Structured Review

TaKaRa pegfp c1
Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected <t>pEGFP-C1</t> (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pegfp c1/product/TaKaRa
Average 77 stars, based on 1 article reviews
Price from $9.99 to $1999.99
pegfp c1 - by Bioz Stars, 2019-10
77/100 stars

Related Products / Commonly Used Together

eeaaka linker

Images

1) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

2) Product Images from "SnoVectors for nuclear expression of RNA"

Article Title: SnoVectors for nuclear expression of RNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1050

snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.
Figure Legend Snippet: snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.

Techniques Used: Transfection, Agarose Gel Electrophoresis, Labeling, Isolation, Plasmid Preparation, Quantitative RT-PCR, Fractionation

mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.
Figure Legend Snippet: mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.

Techniques Used: Plasmid Preparation, Transfection, Staining

snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.
Figure Legend Snippet: snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.

Techniques Used: Transfection, Fluorescence, Agarose Gel Electrophoresis, Labeling, Marker, Isolation, Plasmid Preparation, In Situ, Expressing, Confocal Microscopy, Quantitative RT-PCR, Fractionation

3) Product Images from "Benzyl butyl phthalate induces migration, invasion, and angiogenesis of Huh7 hepatocellular carcinoma cells through nongenomic AhR/G-protein signaling"

Article Title: Benzyl butyl phthalate induces migration, invasion, and angiogenesis of Huh7 hepatocellular carcinoma cells through nongenomic AhR/G-protein signaling

Journal: BMC Cancer

doi: 10.1186/1471-2407-14-556

BBP activates AhR at the cell membrane, which interacts with G proteins. (A) Huh7 cells were transfected with pEGFP-C1-AhR or pEGFP-C1 as a plasmid control. Cells were stimulated by adding DMSO or BBP (1 μM) and then analyzed by real-time TIRF microscopy. Scale bars: 10 μm. The left panel shows Huh7 cells transfected with the pEGFP-C1 plasmid control treated with DMSO (upper) or BBP (lower). The middle panel shows Huh7 cells transfected with pEGFP-C1-AhR and then treated with DMSO (upper) or BBP (lower). The increased intensity of GFP fluorescence indicates AhR expression at the cell membrane, which was induced by BBP. The right panel shows the GFP intensity analyzed by Axio Vision Rel 4.8 software. (B) Huh7 cells were transfected with pEGFP-C1-AhR and then stimulated with BBP (1 μM) before analyzed by real-time confocal microscopy (upper panel), Scale bars: 10 μm. The GFP intensity was analyzed by FV10-ASW 2.1 software (Olympus) (lower panel). (C) Expression of Gα q/11 and G β proteins after BBP treatment for the indicated time was detected by immunoblotting. β-actin was used as an internal control. (D) Interaction of AhR with Gα q/11 at the cell membrane after treatment with BBP (1 μM) was imaged by double immunogold electron microscopy. Black arrows indicate Gα q/11 , and the white arrows indicate AhR. The localization of G protein and AhR protein are shown. (upper left panel) shows the untreatment group and (Lower left, Right left panel) indicated BBP treatment groups. Scale bars: 500 nm. CM, cell membrane; N, nucleus. (E) Huh7 cells after 30 minutes of treatment with BBP (1 μM) or DMSO as the control. The interaction of AhR with Gα q/11 and G β was detected by immunoprecipitation (IP) followed by immunoblot analysis. The IgG were used cell lysates mixed with control and BBP treatment group. Normal rabbit IgG were used as negative control. (F) Huh7 cells were transfected with two different AhR shRNAs as described the Methods or a control shRNA. After treatment with or without BBP (1 μM), AhR, Gα q/11 , and G β levels were measured by immunoblotting. β-actin was used as an internal control.
Figure Legend Snippet: BBP activates AhR at the cell membrane, which interacts with G proteins. (A) Huh7 cells were transfected with pEGFP-C1-AhR or pEGFP-C1 as a plasmid control. Cells were stimulated by adding DMSO or BBP (1 μM) and then analyzed by real-time TIRF microscopy. Scale bars: 10 μm. The left panel shows Huh7 cells transfected with the pEGFP-C1 plasmid control treated with DMSO (upper) or BBP (lower). The middle panel shows Huh7 cells transfected with pEGFP-C1-AhR and then treated with DMSO (upper) or BBP (lower). The increased intensity of GFP fluorescence indicates AhR expression at the cell membrane, which was induced by BBP. The right panel shows the GFP intensity analyzed by Axio Vision Rel 4.8 software. (B) Huh7 cells were transfected with pEGFP-C1-AhR and then stimulated with BBP (1 μM) before analyzed by real-time confocal microscopy (upper panel), Scale bars: 10 μm. The GFP intensity was analyzed by FV10-ASW 2.1 software (Olympus) (lower panel). (C) Expression of Gα q/11 and G β proteins after BBP treatment for the indicated time was detected by immunoblotting. β-actin was used as an internal control. (D) Interaction of AhR with Gα q/11 at the cell membrane after treatment with BBP (1 μM) was imaged by double immunogold electron microscopy. Black arrows indicate Gα q/11 , and the white arrows indicate AhR. The localization of G protein and AhR protein are shown. (upper left panel) shows the untreatment group and (Lower left, Right left panel) indicated BBP treatment groups. Scale bars: 500 nm. CM, cell membrane; N, nucleus. (E) Huh7 cells after 30 minutes of treatment with BBP (1 μM) or DMSO as the control. The interaction of AhR with Gα q/11 and G β was detected by immunoprecipitation (IP) followed by immunoblot analysis. The IgG were used cell lysates mixed with control and BBP treatment group. Normal rabbit IgG were used as negative control. (F) Huh7 cells were transfected with two different AhR shRNAs as described the Methods or a control shRNA. After treatment with or without BBP (1 μM), AhR, Gα q/11 , and G β levels were measured by immunoblotting. β-actin was used as an internal control.

