 50 ng HA-tetherin or empty vector. At 48 h, the cells were examined for tetherin expression, and the pelleted virions were analyzed for p24 content. Pr55Gag was examined to exclude variations in transfection efficiencies. Tubulin was detected as a loading control. (B) The relative infectivity of virus released in (A) was assayed by infecting MAGI cells. Virus release of NL4-3 WT in the absence of tetherin was set to 100%. (C) 293T cells were co-transfected with 1 µg pNL4-3ΔVpu, 50 ng HA-tetherin and increasing doses of Vpu. HA-tetherin and Vpu-cmyc were detected in the cells. (D) The cellular tetherin levels and virus released were plotted in a line graph. The tetherin level in the absence of Vpu was set to 100%. Viral output was scored by titration of the supernatants on MAGI cells, and that without tetherin was set to 100%. (E) HeLa cells were co-transfected with 1 µg pNL4-3ΔVpu or WT, along with 500 ng pEGFP-N3, and increasing doses of Vpu. Vpu was detected in the cells with Vpu antiserum, and the pelleted virions were analyzed for p24 content. (F) Surface tetherin of cells in (E) were stained with tetherin antibodies and analyzed by flow cytometry. Cells only transfected pEGFP-N3 was used as a negative control. The samples were gated on EGFP+ cells, and surface tetherin levels are shown in histograms with median values at the top right corner. (G) The levels of surface tetherin and virus released are shown in a line graph. The tetherin level in the negative control was set to 100%. Viral output was scored by titration of the supernatants on MAGI cells, and that of NL4-3 WT was set to 100%. All values are representative of three independent experiments.

    Article Snippet: Flow cytometry analysis HeLa cells plated in 6-well plates were transfected with indicated expression plasmids along with an EGFP-expressing vector pEGFP-N3 (Clontech) as a transfection marker.

    Techniques: Transfection, Plasmid Preparation, Expressing, Infection, Titration, Staining, Flow Cytometry, Cytometry, Negative Control

    Effects of Vpu TM mutations on Vpu-mediated degradation and surface downregulation of tetherin. (A) 293T cells were co-transfected with 100 ng HA-tetherin expression plasmid along with 200 ng VR1012 control vector or VR1012 encoding Vpu TM variants at a 2∶1 molar ratio. At 48 h post-transfection, the cells were harvested for immunoblotting analysis. Tetherin and Vpu were detected with anti-HA and anti-myc antibody, respectively. Tubulin was detected as a loading control. (B) Tetherin levels were measured using Bandscan software and normalized by tubulin levels. Percentages of degraded tetherin were calculated by subtracting the densitometric intensity values of the indicated Vpu WT or mutant bands from that of the mock band to represent the different abilities of Vpu variants to mediate tetherin degradation. Values are representative of three independent experiments. (C) HeLa cells were co-transfected with 500 ng pEGFP-N3 along with 500 ng VR1012 control vector or VR1012 encoding Vpu TM variants. Cell surface tetherin was stained with BST-2 antibodies, followed by Alexa 633 goat anti-mouse IgG and analyzed by flow cytometry. Samples were gated on EGFP+ cells, and the surface tetherin levels are shown in the histograms with median values at the top right corner.

    Journal: PLoS ONE

    Article Title: Polarity Changes in the Transmembrane Domain Core of HIV-1 Vpu Inhibits Its Anti-Tetherin Activity

    doi: 10.1371/journal.pone.0020890

    Figure Lengend Snippet: Effects of Vpu TM mutations on Vpu-mediated degradation and surface downregulation of tetherin. (A) 293T cells were co-transfected with 100 ng HA-tetherin expression plasmid along with 200 ng VR1012 control vector or VR1012 encoding Vpu TM variants at a 2∶1 molar ratio. At 48 h post-transfection, the cells were harvested for immunoblotting analysis. Tetherin and Vpu were detected with anti-HA and anti-myc antibody, respectively. Tubulin was detected as a loading control. (B) Tetherin levels were measured using Bandscan software and normalized by tubulin levels. Percentages of degraded tetherin were calculated by subtracting the densitometric intensity values of the indicated Vpu WT or mutant bands from that of the mock band to represent the different abilities of Vpu variants to mediate tetherin degradation. Values are representative of three independent experiments. (C) HeLa cells were co-transfected with 500 ng pEGFP-N3 along with 500 ng VR1012 control vector or VR1012 encoding Vpu TM variants. Cell surface tetherin was stained with BST-2 antibodies, followed by Alexa 633 goat anti-mouse IgG and analyzed by flow cytometry. Samples were gated on EGFP+ cells, and the surface tetherin levels are shown in the histograms with median values at the top right corner.

