Structured Review

TaKaRa pegfp c3
HCV Core interacts with CHMP4b. (A–C) HCV Core colocalizes with CHMP4b. 293FT cells cotransfected with 100 ng of pcDNA3/core (JFH1) and either 100 ng of pCHMP4b-GFP [39] (A) or pFLAG-CHMP4b [39] (B) were examined by confocal laser scanning microscopy. Cells were stained with anti-HCV Core and anti-FLAG polyclonal antibody and were then visualized with FITC (FLAG-CHMP4b) or Cy3 (Core). Images were visualized using confocal laser scanning microscopy. The right panels exhibit the two-color overlay images (Merged). Colocalization is shown in yellow. (C) The Core or NS5A partially colocalizes with CHMP4b in HCV-JFH1-infected RSc cells. RSc cells transfected with 100 ng of pCHMP4b-GFP were infected with HCV-JFH1. Cells were fixed 60 hrs post-infection and were then examined by confocal laser scanning microscopy as shown in panel (A). (D) HCV Core binds to CHMP4b. 293FT cells transfected with 4 µg of pCHMP4b-GFP, <t>pEGFP</t> C3 (Clontech), pcDNA3-FLAG, pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed. The mixtures of these lysates were immunoprecipitated with either anti-FLAG or Living Colors A.v. monoclonal antibody (anti-GFP antibody), followed by immunoblot analysis using anti-HCV Core, anti-HCV NS5A, anti-FLAG, and/or Living Colors A.v. monoclonal antibody.
Pegfp C3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 173 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pegfp c3/product/TaKaRa
Average 99 stars, based on 173 article reviews
Price from $9.99 to $1999.99
pegfp c3 - by Bioz Stars, 2019-10
99/100 stars

Images

1) Product Images from "The ESCRT System Is Required for Hepatitis C Virus Production"

Article Title: The ESCRT System Is Required for Hepatitis C Virus Production

Journal: PLoS ONE

doi: 10.1371/journal.pone.0014517

HCV Core interacts with CHMP4b. (A–C) HCV Core colocalizes with CHMP4b. 293FT cells cotransfected with 100 ng of pcDNA3/core (JFH1) and either 100 ng of pCHMP4b-GFP [39] (A) or pFLAG-CHMP4b [39] (B) were examined by confocal laser scanning microscopy. Cells were stained with anti-HCV Core and anti-FLAG polyclonal antibody and were then visualized with FITC (FLAG-CHMP4b) or Cy3 (Core). Images were visualized using confocal laser scanning microscopy. The right panels exhibit the two-color overlay images (Merged). Colocalization is shown in yellow. (C) The Core or NS5A partially colocalizes with CHMP4b in HCV-JFH1-infected RSc cells. RSc cells transfected with 100 ng of pCHMP4b-GFP were infected with HCV-JFH1. Cells were fixed 60 hrs post-infection and were then examined by confocal laser scanning microscopy as shown in panel (A). (D) HCV Core binds to CHMP4b. 293FT cells transfected with 4 µg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG, pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed. The mixtures of these lysates were immunoprecipitated with either anti-FLAG or Living Colors A.v. monoclonal antibody (anti-GFP antibody), followed by immunoblot analysis using anti-HCV Core, anti-HCV NS5A, anti-FLAG, and/or Living Colors A.v. monoclonal antibody.
Figure Legend Snippet: HCV Core interacts with CHMP4b. (A–C) HCV Core colocalizes with CHMP4b. 293FT cells cotransfected with 100 ng of pcDNA3/core (JFH1) and either 100 ng of pCHMP4b-GFP [39] (A) or pFLAG-CHMP4b [39] (B) were examined by confocal laser scanning microscopy. Cells were stained with anti-HCV Core and anti-FLAG polyclonal antibody and were then visualized with FITC (FLAG-CHMP4b) or Cy3 (Core). Images were visualized using confocal laser scanning microscopy. The right panels exhibit the two-color overlay images (Merged). Colocalization is shown in yellow. (C) The Core or NS5A partially colocalizes with CHMP4b in HCV-JFH1-infected RSc cells. RSc cells transfected with 100 ng of pCHMP4b-GFP were infected with HCV-JFH1. Cells were fixed 60 hrs post-infection and were then examined by confocal laser scanning microscopy as shown in panel (A). (D) HCV Core binds to CHMP4b. 293FT cells transfected with 4 µg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG, pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed. The mixtures of these lysates were immunoprecipitated with either anti-FLAG or Living Colors A.v. monoclonal antibody (anti-GFP antibody), followed by immunoblot analysis using anti-HCV Core, anti-HCV NS5A, anti-FLAG, and/or Living Colors A.v. monoclonal antibody.

Techniques Used: Confocal Laser Scanning Microscopy, Staining, Infection, Transfection, Immunoprecipitation

2) Product Images from "Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation"

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0104908

hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p
Figure Legend Snippet: hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p

Techniques Used: Over Expression, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Construct, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot

hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.
Figure Legend Snippet: hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.

Techniques Used: Transfection, Expressing, Confocal Microscopy

3) Product Images from "Full UPF3B function is critical for neuronal differentiation of neural stem cells"

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells

Journal: Molecular Brain

doi: 10.1186/s13041-015-0122-1

Mutations in UPF3B do not affect its cellular distribution in neurons. Neural stem cells were transfected with the pEGFP-C3 expressing GFP only (empty vector) or a pEGFP-C3 derivative expressing one of the UPF3B forms with an N-terminal GFP tag. Cells were diluted and re-plated after 24 h, and then differentiated for 6 days prior to analysis by confocal microscopy. Shown are separate Z-stack projections of GFP and DAPI channels and of the merged channels. The origin region of the enlarged section is indicated. The scale bar represents 20 μm
Figure Legend Snippet: Mutations in UPF3B do not affect its cellular distribution in neurons. Neural stem cells were transfected with the pEGFP-C3 expressing GFP only (empty vector) or a pEGFP-C3 derivative expressing one of the UPF3B forms with an N-terminal GFP tag. Cells were diluted and re-plated after 24 h, and then differentiated for 6 days prior to analysis by confocal microscopy. Shown are separate Z-stack projections of GFP and DAPI channels and of the merged channels. The origin region of the enlarged section is indicated. The scale bar represents 20 μm

Techniques Used: Transfection, Expressing, Plasmid Preparation, Confocal Microscopy

4) Product Images from "Novel role of KCNQ2/3 channels in regulating neuronal cell viability"

Article Title: Novel role of KCNQ2/3 channels in regulating neuronal cell viability

Journal:

doi: 10.1038/cdd.2010.120

Effects of expression of KCNQ2/KCNQ3 channels on caspase-3 activation. ( a – d ) KCNQ2 and KCNQ3 subunits were subcloned into pEGFP-C3 ( a ) and pDsRed2-C1 vectors ( c ) and transfected into CHO cells shown as green and red color in transfected cells
Figure Legend Snippet: Effects of expression of KCNQ2/KCNQ3 channels on caspase-3 activation. ( a – d ) KCNQ2 and KCNQ3 subunits were subcloned into pEGFP-C3 ( a ) and pDsRed2-C1 vectors ( c ) and transfected into CHO cells shown as green and red color in transfected cells

Techniques Used: Expressing, Activation Assay, Transfection

5) Product Images from "Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells"

Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

Journal: Lipids in Health and Disease

doi: 10.1186/1476-511X-6-24

Deficiency of uptake oxLDL by pEGFP-C3-CD36 was partially rescued by surface binding . The transfection was same as described in Fig. 4. After 48 hours of transfection, cells were rinsed with PBS twice and fixed with 4% paraformaldehyde for 30 min, and then incubated with Dil-OxLDL at 10 μg/ml for 2 hours at room temperature. After washed for three times with PBS, cells were collected and assayed with flow cytometry. The results are an average of three experiments. Dark box: oxLDL uptaking and grey box: oxLDL surface binding.
Figure Legend Snippet: Deficiency of uptake oxLDL by pEGFP-C3-CD36 was partially rescued by surface binding . The transfection was same as described in Fig. 4. After 48 hours of transfection, cells were rinsed with PBS twice and fixed with 4% paraformaldehyde for 30 min, and then incubated with Dil-OxLDL at 10 μg/ml for 2 hours at room temperature. After washed for three times with PBS, cells were collected and assayed with flow cytometry. The results are an average of three experiments. Dark box: oxLDL uptaking and grey box: oxLDL surface binding.

Techniques Used: Binding Assay, Transfection, Incubation, Flow Cytometry, Cytometry

Confocal microscopy to observe both GFP and huCD36 protein expression . Constructs of pEGFP-C3-CD36, pEGFP-N3-CD36, and pEGFP-N3 vector alone, were transit-transfected into CHO cells for 48 hours, and the transfected cells were then immunostained with anti-CD36 antibody, counter-stained with TRIC-conjugated anti-mouse IgG secondary antibody. After washing several times, cells were mounted on slides and observed under confocal microscope. Top panel: pEGFP-N3 transfected alone; Middle panel: cells transfected with pEGFP-C3-CD36; Bottom panel: pEGFP-N3-CD36 transfected. Both GFP and CD36 were expressed in two constructs.
Figure Legend Snippet: Confocal microscopy to observe both GFP and huCD36 protein expression . Constructs of pEGFP-C3-CD36, pEGFP-N3-CD36, and pEGFP-N3 vector alone, were transit-transfected into CHO cells for 48 hours, and the transfected cells were then immunostained with anti-CD36 antibody, counter-stained with TRIC-conjugated anti-mouse IgG secondary antibody. After washing several times, cells were mounted on slides and observed under confocal microscope. Top panel: pEGFP-N3 transfected alone; Middle panel: cells transfected with pEGFP-C3-CD36; Bottom panel: pEGFP-N3-CD36 transfected. Both GFP and CD36 were expressed in two constructs.