Techniques Used: Transfection, Plasmid Preparation, Microscopy, Fluorescence, Expressing, Software, Confocal Microscopy, Electron Microscopy, Immunoprecipitation, Negative Control, shRNA

4) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

5) Product Images from "Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain"

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1006691

Cis -acting inhibition of antigen presentation of aLANA. (A) Peptidic coding sequence of aLANA. The acidic central repeat region is highlighted. Residues in red represent the region rich in glycin, glutamate, and proline, consequently termed GPE. Residues in blue represent the region rich in glutamate consequently named E. Residues in green represent the region rich in glycin and glutamate and consequently named GE. The GE-rich domain comprises the E-rich region. N- and C-terminal regions of aLANA are in black. (B) Schematic description of expression constructs. The expression plasmid peGFP-C1 (eGFP) was used to fuse a H-2K b -restricted ovalbumin CTL epitope, SIINFEKL, in-frame to a C-terminal enhanced Green Fluorescent Protein (eGFP-SIIN). The aLANA coding sequence was then inserted in-frame to the eGFP-SIIN plasmid leaving the SIINFEKL in the C-terminus end of aLANA (aLANA-SIIN) or in the N-terminus end of aLANA (SIIN-aLANA) to allow analysis of endogenous processing of aLANA. (C) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells. Cells were stained with APC-conjugated anti-mouse H-2K b -SIINFEKL complex (25-D1.16) 48h after transfection with the indicated constructs. Numbers in red boxes indicate percent of H-2K b -SIINFEKL-positive cells within eGFP + cells. (D) Percent of eGFP + cells expressing H-2K b -SIINFEKL complexes at the cell surface based on the analysis in C. (E) The SIINFEKL-specific T cell hybridoma B3Z was co-cultured overnight with 293Kb cells 48h after transfection with the different constructs. β -galactosidase activity was assayed by cell lysis in the presence of chlorophenol-red- β -D-galactoside (CPRG) and absorbance read at 595 nm. Values relative to eGFP negative construct are shown. (F) Confocal analysis of cell surface expression of H-2K b -SIINFEKL expression 48h after transfection of 293Kb cells with the different constructs. Scale bar = 5 μm. (G) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells 48h after co-transfection with the SIIN construct and plasmids expressing MuHV-4 K3 protein (mK3) that degrades MHC class I heavy chains, or a aLANA-V5 fusion protein [ 21 ]. (H) Percent of eGFP + cells expressing H-2K b -SIINFEKL complexes at the cell surface based on the analysis in G. Bars show mean ± S.D. (n = 3). Statistical analyses by one-way ANOVA and Dunnett’s post-test with SIIN as control comparison mean (***p≤0.001).
Figure Legend Snippet: Cis -acting inhibition of antigen presentation of aLANA. (A) Peptidic coding sequence of aLANA. The acidic central repeat region is highlighted. Residues in red represent the region rich in glycin, glutamate, and proline, consequently termed GPE. Residues in blue represent the region rich in glutamate consequently named E. Residues in green represent the region rich in glycin and glutamate and consequently named GE. The GE-rich domain comprises the E-rich region. N- and C-terminal regions of aLANA are in black. (B) Schematic description of expression constructs. The expression plasmid peGFP-C1 (eGFP) was used to fuse a H-2K b -restricted ovalbumin CTL epitope, SIINFEKL, in-frame to a C-terminal enhanced Green Fluorescent Protein (eGFP-SIIN). The aLANA coding sequence was then inserted in-frame to the eGFP-SIIN plasmid leaving the SIINFEKL in the C-terminus end of aLANA (aLANA-SIIN) or in the N-terminus end of aLANA (SIIN-aLANA) to allow analysis of endogenous processing of aLANA. (C) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells. Cells were stained with APC-conjugated anti-mouse H-2K b -SIINFEKL complex (25-D1.16) 48h after transfection with the indicated constructs. Numbers in red boxes indicate percent of H-2K b -SIINFEKL-positive cells within eGFP + cells. (D) Percent of eGFP + cells expressing H-2K b -SIINFEKL complexes at the cell surface based on the analysis in C. (E) The SIINFEKL-specific T cell hybridoma B3Z was co-cultured overnight with 293Kb cells 48h after transfection with the different constructs. β -galactosidase activity was assayed by cell lysis in the presence of chlorophenol-red- β -D-galactoside (CPRG) and absorbance read at 595 nm. Values relative to eGFP negative construct are shown. (F) Confocal analysis of cell surface expression of H-2K b -SIINFEKL expression 48h after transfection of 293Kb cells with the different constructs. Scale bar = 5 μm. (G) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells 48h after co-transfection with the SIIN construct and plasmids expressing MuHV-4 K3 protein (mK3) that degrades MHC class I heavy chains, or a aLANA-V5 fusion protein [ 21 ]. (H) Percent of eGFP + cells expressing H-2K b -SIINFEKL complexes at the cell surface based on the analysis in G. Bars show mean ± S.D. (n = 3). Statistical analyses by one-way ANOVA and Dunnett’s post-test with SIIN as control comparison mean (***p≤0.001).