    Article Snippet: Flow cytometry analysis HeLa cells plated in 6-well plates were transfected with indicated expression plasmids along with an EGFP-expressing vector pEGFP-N3 (Clontech) as a transfection marker.

    Techniques: Transfection, Expressing, Plasmid Preparation, Software, Mutagenesis, Staining, Flow Cytometry, Cytometry

    Effects of Vpu TM mutations on Vpu-mediated degradation and surface downregulation of CD4. (A) 293T cells were co-transfected with 100 ng CD4-HA expression plasmid along with 200 ng VR1012 control vector or VR1012 encoding Vpu TM variants. At 48 h post-transfection, the cells were harvested for immunoblotting analysis. CD4 and Vpu were detected with anti-HA and anti-myc antibodies, respectively. Tubulin was detected as a loading control. (B) CD4 levels were measured using Bandscan software and normalized by tubulin levels. Percentages of degraded CD4 were calculated by subtracting the densitometric intensity values of the indicated Vpu WT or mutant bands from that of the mock band to represent the different abilities of Vpu variants to mediate CD4 degradation. Results shown are the average of two independent experiments. (C) HeLa CD4 cells were co-transfected with 500 ng pEGFP-N3 along with 500 ng VR1012 control vector or VR1012 encoding Vpu TM variants. Cell surface CD4 was stained with CD4 antibodies followed by Alexa 633 goat anti-mouse IgG and analyzed by flow cytometry. Samples were gated on EGFP+ cells, and the surface CD4 levels are shown in the histograms with median values at the top right corner.

    Journal: PLoS ONE

    Article Title: Polarity Changes in the Transmembrane Domain Core of HIV-1 Vpu Inhibits Its Anti-Tetherin Activity

    doi: 10.1371/journal.pone.0020890

    Figure Lengend Snippet: Effects of Vpu TM mutations on Vpu-mediated degradation and surface downregulation of CD4. (A) 293T cells were co-transfected with 100 ng CD4-HA expression plasmid along with 200 ng VR1012 control vector or VR1012 encoding Vpu TM variants. At 48 h post-transfection, the cells were harvested for immunoblotting analysis. CD4 and Vpu were detected with anti-HA and anti-myc antibodies, respectively. Tubulin was detected as a loading control. (B) CD4 levels were measured using Bandscan software and normalized by tubulin levels. Percentages of degraded CD4 were calculated by subtracting the densitometric intensity values of the indicated Vpu WT or mutant bands from that of the mock band to represent the different abilities of Vpu variants to mediate CD4 degradation. Results shown are the average of two independent experiments. (C) HeLa CD4 cells were co-transfected with 500 ng pEGFP-N3 along with 500 ng VR1012 control vector or VR1012 encoding Vpu TM variants. Cell surface CD4 was stained with CD4 antibodies followed by Alexa 633 goat anti-mouse IgG and analyzed by flow cytometry. Samples were gated on EGFP+ cells, and the surface CD4 levels are shown in the histograms with median values at the top right corner.

    Article Snippet: Flow cytometry analysis HeLa cells plated in 6-well plates were transfected with indicated expression plasmids along with an EGFP-expressing vector pEGFP-N3 (Clontech) as a transfection marker.

    Techniques: Transfection, Expressing, Plasmid Preparation, Software, Mutagenesis, Staining, Flow Cytometry, Cytometry

    Role of apoptosis in Rep-mediated inhibition of HSV-1 replication. (A) Vero cells were transfected with 0.5 μg of pcDNA.Rep78 or empty pcDNA vector together with 0.25 μg pEGFP-N3. At the indicated time points, the cells were stained with

    Journal: Journal of Virology

    Article Title: Inhibition of Herpes Simplex Virus Type 1 Replication by Adeno-Associated Virus Rep Proteins Depends on Their Combined DNA-Binding and ATPase/Helicase Activities ▿

    doi: 10.1128/JVI.01503-09

    Figure Lengend Snippet: Role of apoptosis in Rep-mediated inhibition of HSV-1 replication. (A) Vero cells were transfected with 0.5 μg of pcDNA.Rep78 or empty pcDNA vector together with 0.25 μg pEGFP-N3. At the indicated time points, the cells were stained with

    Article Snippet: Vero cells were transfected with 0.25 μg pEGFP-N3 together with 0.5 or 1 μg pcDNA.Rep plasmids or empty pcDNA vector as indicated in Results.