Techniques Used: Confocal Microscopy, Expressing, Construct, Plasmid Preparation, Transfection, Staining, Microscopy

pEGFP-C3-CD36 limited OxLDL uptake, but not for pEGFP-N3-CD36 . pEGFP-C3-CD36 and pEGFP-N3-CD36, as well as pEGFP-N3 alone were transit-transfected into CHO cells. After transfection for 48 hours, cells were rinsed twice with PBS and Dil-oxLDL at 10 μg/ml was incubated with the transfected cells for 1 hour. After rinsed for three times with PBS, cells were mounted on coverlids and observed under confocal microscope. Typical transfected and Dil-oxLDL was photographed. Dil-oxLDL was only weakly bound to pEGFP-C3-CD36 transfected cells.
Figure Legend Snippet: pEGFP-C3-CD36 limited OxLDL uptake, but not for pEGFP-N3-CD36 . pEGFP-C3-CD36 and pEGFP-N3-CD36, as well as pEGFP-N3 alone were transit-transfected into CHO cells. After transfection for 48 hours, cells were rinsed twice with PBS and Dil-oxLDL at 10 μg/ml was incubated with the transfected cells for 1 hour. After rinsed for three times with PBS, cells were mounted on coverlids and observed under confocal microscope. Typical transfected and Dil-oxLDL was photographed. Dil-oxLDL was only weakly bound to pEGFP-C3-CD36 transfected cells.

Techniques Used: Transfection, Incubation, Microscopy

Both N- and C-terminal tagged huCD36 bind normally to pRBCs . After transfection with pEGFP-C3-CD36, pEGFP-N3-CD36 or pEGFP-N3 alone, cells were fixed with 4% paraformaldehyde for 20 min and then rinsed twice with PBS. The cells were then incubated with pRBCs for 4 hours at room temperature with gent shacking. pRBCs bindings were observed under fluorescent microscope and typical binding cells were photographed. pRBCs were bound to both pEGFP-C3-CD36 and pEGFP-N3-CD36 transfected cells.
Figure Legend Snippet: Both N- and C-terminal tagged huCD36 bind normally to pRBCs . After transfection with pEGFP-C3-CD36, pEGFP-N3-CD36 or pEGFP-N3 alone, cells were fixed with 4% paraformaldehyde for 20 min and then rinsed twice with PBS. The cells were then incubated with pRBCs for 4 hours at room temperature with gent shacking. pRBCs bindings were observed under fluorescent microscope and typical binding cells were photographed. pRBCs were bound to both pEGFP-C3-CD36 and pEGFP-N3-CD36 transfected cells.

Techniques Used: Transfection, Incubation, Microscopy, Binding Assay

Schematic diagram of p-EGFP-C3-CD36 and peGFP-N3-Cd36 constructs . A, the coding sites of vectors, pEGFP-C3 and pEGFP-N3, were restriction enzymatically cut with both Hind III and Kpn I and the DNA fragments were purified. The inserts, PCR-amplified hCD36 coding sequences after purification, were ligated into the vectors, resulted in recombinant constructs of pEGFP-C3-CD36 or pEGFP-N3-CD36. B, 2% agarose gel to confirm the DNA constructs. Lane 1 and 2, Hind III and Kpn I cut and then purified pEGFP-C3 and pEGFP-N3 plasmid DNAs; Lane 3, purified PCR-amplified huCD36 cDNAs; Lane 4, PEGFP-C3-huCD36 constructs; Lane 5, pEGFP-N3-huCD36 constructs; Lane 6 and 7 are re-digested pEGF-C3-hCD36 and pEGFP-N3-hCD36 with Hind III and Kpn I. Lane 8, 1 Kb DNA markers.
Figure Legend Snippet: Schematic diagram of p-EGFP-C3-CD36 and peGFP-N3-Cd36 constructs . A, the coding sites of vectors, pEGFP-C3 and pEGFP-N3, were restriction enzymatically cut with both Hind III and Kpn I and the DNA fragments were purified. The inserts, PCR-amplified hCD36 coding sequences after purification, were ligated into the vectors, resulted in recombinant constructs of pEGFP-C3-CD36 or pEGFP-N3-CD36. B, 2% agarose gel to confirm the DNA constructs. Lane 1 and 2, Hind III and Kpn I cut and then purified pEGFP-C3 and pEGFP-N3 plasmid DNAs; Lane 3, purified PCR-amplified huCD36 cDNAs; Lane 4, PEGFP-C3-huCD36 constructs; Lane 5, pEGFP-N3-huCD36 constructs; Lane 6 and 7 are re-digested pEGF-C3-hCD36 and pEGFP-N3-hCD36 with Hind III and Kpn I. Lane 8, 1 Kb DNA markers.

Techniques Used: Construct, Purification, Polymerase Chain Reaction, Amplification, Recombinant, Agarose Gel Electrophoresis, Plasmid Preparation

6) Product Images from "Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting *"

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting *

Journal:

doi: 10.1074/jbc.M113.523639

Ca v 2. 1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting and ankyrin interaction. A , HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern. B and D , in contrast, HEK293 cells transfected with full-length
Figure Legend Snippet: Ca v 2. 1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting and ankyrin interaction. A , HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern. B and D , in contrast, HEK293 cells transfected with full-length

Techniques Used: Transfection

Ca v 2.1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting. HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern ( A and D ), whereas HEK293 cells transfected with Ca v 2.1 DII/III-GFP ( B ) or Ca v 2.2
Figure Legend Snippet: Ca v 2.1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting. HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern ( A and D ), whereas HEK293 cells transfected with Ca v 2.1 DII/III-GFP ( B ) or Ca v 2.2

Techniques Used: Transfection

7) Product Images from "Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation"

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0104908

hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p
Figure Legend Snippet: hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p

Techniques Used: Over Expression, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Construct, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot

hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.
Figure Legend Snippet: hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.

Techniques Used: Transfection, Expressing, Confocal Microscopy

8) Product Images from "Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses"

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses

Journal: Retrovirology

doi: 10.1186/1742-4690-11-3

Over-expression of REAF confers restriction which is viral route of entry dependent. (A) Over-expression of REAF restricts early HIV-1 DNA production. HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-GFP antibody. Transfection of REAF-EGFP results in expression of REAF (110, 160 and 250 kDa including EGFP tag (30 kDa). Endogenous REAF was knocked out of HeLa-CD4 cells using siRNA targeting its 3’ UTR. (B) Infected cells were measured following transient over-expression of REAF-EGFP or pEGFP-C3 and challenge with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate. (C) Transient over-expression of REAF-EGFP in HeLa-CD4 cells results in decreased RU5 and late RT products 8 hr post challenge with HIV-1 89.6 . HIV-1 DNA copies are normalised to genomic GAPDH and presented per million cells. Results are mean ± s.d. of a representative experiment performed in duplicate. (D) Restriction by REAF is dependent upon viral route of entry. HIV-1 89.6Δenv was pseudotyped with VSV-G envelope and used to challenge HeLa-CD4 cells following REAF siRNA knockdown. p24 immunostaining was used to detect FFU compared with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate.
Figure Legend Snippet: Over-expression of REAF confers restriction which is viral route of entry dependent. (A) Over-expression of REAF restricts early HIV-1 DNA production. HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-GFP antibody. Transfection of REAF-EGFP results in expression of REAF (110, 160 and 250 kDa including EGFP tag (30 kDa). Endogenous REAF was knocked out of HeLa-CD4 cells using siRNA targeting its 3’ UTR. (B) Infected cells were measured following transient over-expression of REAF-EGFP or pEGFP-C3 and challenge with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate. (C) Transient over-expression of REAF-EGFP in HeLa-CD4 cells results in decreased RU5 and late RT products 8 hr post challenge with HIV-1 89.6 . HIV-1 DNA copies are normalised to genomic GAPDH and presented per million cells. Results are mean ± s.d. of a representative experiment performed in duplicate. (D) Restriction by REAF is dependent upon viral route of entry. HIV-1 89.6Δenv was pseudotyped with VSV-G envelope and used to challenge HeLa-CD4 cells following REAF siRNA knockdown. p24 immunostaining was used to detect FFU compared with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate.

Techniques Used: Over Expression, Transfection, Western Blot, Expressing, Infection, Immunostaining

REAF interacts with viral nucleic acids. (A) Oligo d(T) immunoprecipitation of HeLa-CD4 cell lysate shows that REAF associates with captured RNA. Cell lysate was treated with DNase or titrated RNaseA/H before incubation with oligo (dT) beads. Immunoprecipitated protein was analysed by Western blotting and probed for REAF along with positive (PABP) and negative (GAPDH) controls. (B) HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-REAF antibody. Endogenous and exogenous REAF are detectable in input samples (lanes 1 and 2) and following IP of samples transfected with pEGFP-C3 (endogenous REAF; lanes 7 and 8) or REAF-EGFP (endogenous and exogenous REAF; lane 9 and 10) with α-REAF antibody, but not after IP with IgG alone (lanes 3–6). (C) The amount of RU5 or late HIV-1 DNA qPCR product is quantified and normalised to input and IgG negative controls. Endogenous REAF associates with viral nucleic acids and this is enriched in the cells over-expressing REAF-EGFP.
Figure Legend Snippet: REAF interacts with viral nucleic acids. (A) Oligo d(T) immunoprecipitation of HeLa-CD4 cell lysate shows that REAF associates with captured RNA. Cell lysate was treated with DNase or titrated RNaseA/H before incubation with oligo (dT) beads. Immunoprecipitated protein was analysed by Western blotting and probed for REAF along with positive (PABP) and negative (GAPDH) controls. (B) HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-REAF antibody. Endogenous and exogenous REAF are detectable in input samples (lanes 1 and 2) and following IP of samples transfected with pEGFP-C3 (endogenous REAF; lanes 7 and 8) or REAF-EGFP (endogenous and exogenous REAF; lane 9 and 10) with α-REAF antibody, but not after IP with IgG alone (lanes 3–6). (C) The amount of RU5 or late HIV-1 DNA qPCR product is quantified and normalised to input and IgG negative controls. Endogenous REAF associates with viral nucleic acids and this is enriched in the cells over-expressing REAF-EGFP.