Techniques Used: Inhibition, Sequencing, Expressing, Construct, Plasmid Preparation, CTL Assay, Flow Cytometry, Cytometry, Staining, Transfection, Cell Culture, Activity Assay, Lysis, Cotransfection

The GE-rich domain of aLANA is sufficient to regulate OVA-peptide presentation. (A) Schematic representation of peGFP-C1 expression constructs to generate the GE-SIIN and SIIN-GE-SIIN expression constructs. The GE-rich domain was inserted in-frame between the eGFP coding sequence and the SIINFEKL tag (GE-SIIN) followed by insertion of an additional SIINFEKL tag at the N-terminus end of the GE sequence. (B) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells 48h after transfection with the indicated constructs. Numbers in red boxes indicate percent of H-2K b -SIINFEKL-positive cells within eGFP + cells. (C) Percent of eGFP + cells expressing H2-K b -SIINFEKL complexes at the cell surface based on the analysis in B. Bars show mean ± S.D. (n = 3). Statistical analyses by one-way ANOVA and Dunnett’s post-test with SIIN as control comparison mean (*p≤0.05, ***p≤0.001).
Figure Legend Snippet: The GE-rich domain of aLANA is sufficient to regulate OVA-peptide presentation. (A) Schematic representation of peGFP-C1 expression constructs to generate the GE-SIIN and SIIN-GE-SIIN expression constructs. The GE-rich domain was inserted in-frame between the eGFP coding sequence and the SIINFEKL tag (GE-SIIN) followed by insertion of an additional SIINFEKL tag at the N-terminus end of the GE sequence. (B) Representative results from flow cytometry analysis of SIINFEKL presentation on 293Kb cells 48h after transfection with the indicated constructs. Numbers in red boxes indicate percent of H-2K b -SIINFEKL-positive cells within eGFP + cells. (C) Percent of eGFP + cells expressing H2-K b -SIINFEKL complexes at the cell surface based on the analysis in B. Bars show mean ± S.D. (n = 3). Statistical analyses by one-way ANOVA and Dunnett’s post-test with SIIN as control comparison mean (*p≤0.05, ***p≤0.001).

Techniques Used: Expressing, Construct, Sequencing, Flow Cytometry, Cytometry, Transfection