    Techniques: Inhibition, Transfection, Plasmid Preparation, Staining

    5HT6-G-GECO1.0 targets primary cilia and detects changes in ciliary Ca 2+ . (a) Schematic of 5HT 6 -G-GECO1.0. G-GECO1.0 contains M13 (a skeletal muscle light-chain kinase), a circularly permuted GFP (cpGFP), and Calmodulin (CaM). (b) A primary cilium from a NIH-3T3 cell expressing 5HT 6 -G-GECO1.0 stained with antibody against acetylated α-tubulin. Bar represents 3 μm. (c) Time-lapse imaging of a NIH-3T3 primary cilium expressing 5HT 6 -G-GECO1.0 treated with ionomycin (Iono). AFU stands for arbitrary fluorescence unit. Bar represents 5 μm.

    Journal: Nature methods

    Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia

    doi: 10.1038/nmeth.2647

    Figure Lengend Snippet: 5HT6-G-GECO1.0 targets primary cilia and detects changes in ciliary Ca 2+ . (a) Schematic of 5HT 6 -G-GECO1.0. G-GECO1.0 contains M13 (a skeletal muscle light-chain kinase), a circularly permuted GFP (cpGFP), and Calmodulin (CaM). (b) A primary cilium from a NIH-3T3 cell expressing 5HT 6 -G-GECO1.0 stained with antibody against acetylated α-tubulin. Bar represents 3 μm. (c) Time-lapse imaging of a NIH-3T3 primary cilium expressing 5HT 6 -G-GECO1.0 treated with ionomycin (Iono). AFU stands for arbitrary fluorescence unit. Bar represents 5 μm.

    Article Snippet: GFP was digested from 5HT6 -GFP (pEGFP-N3, Clontech) using Acc65I and BsrGI and subcloned into a 5HT6 -mCherry (pmCherry-C1, Clontech) that had been digested with Acc65I .

    Techniques: Chick Chorioallantoic Membrane Assay, Expressing, Staining, Imaging, Fluorescence

    Laminar fluid flow induces dynamic calcium signals in primary cilia (a) Fluorescence intensity of GFP divided by that of mCherry is indicated before and after flow administration. 5HT 6 -mCherry-G-GECO1.0 activity is shown in blue (18 primary cilia from 7 independent experiments) and 5HT 6 -mCherry-GFP (control) is in black (9 primary cilia from 3 independent experiments). Fluorescence signals have been normalized against baseline fluorescence before flow induction. Region highlighted in light blue indicates time points with flow. Error bars represent SEM. (b) Comparison of relative GFP intensities between 5HT 6 -mCherry-G-GECO1.0 and 5HT6-mCherry-GFP before and after one minute flow induction. In each case, the GFP intensity without flow has been normalized to a value of 1. Statistical analysis: 5HT 6 -mCherry-GFP −flow vs +flow ( P = 0.9545); 5HT 6 -mCherry-G-GECO1.0 −flow vs +flow ( P = 0.000153); 5HT 6 -mCherry-G-GECO1.0 +flow vs 5HT 6 -mCherry-GFP +flow ( P = 0.000128).

    Journal: Nature methods

    Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia

    doi: 10.1038/nmeth.2647

    Figure Lengend Snippet: Laminar fluid flow induces dynamic calcium signals in primary cilia (a) Fluorescence intensity of GFP divided by that of mCherry is indicated before and after flow administration. 5HT 6 -mCherry-G-GECO1.0 activity is shown in blue (18 primary cilia from 7 independent experiments) and 5HT 6 -mCherry-GFP (control) is in black (9 primary cilia from 3 independent experiments). Fluorescence signals have been normalized against baseline fluorescence before flow induction. Region highlighted in light blue indicates time points with flow. Error bars represent SEM. (b) Comparison of relative GFP intensities between 5HT 6 -mCherry-G-GECO1.0 and 5HT6-mCherry-GFP before and after one minute flow induction. In each case, the GFP intensity without flow has been normalized to a value of 1. Statistical analysis: 5HT 6 -mCherry-GFP −flow vs +flow ( P = 0.9545); 5HT 6 -mCherry-G-GECO1.0 −flow vs +flow ( P = 0.000153); 5HT 6 -mCherry-G-GECO1.0 +flow vs 5HT 6 -mCherry-GFP +flow ( P = 0.000128).

    Article Snippet: GFP was digested from 5HT6 -GFP (pEGFP-N3, Clontech) using Acc65I and BsrGI and subcloned into a 5HT6 -mCherry (pmCherry-C1, Clontech) that had been digested with Acc65I .

    Techniques: Flow Cytometry, Fluorescence, Activity Assay