Techniques Used: Immunoprecipitation, Incubation, Western Blot, Transfection, Real-time Polymerase Chain Reaction, Expressing

9) Product Images from "The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein"

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein

Journal: BMC Cancer

doi: 10.1186/1471-2407-10-554

Transient transfection of GFP-BAX fusion protein into HCT116 BAX -/- cells rescues cell death after Indomethacin treatment . (A) HCT116 BAX-/- cells are resistant to indomethacin. Line graph showing percentage of apoptotic cells in the medium after exposure of 500 μM indomethacin for wild type (WT) and BAX -deficient HCT116 cells over time. (B) Rescue of the cell death phenotype by transfection of an exogenous GFP- Bax gene. HCT116 BAX -/- cells were transfected with either no plasmid, pEGFP-C3 (GFP), or pEGFP-C3-BAX (GFP-BAX), which expresses a fusion protein of GFP in phase with the murine Bax coding region under the control of the CMV immediate early promoter. Twenty-four hours after transfection, cells were treated with 500 μM indomethacin (+Indo) or vehicle (-Indo). Transfection efficiency was ~60% in each condition, based on the proportion of cells positive for GFP expression. Forty-eight hours after indomethacin treatment, cell death was assessed. Transfection of GFP-BAX into cells that were later treated with indomethacin caused a significant increase in death over GFP transfection and indomethacin-treated cells ( t -test, * P = 0.0001). Values shown are mean ± SD in both graphs of data collected from 3 independent experiments.
Figure Legend Snippet: Transient transfection of GFP-BAX fusion protein into HCT116 BAX -/- cells rescues cell death after Indomethacin treatment . (A) HCT116 BAX-/- cells are resistant to indomethacin. Line graph showing percentage of apoptotic cells in the medium after exposure of 500 μM indomethacin for wild type (WT) and BAX -deficient HCT116 cells over time. (B) Rescue of the cell death phenotype by transfection of an exogenous GFP- Bax gene. HCT116 BAX -/- cells were transfected with either no plasmid, pEGFP-C3 (GFP), or pEGFP-C3-BAX (GFP-BAX), which expresses a fusion protein of GFP in phase with the murine Bax coding region under the control of the CMV immediate early promoter. Twenty-four hours after transfection, cells were treated with 500 μM indomethacin (+Indo) or vehicle (-Indo). Transfection efficiency was ~60% in each condition, based on the proportion of cells positive for GFP expression. Forty-eight hours after indomethacin treatment, cell death was assessed. Transfection of GFP-BAX into cells that were later treated with indomethacin caused a significant increase in death over GFP transfection and indomethacin-treated cells ( t -test, * P = 0.0001). Values shown are mean ± SD in both graphs of data collected from 3 independent experiments.

Techniques Used: Transfection, Plasmid Preparation, Expressing

10) Product Images from "Full UPF3B function is critical for neuronal differentiation of neural stem cells"

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells

Journal: Molecular Brain

doi: 10.1186/s13041-015-0122-1

Mutations in UPF3B do not affect its cellular distribution in neurons. Neural stem cells were transfected with the pEGFP-C3 expressing GFP only (empty vector) or a pEGFP-C3 derivative expressing one of the UPF3B forms with an N-terminal GFP tag. Cells were diluted and re-plated after 24 h, and then differentiated for 6 days prior to analysis by confocal microscopy. Shown are separate Z-stack projections of GFP and DAPI channels and of the merged channels. The origin region of the enlarged section is indicated. The scale bar represents 20 μm
Figure Legend Snippet: Mutations in UPF3B do not affect its cellular distribution in neurons. Neural stem cells were transfected with the pEGFP-C3 expressing GFP only (empty vector) or a pEGFP-C3 derivative expressing one of the UPF3B forms with an N-terminal GFP tag. Cells were diluted and re-plated after 24 h, and then differentiated for 6 days prior to analysis by confocal microscopy. Shown are separate Z-stack projections of GFP and DAPI channels and of the merged channels. The origin region of the enlarged section is indicated. The scale bar represents 20 μm

Techniques Used: Transfection, Expressing, Plasmid Preparation, Confocal Microscopy

11) Product Images from "Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting"

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting

Journal:

doi: 10.1074/jbc.M113.523639

Ca v 2. 1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting and ankyrin interaction. A , HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern. B and D , in contrast, HEK293 cells transfected with full-length
Figure Legend Snippet: Ca v 2. 1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting and ankyrin interaction. A , HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern. B and D , in contrast, HEK293 cells transfected with full-length

Techniques Used: Transfection

Ca v 2.1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting. HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern ( A and D ), whereas HEK293 cells transfected with Ca v 2.1 DII/III-GFP ( B ) or Ca v 2.2
Figure Legend Snippet: Ca v 2.1/Ca v 2.2 tyrosine residues in ABM are critical for cellular targeting. HEK293 cells transfected with pEGFP-C3 demonstrated a primarily nuclear localization pattern ( A and D ), whereas HEK293 cells transfected with Ca v 2.1 DII/III-GFP ( B ) or Ca v 2.2

Techniques Used: Transfection

12) Product Images from "Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation"

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0104908

hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p
Figure Legend Snippet: hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p

Techniques Used: Over Expression, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Construct, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot

hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.
Figure Legend Snippet: hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.

Techniques Used: Transfection, Expressing, Confocal Microscopy

13) Product Images from "Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking"

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking

Journal:

doi: 10.1128/JVI.79.18.11776-11787.2005

Schematic representation of the plasmids. (A) The plasmid pGFP-VP2 encodes the GFP-VP2 fusion protein. VP2 was amplified by PCR from pUC-AV2 and cloned into the multiple cloning site of pEGFP-C3 (Clontech). During this step, the VP2 start codon was deleted. (B) To produce wild-type AAV, the plasmid pUC-AV2 was used (top). A G-to-C substitution within the wobble position of the VP2 start codon (T138) was introduced, resulting in the plasmid pUC-AV2-VP2k.o. (bottom). Due to the substitution, VP2 expression was abolished without altering the amino acid sequence of VP1.
Figure Legend Snippet: Schematic representation of the plasmids. (A) The plasmid pGFP-VP2 encodes the GFP-VP2 fusion protein. VP2 was amplified by PCR from pUC-AV2 and cloned into the multiple cloning site of pEGFP-C3 (Clontech). During this step, the VP2 start codon was deleted. (B) To produce wild-type AAV, the plasmid pUC-AV2 was used (top). A G-to-C substitution within the wobble position of the VP2 start codon (T138) was introduced, resulting in the plasmid pUC-AV2-VP2k.o. (bottom). Due to the substitution, VP2 expression was abolished without altering the amino acid sequence of VP1.

Techniques Used: Plasmid Preparation, Amplification, Polymerase Chain Reaction, Clone Assay, Expressing, Sequencing

14) Product Images from "Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses"

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses

Journal: Retrovirology

doi: 10.1186/1742-4690-11-3

Over-expression of REAF confers restriction which is viral route of entry dependent. (A) Over-expression of REAF restricts early HIV-1 DNA production. HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-GFP antibody. Transfection of REAF-EGFP results in expression of REAF (110, 160 and 250 kDa including EGFP tag (30 kDa). Endogenous REAF was knocked out of HeLa-CD4 cells using siRNA targeting its 3’ UTR. (B) Infected cells were measured following transient over-expression of REAF-EGFP or pEGFP-C3 and challenge with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate. (C) Transient over-expression of REAF-EGFP in HeLa-CD4 cells results in decreased RU5 and late RT products 8 hr post challenge with HIV-1 89.6 . HIV-1 DNA copies are normalised to genomic GAPDH and presented per million cells. Results are mean ± s.d. of a representative experiment performed in duplicate. (D) Restriction by REAF is dependent upon viral route of entry. HIV-1 89.6Δenv was pseudotyped with VSV-G envelope and used to challenge HeLa-CD4 cells following REAF siRNA knockdown. p24 immunostaining was used to detect FFU compared with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate.
Figure Legend Snippet: Over-expression of REAF confers restriction which is viral route of entry dependent. (A) Over-expression of REAF restricts early HIV-1 DNA production. HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-GFP antibody. Transfection of REAF-EGFP results in expression of REAF (110, 160 and 250 kDa including EGFP tag (30 kDa). Endogenous REAF was knocked out of HeLa-CD4 cells using siRNA targeting its 3’ UTR. (B) Infected cells were measured following transient over-expression of REAF-EGFP or pEGFP-C3 and challenge with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate. (C) Transient over-expression of REAF-EGFP in HeLa-CD4 cells results in decreased RU5 and late RT products 8 hr post challenge with HIV-1 89.6 . HIV-1 DNA copies are normalised to genomic GAPDH and presented per million cells. Results are mean ± s.d. of a representative experiment performed in duplicate. (D) Restriction by REAF is dependent upon viral route of entry. HIV-1 89.6Δenv was pseudotyped with VSV-G envelope and used to challenge HeLa-CD4 cells following REAF siRNA knockdown. p24 immunostaining was used to detect FFU compared with HIV-1 89.6 . Results are shown as FFU/ml and are mean ± s.d. of a representative experiment performed in duplicate.