The GE-rich domain reduces protein synthesis efficiency of aLANA. (A) Immunoblot analysis of expression of aLANA-, ΔCR-, ΔGPE- and ΔGE-SIIN. 293Kb cells were transfected with the indicated plasmids and immunoblot performed at 48h after transfection. Duplicate blots were probed with either HRP-anti-GFP monoclonal antibody to detect aLANA constructs or anti-actin monoclonal antibody as loading control. Band intensities from the immunoblot were quantified by densitometry analysis using ImageJ64 software. Data are representative of three independent experiments with similar results. (B) Flow cytometry analysis of eGFP median fluorescence intensities (MFI) at the indicated time points after transfection. The left panel shows percent of eGFP + cells and the right panel shows deltaMFI (dMFI). dMFI were calcutated as [MFI of eGFP-positive population–MFI of eGFP-negative population]. (C) Halotag pulse-chase. Cells were transfected with aLANA- or ΔGE-HT2 constructs and pulsed 12h later with HaloTag TMR-Direct Ligand overnight, extensively washed and chased for 24h. At the indicated time points, cells were incubated with cell-permeable HaloTag Oregon Green (OG) Ligand for 15 min before analysis by flow cytometry for detection of de novo protein expression. (D) Uncoupled in vitro transcription/translation assay of aLANA, ΔCR-, ΔGPE- and ΔGE-SIIN. The T7 promoter was first subcloned into the different peGFP-C1 constructs downstream the CMV promoter. The constructs were then transcribed in vitro with T7 RNA polymerase. Equimolar amounts of the resulting capped RNAs were then subjected to in vitro translation using rabbit reticulocyte lysate supplemented with [ 35 S]-methionine. Intensities of the bands at the expected size obtained from immunoblotting in A were quantified by densitometry analysis using ImageJ64 software. Braces indicate radioactive signal from parasite bands. (E) Immunoblot analysis of SIIN, aLANA-SIIN, and GE-SIIN expression. 293Kb cells were transfected with the indicated plasmids and immunoblot performed at 24h after transfection. Duplicate blots were probed with either HRP-anti-GFP monoclonal antibody to detect aLANA constructs or anti-GAPDH monoclonal antibody as loading control. Band intensities from the immunoblot were quantified by densitometry analysis using ImageJ64 software. Data are representative of two independent experiments with similar results. Statistical analyses by two-way ANOVA and Sidak’s post-test (***p≤0.001).
Figure Legend Snippet: The GE-rich domain reduces protein synthesis efficiency of aLANA. (A) Immunoblot analysis of expression of aLANA-, ΔCR-, ΔGPE- and ΔGE-SIIN. 293Kb cells were transfected with the indicated plasmids and immunoblot performed at 48h after transfection. Duplicate blots were probed with either HRP-anti-GFP monoclonal antibody to detect aLANA constructs or anti-actin monoclonal antibody as loading control. Band intensities from the immunoblot were quantified by densitometry analysis using ImageJ64 software. Data are representative of three independent experiments with similar results. (B) Flow cytometry analysis of eGFP median fluorescence intensities (MFI) at the indicated time points after transfection. The left panel shows percent of eGFP + cells and the right panel shows deltaMFI (dMFI). dMFI were calcutated as [MFI of eGFP-positive population–MFI of eGFP-negative