Techniques Used: Over Expression, Transfection, Western Blot, Expressing, Infection, Immunostaining

REAF interacts with viral nucleic acids. (A) Oligo d(T) immunoprecipitation of HeLa-CD4 cell lysate shows that REAF associates with captured RNA. Cell lysate was treated with DNase or titrated RNaseA/H before incubation with oligo (dT) beads. Immunoprecipitated protein was analysed by Western blotting and probed for REAF along with positive (PABP) and negative (GAPDH) controls. (B) HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-REAF antibody. Endogenous and exogenous REAF are detectable in input samples (lanes 1 and 2) and following IP of samples transfected with pEGFP-C3 (endogenous REAF; lanes 7 and 8) or REAF-EGFP (endogenous and exogenous REAF; lane 9 and 10) with α-REAF antibody, but not after IP with IgG alone (lanes 3–6). (C) The amount of RU5 or late HIV-1 DNA qPCR product is quantified and normalised to input and IgG negative controls. Endogenous REAF associates with viral nucleic acids and this is enriched in the cells over-expressing REAF-EGFP.
Figure Legend Snippet: REAF interacts with viral nucleic acids. (A) Oligo d(T) immunoprecipitation of HeLa-CD4 cell lysate shows that REAF associates with captured RNA. Cell lysate was treated with DNase or titrated RNaseA/H before incubation with oligo (dT) beads. Immunoprecipitated protein was analysed by Western blotting and probed for REAF along with positive (PABP) and negative (GAPDH) controls. (B) HEK 293 T cells were transiently transfected with pEGFP-C3 or REAF-EGFP and the Western blot probed with α-REAF antibody. Endogenous and exogenous REAF are detectable in input samples (lanes 1 and 2) and following IP of samples transfected with pEGFP-C3 (endogenous REAF; lanes 7 and 8) or REAF-EGFP (endogenous and exogenous REAF; lane 9 and 10) with α-REAF antibody, but not after IP with IgG alone (lanes 3–6). (C) The amount of RU5 or late HIV-1 DNA qPCR product is quantified and normalised to input and IgG negative controls. Endogenous REAF associates with viral nucleic acids and this is enriched in the cells over-expressing REAF-EGFP.

Techniques Used: Immunoprecipitation, Incubation, Western Blot, Transfection, Real-time Polymerase Chain Reaction, Expressing

Related Articles

Clone Assay:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study. .. Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The vector used was pEGFP-C3 (Clontech). .. Plasmid construct HIV-189.6Δenv was generated from the HIV-189.6 molecular clone using overlap extension PCR.

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: Furthermore, experiments using a GFP-BAX fusion protein, indicate that normal aggregation of BAX is impaired at non-lethal levels, suggesting that the level of BAX is critical for the successful activation of this proapoptotic protein, and not related to overcoming a defined number of anti-apoptotic proteins. .. To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Paragraph title: Cloning and cDNA constructs ... EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector.

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The 3xFLAG-tagged G3BP1 constructs were generated from p3xFLAG-CMV10 (Sigma) using standard cloning techniques. .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively.

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: Under indicated situations, 10 μM ATM inhibitor (KU55933), 20 μM DNA-PK inhibitor (NU7026), or 50 μM PARP inhibitor (ABT-888) were applied to cells 1 h prior to laser microirradiation. .. Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively. .. Anti-Flag M2 agarose affinity gel was purchased from Sigma (A2220).

Amplification:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: ZNF-134-GFP-C3 : hznf-134 gene was amplified from cDNA reverse transcribed from Astrocytoma 1321N1 using primers ZNF-GFP-FP and ZNF-GFP-RP and cloned into XhoI and BamHI sites of the vector pEGFP-C3 ( ). .. Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes. .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes.

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Article Title: Novel role of KCNQ2/3 channels in regulating neuronal cell viability
Article Snippet: Plasmids encoding rat KCNQ2 (GenBank: ) and rat KCNQ3 (GenBank: AF-91247) were subcloned into pEGFP-C3 and pDsRed2-C1 (Clontech, Mountain View, CA, USA), respectively. .. Plasmids encoding rat KCNQ2 (GenBank: ) and rat KCNQ3 (GenBank: AF-91247) were subcloned into pEGFP-C3 and pDsRed2-C1 (Clontech, Mountain View, CA, USA), respectively.

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: To obtain the plasmid pGFP-VP2, the sequence encoding VP2 was amplified from pSUB201+ by PCR using the primer pair VP2-N (5′-CTCCGGGAAAAAAGAGG-3′) and VP2-C (5′-TTACAGATTACGAGTCAGGTAT-3′), thereby deleting the VP2 start codon. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

Synthesized:

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: FUS mRRM/mZnF (F305L/K312A/K315A/K316A/F341L/F359L/F368L/D425A/N435A/F438A/W440A/R441A/N445A) and mRGG cDNAs were commercially synthesized (Genscript) and cloned by enzyme restriction digest into the pEGFP-C2 (Clontech) mammalian expression vector. .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector.

Construct:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: Paragraph title: Plasmids and constructs ... Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The vector used was pEGFP-C3 (Clontech). .. The vector used was pEGFP-C3 (Clontech).

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: Paragraph title: Cav 2.1 and Cav 2.2 Constructs ... To facilitate subcloning into pEGFP-C3 (Clontech), primers were designed to incorporate 5′ EcoRI and 3′ BamHI restriction sites.

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: Furthermore, experiments using a GFP-BAX fusion protein, indicate that normal aggregation of BAX is impaired at non-lethal levels, suggesting that the level of BAX is critical for the successful activation of this proapoptotic protein, and not related to overcoming a defined number of anti-apoptotic proteins. .. To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Constructs encoding flag-TDP-43 and RNA-binding-deficient mutants thereof were kindly provided by Emanuele Buratti and Francisco Baralle , . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector. .. Lentiviral constructs used for generation of stable HeLa cell lines were in pCDH-Ef1-MCS-IRES-Puro (System Biosciences).

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The F380L/F382L G3BP1 mutation and the W32S SOD1 mutation were introduced with the QuikChange II Site-Directed Mutagenesis Kit (Agilent). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Luciferase:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: The DNA-lipofectamine complex was kept at RT for 30 min followed by addition to the cells. .. For luciferase based assay, pLTR-luc (30 ng/well) and pRL-TK (5 ng/well) were co-transfected with pEGFP-C3 or ZNF-134-GFP-C3 (100 ng/well) or pcTAT (20 ng/well) separately or together. .. 48 hours post transfection, cells were harvested and analyzed for luciferase activity using Dual Glow Luciferase assay Kit as per the manufacturer's protocol (Promega, USA).

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: pGL3-promoter expressing firefly luciferase was from Promega and phrGFP-C was from Stratagene/Agilent. .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes.

Infection:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: The clones were confirmed by sequencing (Eurofins, India). .. Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study. .. All experiments were performed in the facilities approved for Mycobacterial and HIV cultures by University of Hyderabad Institutional Biosafety Committee under Department of Biotechnology, Govt. of India (UH/SLS/IBSC/Review/facilities F-60 & F-70).

Expressing:

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The REAF-EGFP expression plasmid was generated by PCR amplifying the open reading frame from HeLa-CD4 cDNA. .. The vector used was pEGFP-C3 (Clontech).

Article Title: The ESCRT System Is Required for Hepatitis C Virus Production
Article Snippet: Then, we examined whether or not HCV Core can bind to CHMP4b by immunoprecipitation analysis. .. 293FT cells transfected with 4 mg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG , pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed and performed immunoprecipitation of lysate mixtures of HCV-JFH1-infected RSc cells and 293FT cells expressing CHMP4b-GFP, GFP alone, FLAG-CHMP4b or FLAG-epitope alone with anti-FLAG or anti-GFP antibody. .. Consequently, we observed that the Core but not the NS5A could bind to FLAG-CHMP4b ( ).

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: Plasmids pCI-λNhUPF3B and pCI- λNhUPF3BArg423Ala expressing the human UPF3B isoform 2 (GenBank:NP_075386) and the UPF3BArg423Ala protein were a generous gift of Niels Gehring (University of Cologne, Germany) [ ]. .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes.

Article Title: Novel role of KCNQ2/3 channels in regulating neuronal cell viability
Article Snippet: Paragraph title: Expression of KCNQ2/3 channels in CHO cells ... Plasmids encoding rat KCNQ2 (GenBank: ) and rat KCNQ3 (GenBank: AF-91247) were subcloned into pEGFP-C3 and pDsRed2-C1 (Clontech, Mountain View, CA, USA), respectively.

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: Secondary and tertiary neurites originating from neuritic processes and ending at a terminus were classified as branches. .. For the localisation of GFP-UPF3B fusion proteins HCN-A94 cells were seeded in 6-well plates and the following day were transfected with 5 μg of pEGFP-C3 or derivatives expressing GFP-UPF3B fusion proteins using Lipofectamine 2000 as per manufacturer’s instructions. .. The medium was removed and cells were fixed in PBS/4 % paraformaldehyde for 10 min at room temperature and washed three times with PBS for 5 min.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Constructs encoding flag-TDP-43 and RNA-binding-deficient mutants thereof were kindly provided by Emanuele Buratti and Francisco Baralle , . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector. .. Lentiviral constructs used for generation of stable HeLa cell lines were in pCDH-Ef1-MCS-IRES-Puro (System Biosciences).

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The F380L/F382L G3BP1 mutation and the W32S SOD1 mutation were introduced with the QuikChange II Site-Directed Mutagenesis Kit (Agilent). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: Under indicated situations, 10 μM ATM inhibitor (KU55933), 20 μM DNA-PK inhibitor (NU7026), or 50 μM PARP inhibitor (ABT-888) were applied to cells 1 h prior to laser microirradiation. .. Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively. .. Anti-Flag M2 agarose affinity gel was purchased from Sigma (A2220).