population]. (C) Halotag pulse-chase. Cells were transfected with aLANA- or ΔGE-HT2 constructs and pulsed 12h later with HaloTag TMR-Direct Ligand overnight, extensively washed and chased for 24h. At the indicated time points, cells were incubated with cell-permeable HaloTag Oregon Green (OG) Ligand for 15 min before analysis by flow cytometry for detection of de novo protein expression. (D) Uncoupled in vitro transcription/translation assay of aLANA, ΔCR-, ΔGPE- and ΔGE-SIIN. The T7 promoter was first subcloned into the different peGFP-C1 constructs downstream the CMV promoter. The constructs were then transcribed in vitro with T7 RNA polymerase. Equimolar amounts of the resulting capped RNAs were then subjected to in vitro translation using rabbit reticulocyte lysate supplemented with [ 35 S]-methionine. Intensities of the bands at the expected size obtained from immunoblotting in A were quantified by densitometry analysis using ImageJ64 software. Braces indicate radioactive signal from parasite bands. (E) Immunoblot analysis of SIIN, aLANA-SIIN, and GE-SIIN expression. 293Kb cells were transfected with the indicated plasmids and immunoblot performed at 24h after transfection. Duplicate blots were probed with either HRP-anti-GFP monoclonal antibody to detect aLANA constructs or anti-GAPDH monoclonal antibody as loading control. Band intensities from the immunoblot were quantified by densitometry analysis using ImageJ64 software. Data are representative of two independent experiments with similar results. Statistical analyses by two-way ANOVA and Sidak’s post-test (***p≤0.001).

Techniques Used: Expressing, Transfection, Construct, Software, Flow Cytometry, Cytometry, Fluorescence, Pulse Chase, Incubation, In Vitro

6) Product Images from "SnoVectors for nuclear expression of RNA"

Article Title: SnoVectors for nuclear expression of RNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1050

snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.
Figure Legend Snippet: snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.

Techniques Used: Transfection, Agarose Gel Electrophoresis, Labeling, Isolation, Plasmid Preparation, Quantitative RT-PCR, Fractionation

mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.
Figure Legend Snippet: mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.

Techniques Used: Plasmid Preparation, Transfection, Staining

snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.
Figure Legend Snippet: snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.

Techniques Used: Transfection, Fluorescence, Agarose Gel Electrophoresis, Labeling, Marker, Isolation, Plasmid Preparation, In Situ, Expressing, Confocal Microscopy, Quantitative RT-PCR, Fractionation

7) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

8) Product Images from "SnoVectors for nuclear expression of RNA"

Article Title: SnoVectors for nuclear expression of RNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1050

snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.
Figure Legend Snippet: snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.

Techniques Used: Transfection, Agarose Gel Electrophoresis, Labeling, Isolation, Plasmid Preparation, Quantitative RT-PCR, Fractionation

mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.
Figure Legend Snippet: mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.