Modification:

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: To generate GCR2 -EGFP2 -TDP-43 and GCR2 -EGFP2 -FUS constructs, TDP-43 and FUS cDNAs were cloned by enzyme restriction digest into the modified pEGFP-C1 vector containing a GCR2 -EGFP2 cassette . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector.

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: All cell lines were grown in Dulbecco Modified Eagle medium (DMEM) at 37°C, 5% CO2 with 10% fetal bovine serum. .. Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively.

Countercurrent Chromatography:

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: Furthermore, experiments using a GFP-BAX fusion protein, indicate that normal aggregation of BAX is impaired at non-lethal levels, suggesting that the level of BAX is critical for the successful activation of this proapoptotic protein, and not related to overcoming a defined number of anti-apoptotic proteins. .. To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Transfection:

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The vector used was pEGFP-C3 (Clontech). .. The vector used was pEGFP-C3 (Clontech).

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: The plots are denoted as fold increase in the luciferase activity as compared to control. .. For quantification of the LTR driven viral transcripts, second round of transfection was performed with pNL4-3 vector (40 ng/well) after 24 hours of transfection of pEGFP-C3 or ZNF-134-GFP-C3 vector. .. The transfection efficiencies of pNL4-3 were normalized with pRL-TK.

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: GAPDH (36 kDa) is added as a loading control. (B) Target sequence of REAF 3’UTR siRNA. .. Click here for file Transfection efficiency of REAF-EGFP compared to pEGFP-C3. .. HeLa-CD4 cells transfected with REAF-EGFP or pEGFP-C3 empty vector.

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: After 48 h, the cells were fixed with 2% paraformaldehyde, stained with ToPro (to discriminate nuclear material), and evaluated by confocal microscopy. .. Likewise, transfections using Cav 2.1 DII/III pEGFP-C3, Cav 2.1 DII/III Y797E pEGFP-C3, and pEGFP-C3 alone were also performed using the same protocol. .. HEK293 cells were maintained in Dulbecco's modified essential medium supplemented with 10% FBS and 0.1% penicillin/streptomycin.

Article Title: The ESCRT System Is Required for Hepatitis C Virus Production
Article Snippet: Then, we examined whether or not HCV Core can bind to CHMP4b by immunoprecipitation analysis. .. 293FT cells transfected with 4 mg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG , pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed and performed immunoprecipitation of lysate mixtures of HCV-JFH1-infected RSc cells and 293FT cells expressing CHMP4b-GFP, GFP alone, FLAG-CHMP4b or FLAG-epitope alone with anti-FLAG or anti-GFP antibody. .. Consequently, we observed that the Core but not the NS5A could bind to FLAG-CHMP4b ( ).

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: Secondary and tertiary neurites originating from neuritic processes and ending at a terminus were classified as branches. .. For the localisation of GFP-UPF3B fusion proteins HCN-A94 cells were seeded in 6-well plates and the following day were transfected with 5 μg of pEGFP-C3 or derivatives expressing GFP-UPF3B fusion proteins using Lipofectamine 2000 as per manufacturer’s instructions. .. The medium was removed and cells were fixed in PBS/4 % paraformaldehyde for 10 min at room temperature and washed three times with PBS for 5 min.

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively. .. Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively.

Ligation:

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: The plasmid pUC-AV2-VP2k.o. was obtained by PCR amplification combined with site-directed mutagenesis of pUC-AV2, changing the ACG start codon into ACC by using overlapping PCR fragments (VP2ko_for, 5′-GTTAAGACCGCTCCGGG-3′; and 4066, 5′-ATGTCCGTCCGTGTGTGG-3′; VP2ko_back, 5′-CCCGGAGCGGTCTTAAC-3′; and 3201, 5′-GGTACGACGACGATTGCC-3′) and ligation of the fragments in a second PCR step with the primers 3201 and 4066. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

Cell Culture:

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: Paragraph title: Cell culture and reagents ... Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively.

Hemagglutination Assay:

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: An HA tag was introduced into these plasmids in the XhoI site between the λN and UPF3B domains, producing pCI-λN-HA-UPF3B and pCI-λN-HA-UPF3B-Ala423. .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes.

Article Title: RBM45 competes with HDAC1 for binding to FUS in response to DNA damage
Article Snippet: Under indicated situations, 10 μM ATM inhibitor (KU55933), 20 μM DNA-PK inhibitor (NU7026), or 50 μM PARP inhibitor (ABT-888) were applied to cells 1 h prior to laser microirradiation. .. Full-length RBM45, HDAC1 and FUS cDNAs were cloned into pEGFP-C3 (Clontech), MC-Flag-pCS2, MC-HA-pCS2, or pNTAP expression vectors as indicated to generate EGFP, Flag, HA or SBP fusion proteins, respectively. .. Anti-Flag M2 agarose affinity gel was purchased from Sigma (A2220).

Generated:

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The REAF-EGFP expression plasmid was generated by PCR amplifying the open reading frame from HeLa-CD4 cDNA. .. The vector used was pEGFP-C3 (Clontech).

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: Full-length Cav 2.1 constructs were generated from rat Cav 2.1. .. To facilitate subcloning into pEGFP-C3 (Clontech), primers were designed to incorporate 5′ EcoRI and 3′ BamHI restriction sites.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Constructs encoding flag-TDP-43 and RNA-binding-deficient mutants thereof were kindly provided by Emanuele Buratti and Francisco Baralle , . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector. .. Lentiviral constructs used for generation of stable HeLa cell lines were in pCDH-Ef1-MCS-IRES-Puro (System Biosciences).

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The F380L/F382L G3BP1 mutation and the W32S SOD1 mutation were introduced with the QuikChange II Site-Directed Mutagenesis Kit (Agilent). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Sequencing:

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study. .. Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The vector used was pEGFP-C3 (Clontech). .. Plasmid construct HIV-189.6Δenv was generated from the HIV-189.6 molecular clone using overlap extension PCR.

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: Primers were designed to clone amino acids 710–1139 (Cav 2.2 DII/III loop), 779–1139, and 799–1139 from a murine brain cDNA library based on the sequence obtained from GenBank ( ). .. To facilitate subcloning into pEGFP-C3 (Clontech), primers were designed to incorporate 5′ EcoRI and 3′ BamHI restriction sites.

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: To obtain the plasmid pGFP-VP2, the sequence encoding VP2 was amplified from pSUB201+ by PCR using the primer pair VP2-N (5′-CTCCGGGAAAAAAGAGG-3′) and VP2-C (5′-TTACAGATTACGAGTCAGGTAT-3′), thereby deleting the VP2 start codon. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Cellular Antioxidant Activity Assay:

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Mutagenesis:

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: Other mutations were introduced into pCI-λN-HA-hUPF3B by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes.

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: The plasmid pUC-AV2-VP2k.o. was obtained by PCR amplification combined with site-directed mutagenesis of pUC-AV2, changing the ACG start codon into ACC by using overlapping PCR fragments (VP2ko_for, 5′-GTTAAGACCGCTCCGGG-3′; and 4066, 5′-ATGTCCGTCCGTGTGTGG-3′; VP2ko_back, 5′-CCCGGAGCGGTCTTAAC-3′; and 3201, 5′-GGTACGACGACGATTGCC-3′) and ligation of the fragments in a second PCR step with the primers 3201 and 4066. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: TDP-43 and FUS constructs carrying mutations in the NLS (mNLS, for TDP-43: amino acids 83–85 exchanged for alanine; for FUS: P525L mutation) as well as in the putative NESs (mNLS/double-mNES) were generated by QuikChange mutagenesis (Stratagene). .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector.

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The F380L/F382L G3BP1 mutation and the W32S SOD1 mutation were introduced with the QuikChange II Site-Directed Mutagenesis Kit (Agilent). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Subcloning:

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: To facilitate subcloning into pcDNA3.1+ (Invitrogen), primers were designed to incorporate 5′ EcoRI and 3′ XhoI restriction sites. .. To facilitate subcloning into pEGFP-C3 (Clontech), primers were designed to incorporate 5′ EcoRI and 3′ BamHI restriction sites. .. Full-length Cav 2.2 constructs were generated from rat Cav 2.2.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Constructs encoding flag-TDP-43 and RNA-binding-deficient mutants thereof were kindly provided by Emanuele Buratti and Francisco Baralle , . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector. .. Lentiviral constructs used for generation of stable HeLa cell lines were in pCDH-Ef1-MCS-IRES-Puro (System Biosciences).

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The F380L/F382L G3BP1 mutation and the W32S SOD1 mutation were introduced with the QuikChange II Site-Directed Mutagenesis Kit (Agilent). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively. .. The mCherry-WT and F380L/F382L double mutant G3BP1 constructs were made by subcloning the respective G3BP1 fragments to pmCherry-C1 (Clontech).

Polymerase Chain Reaction:

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The REAF-EGFP expression plasmid was generated by PCR amplifying the open reading frame from HeLa-CD4 cDNA. .. The vector used was pEGFP-C3 (Clontech).

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. To generate constructs in the pTRE-Tight vector (Clontech), GFP-BAX was amplified from the pEGFP-C3 plasmid using 5'GCA TGC GAT AGG TAC CAT GGT GAG CAA GGG CGA GG (forward, includes Kpn I site) and 5'GTC GCG TCC TAA GCT TTC AGC CCA TCT TCT TCC (reverse, includes Hind III site).

Article Title: Novel role of KCNQ2/3 channels in regulating neuronal cell viability
Article Snippet: Plasmids encoding rat KCNQ2 (GenBank: ) and rat KCNQ3 (GenBank: AF-91247) were subcloned into pEGFP-C3 and pDsRed2-C1 (Clontech, Mountain View, CA, USA), respectively. .. Plasmids encoding rat KCNQ2 (GenBank: ) and rat KCNQ3 (GenBank: AF-91247) were subcloned into pEGFP-C3 and pDsRed2-C1 (Clontech, Mountain View, CA, USA), respectively.