Techniques Used: Plasmid Preparation, Transfection, Staining

snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.
Figure Legend Snippet: snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.

Techniques Used: Transfection, Fluorescence, Agarose Gel Electrophoresis, Labeling, Marker, Isolation, Plasmid Preparation, In Situ, Expressing, Confocal Microscopy, Quantitative RT-PCR, Fractionation

9) Product Images from "Role of TAF4 in Transcriptional Activation by Rta of Epstein-Barr Virus"

Article Title: Role of TAF4 in Transcriptional Activation by Rta of Epstein-Barr Virus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0054075

Mapping the interaction domains in TAF4 and Rta. (A) Plasmids that expressed deleted GFP-TAF4 were used to delineate the region in TAF4 that interacts with Rta. Numbers represent the positions of amino acids in TAF4. Q denotes the glutamine-rich regions. (B) 293T cells were cotransfected with pCMV-R and plasmids that expressed GFP fusion proteins including pEGFP-TAF4 (lanes 2, 7), pEGFP-TAF4-NM (lanes 3, 8), pEGFP-TAF4-C (lanes 4 and 9) or pEGFP-C1 (lanes 1, 6). Input lanes were loaded with 5% of the lysate (lanes 1–5). Proteins in the lysates were coimmunoprecipitated (IP) with anti-GFP antibody and analyzed by immunoblotting (IB) using anti-Rta antibody (lanes 6–9). (C) Deletion mutants of Rta were used to identify the region in Rta that interacts with TAF4. Numbers represent the positions of amino acids in Rta (D). Plasmids that expressed GFP-Rta (lanes 2, 7), GFP-N190 (lanes 3, 8), GFP-N191-415 (lanes 4, 9), GFP-Rev (lanes 5, 10) or GFP (lanes 1, 6) were transfected into 293T cells. The input lanes were loaded with 5% of the cell lysates and GFP-fusion proteins were detected using anti-GFP antibody (lanes 1–5). Proteins in the lysates were coimmunoprecipitated with anti-TAF4 antibody and analyzed by immunoblotting using anti-GFP antibody (lanes 6–10).
Figure Legend Snippet: Mapping the interaction domains in TAF4 and Rta. (A) Plasmids that expressed deleted GFP-TAF4 were used to delineate the region in TAF4 that interacts with Rta. Numbers represent the positions of amino acids in TAF4. Q denotes the glutamine-rich regions. (B) 293T cells were cotransfected with pCMV-R and plasmids that expressed GFP fusion proteins including pEGFP-TAF4 (lanes 2, 7), pEGFP-TAF4-NM (lanes 3, 8), pEGFP-TAF4-C (lanes 4 and 9) or pEGFP-C1 (lanes 1, 6). Input lanes were loaded with 5% of the lysate (lanes 1–5). Proteins in the lysates were coimmunoprecipitated (IP) with anti-GFP antibody and analyzed by immunoblotting (IB) using anti-Rta antibody (lanes 6–9). (C) Deletion mutants of Rta were used to identify the region in Rta that interacts with TAF4. Numbers represent the positions of amino acids in Rta (D). Plasmids that expressed GFP-Rta (lanes 2, 7), GFP-N190 (lanes 3, 8), GFP-N191-415 (lanes 4, 9), GFP-Rev (lanes 5, 10) or GFP (lanes 1, 6) were transfected into 293T cells. The input lanes were loaded with 5% of the cell lysates and GFP-fusion proteins were detected using anti-GFP antibody (lanes 1–5). Proteins in the lysates were coimmunoprecipitated with anti-TAF4 antibody and analyzed by immunoblotting using anti-GFP antibody (lanes 6–10).