Article Title: Lysosomal trafficking functions of mucolipin-1 in murine macrophages
Article Snippet: Plasmid pHD300 encoding a fusion protein of EGFP to the amino-terminus of mouse ML1 is the ~1.7 kb PCR fragment (template: mouse cDNA; primers: 5' CACACAAAGCTTATGGCCACCCCGGCGGGCCGGCGC 3' and 5' CACACAGTCGACTCAGTTCACCAGCAGCGAATGGTC 3') restriction digested with Hind III + Sal I and inserted into the same sites of pEGFP-C3 (Clontech, Mountain View, CA). .. Plasmid pHD334, in which the red fluorescent protein mCherry replaces EGFP in the same frame of pEGFP-C3, was made by restriction digesting the 720 bp PCR fragment (template: pmCherry; primers: 5' CACACAACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGG 3' and 5' CACACAAGATCTGAGTACTTGTACAGCTCGTCCATGCCG 3') with Age I + Bgl II and inserting into the same sites of pEGFP-C3 [ ]. .. Plasmid pHD339 encoding a fusion protein of mCherry to the amino-terminus of mouse ML1, was made by subcloning the ~1.7 kb Hind III + Sal I fragment from pHD300 into the same sites of pHD334.

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: To obtain the plasmid pGFP-VP2, the sequence encoding VP2 was amplified from pSUB201+ by PCR using the primer pair VP2-N (5′-CTCCGGGAAAAAAGAGG-3′) and VP2-C (5′-TTACAGATTACGAGTCAGGTAT-3′), thereby deleting the VP2 start codon. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

cDNA Library Assay:

Article Title: Ankyrin-B Regulates Cav2.1 and Cav2.2 Channel Expression and Targeting
Article Snippet: Primers were designed to clone amino acids 710–1139 (Cav 2.2 DII/III loop), 779–1139, and 799–1139 from a murine brain cDNA library based on the sequence obtained from GenBank ( ). .. To facilitate subcloning into pEGFP-C3 (Clontech), primers were designed to incorporate 5′ EcoRI and 3′ BamHI restriction sites.

Chloramphenicol Acetyltransferase Assay:

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Plasmid Preparation:

Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells
Article Snippet: These results suggested that the interaction between oxLDL and CD36 can be blocked using recombinant proteins and this may be useful in potential control of the trafficking of modified lipoproteins into monocytes leading to atherogenesis. .. pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA). .. TheExgen 500 transfection kit and restriction enzymes, KphI and HindIII were from Fermentas (Burlinton, ON, Canada).

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: ZNF-134-GFP-C3 : hznf-134 gene was amplified from cDNA reverse transcribed from Astrocytoma 1321N1 using primers ZNF-GFP-FP and ZNF-GFP-RP and cloned into XhoI and BamHI sites of the vector pEGFP-C3 ( ). .. Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

Article Title: Novel restriction factor RNA-associated early-stage anti-viral factor (REAF) inhibits human and simian immunodeficiency viruses
Article Snippet: The REAF-EGFP expression plasmid was generated by PCR amplifying the open reading frame from HeLa-CD4 cDNA. .. The vector used was pEGFP-C3 (Clontech). .. The infectious molecular clone for HIV-189.6 was obtained from the Centre for AIDS Research (NIBSC, UK).

Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation
Article Snippet: The plots are denoted as fold increase in the luciferase activity as compared to control. .. For quantification of the LTR driven viral transcripts, second round of transfection was performed with pNL4-3 vector (40 ng/well) after 24 hours of transfection of pEGFP-C3 or ZNF-134-GFP-C3 vector. .. The transfection efficiencies of pNL4-3 were normalized with pRL-TK.

Article Title: Full UPF3B function is critical for neuronal differentiation of neural stem cells
Article Snippet: This resulted in plasmids pCI-λN-HA-UPF3B-Asp160, pCI-λN-HA-UPF3B-Lys225, pCI-λN-HA-UPF3B-Gln355, pCI-λN-HA-UPF3B-His366 and pCI-λN-HA-UPF3B-Ala423, respectively. .. UPF3B fragments were excised from the pCI-λN-HA plasmids using XhoI and SalI and inserted into pEGFP-C3 (Clontech Laboratories) plasmid cleaved with the same enzymes. .. This resulted in plasmids pEGFP-UPF3B, pEGFP-UPF3B-Asp160, pEGFP-UPF3B-Lys225, pEGFP-UPF3B-Gln355, UPF3B-His366 and pEGFP-UPF3B-Ala423.

Article Title: The apoptotic response in HCT116BAX-/- cancer cells becomes rapidly saturated with increasing expression of a GFP-BAX fusion protein
Article Snippet: To generate the GFP-BAX fusion protein construct, murine Bax was cloned into pEGFP-C3 (Clontech, Palo Alto, CA) by first amplifying Bax cDNA using the following primers: 5'ACC CGC CGA GAG GCA GCG (forward) and 5'CAC AGT CCC AGG CAG TGG G (reverse). .. Nested PCR was used to engineer a Hind III and EcoR I site onto the Bax cDNA for in-frame ligation to the C-terminus of GFP.

Article Title: Lysosomal trafficking functions of mucolipin-1 in murine macrophages
Article Snippet: Plasmid pHD300 encoding a fusion protein of EGFP to the amino-terminus of mouse ML1 is the ~1.7 kb PCR fragment (template: mouse cDNA; primers: 5' CACACAAAGCTTATGGCCACCCCGGCGGGCCGGCGC 3' and 5' CACACAGTCGACTCAGTTCACCAGCAGCGAATGGTC 3') restriction digested with Hind III + Sal I and inserted into the same sites of pEGFP-C3 (Clontech, Mountain View, CA). .. Plasmid pHD334, in which the red fluorescent protein mCherry replaces EGFP in the same frame of pEGFP-C3, was made by restriction digesting the 720 bp PCR fragment (template: pmCherry; primers: 5' CACACAACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGG 3' and 5' CACACAAGATCTGAGTACTTGTACAGCTCGTCCATGCCG 3') with Age I + Bgl II and inserting into the same sites of pEGFP-C3 [ ]. .. Plasmid pHD339 encoding a fusion protein of mCherry to the amino-terminus of mouse ML1, was made by subcloning the ~1.7 kb Hind III + Sal I fragment from pHD300 into the same sites of pHD334.

Article Title: Green Fluorescent Protein-Tagged Adeno-Associated Virus Particles Allow the Study of Cytosolic and Nuclear Trafficking
Article Snippet: To obtain the plasmid pGFP-VP2, the sequence encoding VP2 was amplified from pSUB201+ by PCR using the primer pair VP2-N (5′-CTCCGGGAAAAAAGAGG-3′) and VP2-C (5′-TTACAGATTACGAGTCAGGTAT-3′), thereby deleting the VP2 start codon. .. It was then ligated into pEGFP-C3 (Clontech), which was digested with Bgl II and filled in by Klenow polymerase.

Article Title: Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1
Article Snippet: Constructs encoding flag-TDP-43 and RNA-binding-deficient mutants thereof were kindly provided by Emanuele Buratti and Francisco Baralle , . .. EGFP-TDP-43 (F4L) construct was generated by subcloning TDP-43-4FL into the pEGFP-C3 (Clontech) mammalian expression vector. .. Lentiviral constructs used for generation of stable HeLa cell lines were in pCDH-Ef1-MCS-IRES-Puro (System Biosciences).

Article Title: ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics
Article Snippet: The human G3BP1 expression constructs used in this study were based on the FLAG-G3BP1 plasmid [ ], a generous gift from Dr. Zhi-Min Yuan (University of Texas Health Science Center at San Antonio). .. The A4V/W32S double mutant SOD1-EGFP and the EGFP-G3BP1 expression constructs were generated by subcloning the respective fragments to pEGFP-N3 and pEGFP-C3 (Clontech), respectively.

Immunoprecipitation:

Article Title: The ESCRT System Is Required for Hepatitis C Virus Production
Article Snippet: Then, we examined whether or not HCV Core can bind to CHMP4b by immunoprecipitation analysis. .. 293FT cells transfected with 4 mg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG , pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed and performed immunoprecipitation of lysate mixtures of HCV-JFH1-infected RSc cells and 293FT cells expressing CHMP4b-GFP, GFP alone, FLAG-CHMP4b or FLAG-epitope alone with anti-FLAG or anti-GFP antibody. .. Consequently, we observed that the Core but not the NS5A could bind to FLAG-CHMP4b ( ).

DNA Purification:

Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells
Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA). .. pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

FLAG-tag:

Article Title: The ESCRT System Is Required for Hepatitis C Virus Production
Article Snippet: Then, we examined whether or not HCV Core can bind to CHMP4b by immunoprecipitation analysis. .. 293FT cells transfected with 4 mg of pCHMP4b-GFP, pEGFP C3 (Clontech), pcDNA3-FLAG , pcDNA3-FLAG-Alix or pFLAG-CHMP4b and RSc cells 5 days after inoculation of HCV-JFH1 at an MOI of 4 were lysed and performed immunoprecipitation of lysate mixtures of HCV-JFH1-infected RSc cells and 293FT cells expressing CHMP4b-GFP, GFP alone, FLAG-CHMP4b or FLAG-epitope alone with anti-FLAG or anti-GFP antibody. .. Consequently, we observed that the Core but not the NS5A could bind to FLAG-CHMP4b ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa pegfp c3
    Deficiency of uptake oxLDL by <t>pEGFP-C3-CD36</t> was partially rescued by surface binding . The transfection was same as described in Fig. 4. After 48 hours of transfection, cells were rinsed with PBS twice and fixed with 4% paraformaldehyde for 30 min, and then incubated with Dil-OxLDL at 10 μg/ml for 2 hours at room temperature. After washed for three times with PBS, cells were collected and assayed with flow cytometry. The results are an average of three experiments. Dark box: oxLDL uptaking and grey box: oxLDL surface binding.
    Pegfp C3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 195 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c3/product/TaKaRa
    Average 99 stars, based on 195 article reviews
    Price from $9.99 to $1999.99
    pegfp c3 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Deficiency of uptake oxLDL by pEGFP-C3-CD36 was partially rescued by surface binding . The transfection was same as described in Fig. 4. After 48 hours of transfection, cells were rinsed with PBS twice and fixed with 4% paraformaldehyde for 30 min, and then incubated with Dil-OxLDL at 10 μg/ml for 2 hours at room temperature. After washed for three times with PBS, cells were collected and assayed with flow cytometry. The results are an average of three experiments. Dark box: oxLDL uptaking and grey box: oxLDL surface binding.