Techniques Used: Transfection

Indirect immunofluorescence analysis. P3HR1 cells were transfected with pEGFP-C1 (A–D) or pEGFP-TAF4 (E–H) and then treated with sodium butyrate for 24 hr. Cells were incubated with monoclonal anti-Rta antibody and observed under a confocal laser-scanning microscope. DAPI staining revealed the positions of nuclei (A and E). D and H are merged images.
Figure Legend Snippet: Indirect immunofluorescence analysis. P3HR1 cells were transfected with pEGFP-C1 (A–D) or pEGFP-TAF4 (E–H) and then treated with sodium butyrate for 24 hr. Cells were incubated with monoclonal anti-Rta antibody and observed under a confocal laser-scanning microscope. DAPI staining revealed the positions of nuclei (A and E). D and H are merged images.

Techniques Used: Immunofluorescence, Transfection, Incubation, Laser-Scanning Microscopy, Staining

10) Product Images from "SnoVectors for nuclear expression of RNA"

Article Title: SnoVectors for nuclear expression of RNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1050

snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.
Figure Legend Snippet: snoVectors can lead to the nuclear retention of different types of RNA sequences. ( A ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pZW1-snoVector are retained in the nucleus. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled antisense SNORD116-13 and their predicted sizes are labeled at the bottom of each NB. tRNA lys was used as markers for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. ( B ) Different types of RNAs, including intron sequences, a lncRNA and mRNAs, expressed from pEGFP-C1 are found in both the nucleus and in the cytoplasm. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from HeLa cells transfected with the indicated plasmids individually and then resolved on an agarose gel. Transcripts of different types of expressed RNAs (indicated by white arrows) were probed with Dig-labeled egfp and their predicted sizes were labeled in the bottom of each NB. See (A) for details. ( C) Different types of RNAs expressed from pZW1-snoVector are retained in the nucleus, while those expressed from pEGFP-C1 are found in both the nucleus and the cytoplasm. ( D ) Different types of RNAs expressed from pcDNA3.0 vector are found in both the nucleus and the cytoplasm. In (A) and (B), white arrows indicate the expected RNAs expressed from different vectors. Assays were repeated and the same results were obtained. In (C) and (D), nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. Also see supplemental information Figures S5–S6.

Techniques Used: Transfection, Agarose Gel Electrophoresis, Labeling, Isolation, Plasmid Preparation, Quantitative RT-PCR, Fractionation

mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.
Figure Legend Snippet: mNEAT1 and its fragments expressed from snoVectors largely retain their endogenous characteristics in the nucleus. ( A ) The subcellular localization of mNEAT1 RNA from a pZW1-snoVector or a pEGFP-C1 vector. Left, HeLa cells were co-transfected with Flag-p54 nrb and pZW1-snoVector- mNEAT1 -FL or Flag-p54 nrb and pEGFP-C1- mNEAT1 -FL, followed by co-staining of Flag-p54 nrb (red) and mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns of mNEAT1 expressed from these two vectors are shown (a-e). All nuclei were counterstained with DAPI. Scale bars 5 μm in all panels. Right, Quantitative analysis of each observed subcellular localization pattern of snoRNA-ended mNEAT1 or egfp - mNEAT1 counted from randomly selected microscopic fields. Note that the majority of expressed snoRNA-ended mNEAT1 RNA co-localizes with Flag-p54 nrb . ( B-E ) The subcellular localization of the expressed fragments of mNEAT1 RNA from either pZW1-snoVectors or pEGFP-C1 vectors. Representative images of all observed subcellular localization patterns (cytoplasmic localization; co-localization with p54 nrb in the nucleus; nonco-localization with p54 nrb in the nucleus) of expressed mNEAT1 fragments from these two vectors are shown. See (A) for details. Note that fragments of mNEAT1 expressed from snoVectors are predominately retained in the nucleus and co-localize with Flag-p54 nrb . ( F ) The majority of the snoVector expressed mNEAT1 RNAs do not localize to Cajal bodies or nucleoli. Left, HeLa cells were transfected with pZW1-snoVector- mNEAT1 -FL, followed by co-staining of Coilin (red) or Nucleolin (red) with mNEAT1 RNA (green). Representative images of all observed subcellular localization patterns (partial co-localization or nonco-localization) of snoRNA-ended mNEAT1 with Colin or Nucleolin are shown (a-d). Right, Quantitative analysis of each observed subcellular co-localization pattern of snoRNA-ended mNEAT1 with Colin or Nucleolin counted from randomly selected microscopic fields. In all panels, assays were repeated and the same results were obtained. Also see supplemental information Figures S3 and S4.