    Journal: Lipids in Health and Disease

    Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

    doi: 10.1186/1476-511X-6-24

    Figure Lengend Snippet: Deficiency of uptake oxLDL by pEGFP-C3-CD36 was partially rescued by surface binding . The transfection was same as described in Fig. 4. After 48 hours of transfection, cells were rinsed with PBS twice and fixed with 4% paraformaldehyde for 30 min, and then incubated with Dil-OxLDL at 10 μg/ml for 2 hours at room temperature. After washed for three times with PBS, cells were collected and assayed with flow cytometry. The results are an average of three experiments. Dark box: oxLDL uptaking and grey box: oxLDL surface binding.

    Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

    Techniques: Binding Assay, Transfection, Incubation, Flow Cytometry, Cytometry

    Confocal microscopy to observe both GFP and huCD36 protein expression . Constructs of pEGFP-C3-CD36, pEGFP-N3-CD36, and pEGFP-N3 vector alone, were transit-transfected into CHO cells for 48 hours, and the transfected cells were then immunostained with anti-CD36 antibody, counter-stained with TRIC-conjugated anti-mouse IgG secondary antibody. After washing several times, cells were mounted on slides and observed under confocal microscope. Top panel: pEGFP-N3 transfected alone; Middle panel: cells transfected with pEGFP-C3-CD36; Bottom panel: pEGFP-N3-CD36 transfected. Both GFP and CD36 were expressed in two constructs.

    Journal: Lipids in Health and Disease

    Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

    doi: 10.1186/1476-511X-6-24

    Figure Lengend Snippet: Confocal microscopy to observe both GFP and huCD36 protein expression . Constructs of pEGFP-C3-CD36, pEGFP-N3-CD36, and pEGFP-N3 vector alone, were transit-transfected into CHO cells for 48 hours, and the transfected cells were then immunostained with anti-CD36 antibody, counter-stained with TRIC-conjugated anti-mouse IgG secondary antibody. After washing several times, cells were mounted on slides and observed under confocal microscope. Top panel: pEGFP-N3 transfected alone; Middle panel: cells transfected with pEGFP-C3-CD36; Bottom panel: pEGFP-N3-CD36 transfected. Both GFP and CD36 were expressed in two constructs.

    Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

    Techniques: Confocal Microscopy, Expressing, Construct, Plasmid Preparation, Transfection, Staining, Microscopy

    pEGFP-C3-CD36 limited OxLDL uptake, but not for pEGFP-N3-CD36 . pEGFP-C3-CD36 and pEGFP-N3-CD36, as well as pEGFP-N3 alone were transit-transfected into CHO cells. After transfection for 48 hours, cells were rinsed twice with PBS and Dil-oxLDL at 10 μg/ml was incubated with the transfected cells for 1 hour. After rinsed for three times with PBS, cells were mounted on coverlids and observed under confocal microscope. Typical transfected and Dil-oxLDL was photographed. Dil-oxLDL was only weakly bound to pEGFP-C3-CD36 transfected cells.

    Journal: Lipids in Health and Disease

    Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

    doi: 10.1186/1476-511X-6-24

    Figure Lengend Snippet: pEGFP-C3-CD36 limited OxLDL uptake, but not for pEGFP-N3-CD36 . pEGFP-C3-CD36 and pEGFP-N3-CD36, as well as pEGFP-N3 alone were transit-transfected into CHO cells. After transfection for 48 hours, cells were rinsed twice with PBS and Dil-oxLDL at 10 μg/ml was incubated with the transfected cells for 1 hour. After rinsed for three times with PBS, cells were mounted on coverlids and observed under confocal microscope. Typical transfected and Dil-oxLDL was photographed. Dil-oxLDL was only weakly bound to pEGFP-C3-CD36 transfected cells.

    Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

    Techniques: Transfection, Incubation, Microscopy

    Both N- and C-terminal tagged huCD36 bind normally to pRBCs . After transfection with pEGFP-C3-CD36, pEGFP-N3-CD36 or pEGFP-N3 alone, cells were fixed with 4% paraformaldehyde for 20 min and then rinsed twice with PBS. The cells were then incubated with pRBCs for 4 hours at room temperature with gent shacking. pRBCs bindings were observed under fluorescent microscope and typical binding cells were photographed. pRBCs were bound to both pEGFP-C3-CD36 and pEGFP-N3-CD36 transfected cells.

    Journal: Lipids in Health and Disease

    Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

    doi: 10.1186/1476-511X-6-24

    Figure Lengend Snippet: Both N- and C-terminal tagged huCD36 bind normally to pRBCs . After transfection with pEGFP-C3-CD36, pEGFP-N3-CD36 or pEGFP-N3 alone, cells were fixed with 4% paraformaldehyde for 20 min and then rinsed twice with PBS. The cells were then incubated with pRBCs for 4 hours at room temperature with gent shacking. pRBCs bindings were observed under fluorescent microscope and typical binding cells were photographed. pRBCs were bound to both pEGFP-C3-CD36 and pEGFP-N3-CD36 transfected cells.

    Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

    Techniques: Transfection, Incubation, Microscopy, Binding Assay

    Schematic diagram of p-EGFP-C3-CD36 and peGFP-N3-Cd36 constructs . A, the coding sites of vectors, pEGFP-C3 and pEGFP-N3, were restriction enzymatically cut with both Hind III and Kpn I and the DNA fragments were purified. The inserts, PCR-amplified hCD36 coding sequences after purification, were ligated into the vectors, resulted in recombinant constructs of pEGFP-C3-CD36 or pEGFP-N3-CD36. B, 2% agarose gel to confirm the DNA constructs. Lane 1 and 2, Hind III and Kpn I cut and then purified pEGFP-C3 and pEGFP-N3 plasmid DNAs; Lane 3, purified PCR-amplified huCD36 cDNAs; Lane 4, PEGFP-C3-huCD36 constructs; Lane 5, pEGFP-N3-huCD36 constructs; Lane 6 and 7 are re-digested pEGF-C3-hCD36 and pEGFP-N3-hCD36 with Hind III and Kpn I. Lane 8, 1 Kb DNA markers.

    Journal: Lipids in Health and Disease

    Article Title: Expression of both N- and C-terminal GFP tagged huCD36 and their discrepancy in OxLDL and pRBC binding on CHO cells

    doi: 10.1186/1476-511X-6-24

    Figure Lengend Snippet: Schematic diagram of p-EGFP-C3-CD36 and peGFP-N3-Cd36 constructs . A, the coding sites of vectors, pEGFP-C3 and pEGFP-N3, were restriction enzymatically cut with both Hind III and Kpn I and the DNA fragments were purified. The inserts, PCR-amplified hCD36 coding sequences after purification, were ligated into the vectors, resulted in recombinant constructs of pEGFP-C3-CD36 or pEGFP-N3-CD36. B, 2% agarose gel to confirm the DNA constructs. Lane 1 and 2, Hind III and Kpn I cut and then purified pEGFP-C3 and pEGFP-N3 plasmid DNAs; Lane 3, purified PCR-amplified huCD36 cDNAs; Lane 4, PEGFP-C3-huCD36 constructs; Lane 5, pEGFP-N3-huCD36 constructs; Lane 6 and 7 are re-digested pEGF-C3-hCD36 and pEGFP-N3-hCD36 with Hind III and Kpn I. Lane 8, 1 Kb DNA markers.

    Article Snippet: pEGFP-C3 and pEGFP-N3 plasmid DNA were purchased from Clontech Laboratories, Inc. (Pulo Alto, CA, USA).

    Techniques: Construct, Purification, Polymerase Chain Reaction, Amplification, Recombinant, Agarose Gel Electrophoresis, Plasmid Preparation

    Fluorescence microscopic imaging of pEGFP-C3 transfected HeLa cells. Cells were transfected of 50% FBS: (A–I) −FBS+FBS and (J–R) +FBS+FBS. Cells were treated with (A and J) Cells only; (B and K) Effectene using manufacturers protocol; (C and L) CholHG-1ox, N/P ratio 0.5; (D and M) CholHG-2ox, N/P ratio 0.5; (E and N) CholHG-3ox, N/P ratio 0.75; (F and O) CholHG-4ox, N/P ratio 0.75; (G and P) CholG-D, N/P ratio 1; (H and Q) CholHG-D, N/P ratio 1 and (I and R) Chol-M, N/P ratio 4. Plasmid DNA pEGFP-C3, 0.8 µg was used in study.

    Journal: PLoS ONE

    Article Title: Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids

    doi: 10.1371/journal.pone.0068305

    Figure Lengend Snippet: Fluorescence microscopic imaging of pEGFP-C3 transfected HeLa cells. Cells were transfected of 50% FBS: (A–I) −FBS+FBS and (J–R) +FBS+FBS. Cells were treated with (A and J) Cells only; (B and K) Effectene using manufacturers protocol; (C and L) CholHG-1ox, N/P ratio 0.5; (D and M) CholHG-2ox, N/P ratio 0.5; (E and N) CholHG-3ox, N/P ratio 0.75; (F and O) CholHG-4ox, N/P ratio 0.75; (G and P) CholG-D, N/P ratio 1; (H and Q) CholHG-D, N/P ratio 1 and (I and R) Chol-M, N/P ratio 4. Plasmid DNA pEGFP-C3, 0.8 µg was used in study.

    Article Snippet: We have used plasmid pEGFP-C3 (Clontech USA) and plasmid PGL-3 for the gene transfection studies.

    Techniques: Fluorescence, Imaging, Transfection, Plasmid Preparation

    MTT based cellular cytotoxicity assay of the lipoplexes at different N/P ratios. Experiment was performed using optimized lipid: DOPE and pEGFP-C3 plasmid DNA against HeLa cells. The percentage viability values shown are the average of triplicate experiments performed on the same day. (A) Cytotoxicity of lipids at different concentrations varying from 0.6 to 3 µM. Same concentrations were used for transfection during the lipoplex preparation. (B) Cytotoxicity of lipoplexes at different N/P charge ratios, which were used during transfection.

    Journal: PLoS ONE

    Article Title: Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids

    doi: 10.1371/journal.pone.0068305

    Figure Lengend Snippet: MTT based cellular cytotoxicity assay of the lipoplexes at different N/P ratios. Experiment was performed using optimized lipid: DOPE and pEGFP-C3 plasmid DNA against HeLa cells. The percentage viability values shown are the average of triplicate experiments performed on the same day. (A) Cytotoxicity of lipids at different concentrations varying from 0.6 to 3 µM. Same concentrations were used for transfection during the lipoplex preparation. (B) Cytotoxicity of lipoplexes at different N/P charge ratios, which were used during transfection.

    Article Snippet: We have used plasmid pEGFP-C3 (Clontech USA) and plasmid PGL-3 for the gene transfection studies.

    Techniques: MTT Assay, Cytotoxicity Assay, Plasmid Preparation, Transfection

    Bovine serum albumin (BSA) induced gel retardation. Gel electrophoretic patterns for the lipoplex-associated pEGFP-C3 plasmid DNA in the gel retardation assay for cationic lipid formulations where complexes were further treated with BSA. Experiment was performed using 0.2 µg of DNA per well at the N/P ratio of 5.

    Journal: PLoS ONE

    Article Title: Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids

    doi: 10.1371/journal.pone.0068305

    Figure Lengend Snippet: Bovine serum albumin (BSA) induced gel retardation. Gel electrophoretic patterns for the lipoplex-associated pEGFP-C3 plasmid DNA in the gel retardation assay for cationic lipid formulations where complexes were further treated with BSA. Experiment was performed using 0.2 µg of DNA per well at the N/P ratio of 5.

    Article Snippet: We have used plasmid pEGFP-C3 (Clontech USA) and plasmid PGL-3 for the gene transfection studies.

    Techniques: Electrophoretic Mobility Shift Assay, Plasmid Preparation

    Gel electrophoresis to find out DNA binding and release efficiency. Electrophoretic gel patterns for the lipoplex-associated pEGFP-C3 plasmid DNA. (A) DNA binding efficiency of different gemini lipid based lipoplexes. The N/P ratios are indicated at the top of each lane. (B) SDS mediated DNA release from representative lipid based lipoplexes. The SDS/lipid ratios are indicated below each lane. Both experiments were performed using 0.2 µg of DNA per well.

    Journal: PLoS ONE

    Article Title: Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids

    doi: 10.1371/journal.pone.0068305

    Figure Lengend Snippet: Gel electrophoresis to find out DNA binding and release efficiency. Electrophoretic gel patterns for the lipoplex-associated pEGFP-C3 plasmid DNA. (A) DNA binding efficiency of different gemini lipid based lipoplexes. The N/P ratios are indicated at the top of each lane. (B) SDS mediated DNA release from representative lipid based lipoplexes. The SDS/lipid ratios are indicated below each lane. Both experiments were performed using 0.2 µg of DNA per well.

    Article Snippet: We have used plasmid pEGFP-C3 (Clontech USA) and plasmid PGL-3 for the gene transfection studies.

    Techniques: Nucleic Acid Electrophoresis, Binding Assay, Plasmid Preparation

    Western blotting analysis for nuclear p65. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core; SiRNA: transient transfection of core specific shRNAs in the HCV core transformant; ScRNA: transient transfection of

    Journal:

    Article Title: Down-regulation of PTEN by HCV core protein through activating nuclear factor-κB

    doi:

    Figure Lengend Snippet: Western blotting analysis for nuclear p65. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core; SiRNA: transient transfection of core specific shRNAs in the HCV core transformant; ScRNA: transient transfection of

    Article Snippet: The expression vector pEGFP-C3 (Clontech, Palo Alto, CA, USA), which contains both the green fluorescence protein (GFP) coding sequences and a neomycin resistance cassette (Neor), was used as a negative control. pEGFP-Core which expresses the full-length coding sequences of core region (amino acids 1-191) of the HCV 1b genotype were constructed by our group previously.

    Techniques: Western Blot, Transfection, Plasmid Preparation

    RT-PCR analysis showed a high HCV core mRNA expression in the HCV core stable transfectant. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core.

    Journal:

    Article Title: Down-regulation of PTEN by HCV core protein through activating nuclear factor-κB

    doi:

    Figure Lengend Snippet: RT-PCR analysis showed a high HCV core mRNA expression in the HCV core stable transfectant. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core.

    Article Snippet: The expression vector pEGFP-C3 (Clontech, Palo Alto, CA, USA), which contains both the green fluorescence protein (GFP) coding sequences and a neomycin resistance cassette (Neor), was used as a negative control. pEGFP-Core which expresses the full-length coding sequences of core region (amino acids 1-191) of the HCV 1b genotype were constructed by our group previously.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Transfection, Plasmid Preparation

    Western blotting analysis for HCV core and PTEN expression. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core; SiRNA: transient transfection of core specific shRNAs in the HCV core transformant; ScRNA: transient

    Journal:

    Article Title: Down-regulation of PTEN by HCV core protein through activating nuclear factor-κB

    doi:

    Figure Lengend Snippet: Western blotting analysis for HCV core and PTEN expression. Mock: cells transfected with empty vector pEGFP-C3; Core: cells transfected with HCV core; SiRNA: transient transfection of core specific shRNAs in the HCV core transformant; ScRNA: transient

    Article Snippet: The expression vector pEGFP-C3 (Clontech, Palo Alto, CA, USA), which contains both the green fluorescence protein (GFP) coding sequences and a neomycin resistance cassette (Neor), was used as a negative control. pEGFP-Core which expresses the full-length coding sequences of core region (amino acids 1-191) of the HCV 1b genotype were constructed by our group previously.

    Techniques: Western Blot, Expressing, Transfection, Plasmid Preparation

    hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p

    Journal: PLoS ONE

    Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation

    doi: 10.1371/journal.pone.0104908

    Figure Lengend Snippet: hZNF-134 over expression enhanced the transcriptional potential of LTR and increased viral titers. (A) Luciferase activity was measured in the presence or absence of Tat following transfection with pEGFP-C3 or ZNF-134-GFP-C3 vector into HEK293T cells along with the reporter construct, pLTR-luc. Luciferase activity was measured in terms of relative luminescence units (RLU) from HEK293T cell lysates after 48 hours and plotted as fold increase in the luciferase activity. Cells over-expressing hZNF-134-GFP showed increased luciferase activity when compared to GFP alone. (B) pNL4-3 was transfected in HEK293T cells with either GFP or hZNF-134-GFP. After 48 hours, the viral transcription was measured by qRT-PCR. The plot shows that viral transcripts increased in the presence of over-expressed hZNF-134. (C) HEK293T cells over-expressing either GFP or hZNF-134-GFP were transfected with pNL4-3 vector and after 48 hours scored for viral p24 by ELISA. Inset shows the Western blot confirming the over-expression of either GFP or hZNF-134-GFP in HEK293T cells. For loading control, expression of GAPDH was detected by Western blots in both the cases. Over-expression of hZNF-134 increased viral titers. All the transfection efficiencies were normalized to pRL-TK transfections. All experiments were done more than three times and error bars represents mean ± SD. Student's t -test was performed and *p

    Article Snippet: Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

    Techniques: Over Expression, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Construct, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot

    hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.

    Journal: PLoS ONE

    Article Title: Mycobacterial and HIV Infections Up-Regulated Human Zinc Finger Protein 134, a Novel Positive Regulator of HIV-1 LTR Activity and Viral Propagation

    doi: 10.1371/journal.pone.0104908

    Figure Lengend Snippet: hZNF-134-GFP is localized in the nucleus of HEK293T and Astrocytoma 1321N1 cells. HEK293T and 1321N1 cells were transfected with expression plasmids pEGFP-C3 or ZNF-134-GFP-C3. The cells were fixed after 48 hours and visualized under confocal microscopy. Panels show Trans, DAPI, GFP, and Merged images. hZNF-134-GFP protein was localized in the nucleus of HEK293T and 1321N1 cells whereas GFP control showed both nuclear and cytoplasmic localization. Localization was confirmed by 3 independent experiments.

    Article Snippet: Primer list is given in . pLTR-Luc (a gift from Dr. Debashish Mitra, NCCS, Pune, India); pNL4-3 : a full length replication and infection competent chimeric DNA (Gene Bank: AF324493) ; pcTat (a gift from Prof Anand K Kondapi), pRL-TK (Promega, USA) and pEGFP-C3 (Clonetech, USA) were used for the study.

    Techniques: Transfection, Expressing, Confocal Microscopy