Techniques Used: Plasmid Preparation, Transfection, Staining

snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.
Figure Legend Snippet: snoVectors express RNAs in the nucleus. ( A ) A schematic drawing to show full-length (FL) mNEAT1 RNA and different fragments of it ( 9 ) inserted into either the sno-lncRNA region in pZW1-snoVector (top) or into the UTR region of pEGFP-C1, which was engineered with a stop codon immediately downstream of the EGFP ORF (Bottom). ( B ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus. Top, HeLa cells were transfected with indicated plasmids individually and fluorescence pictures were taken 36 h after transfection. Bottom, total RNAs and fractionated nuclear and cytoplasmic RNAs were collected from the same batch of transfected HeLa cells as shown above, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with a Dig-labeled antisense SNORD116-13; tRNA lys was used as marker for nuclear/cytoplasmic RNA isolation. Equal amounts of total, cytoplasmic and nuclear RNAs were loaded onto an agarose gel and rRNAs were used as the loading control. T, total RNAs; C, cytoplasmic RNAs; N, nuclear RNAs. ( C ) mNEAT1 RNA and different fragments of it expressed from pEGFP-C1 are at least partially exported to the cytoplasm. Top, HeLa cells were transfected individually with the indicated plasmids. Total RNAs and fractionated nuclear and cytoplasmic RNAs were collected 36 h after transfection, and then resolved on an agarose gel. Transcripts of mNEAT1 RNA and different fragments of it were probed with Dig-labeled egfp . See (B) for details. ( D ) RNAs expressed from pZW1-snoVector are absolutely retained in the nucleus, while those from pEGFP-C1 are not. Top, HeLa cells were transfected with each indicated plasmid in a pZW1-snoVector for 36 h. RNA in situ hybridizations were performed with Dig-labeled probes for mNEAT1 RNA and different fragments of it. Bottom, HeLa cells were transfected with each indicated plasmid in a pEGFP-C1 vector for 36 h. RNA in situ hybridizations were performed with Dig-labeled egfp . Representative images are shown for each transfection. White arrow heads represent the cytoplasmic signals of egfp - mNEAT1 -FL in cytoplasm in transfected HeLa cells. All nuclei were counterstained with DAPI. Scale bars 10 μm. ( E ) Subcellular distribution of transfected RNAs from different expression vectors. Quantitative analysis of the data from experiments shown in (D) is presented. More than 200 transfected cells were recorded randomly by confocal microscopy following each different transfection, and the percentage of each distinct nuclear/cytoplasmic localization pattern of RNAs transcribed from pZW1-snoVector or pEGFP-C1 was recorded. Note that mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are retained in the nucleus, while those from pEGFP-C1 are not. ( F ) mNEAT1 RNA and different fragments of it expressed from pZW1-snoVector are predominately retained in the nucleus. Nuclear and cytoplasmic RNAs extracted from equal numbers of transfected HeLa cells under each indicated condition were assayed by RT-qPCR. The cytoplasmic distributed gapdh and the nuclear retained endogenous hNEAT1 were used as markers to indicate a qualified cytoplasmic and nuclear fractionation under each transfection condition. Error bars were calculated from three replicates. In (B), (C) and (D), assays were repeated and the same results were obtained. Also see supplemental information Figure S2.

Techniques Used: Transfection, Fluorescence, Agarose Gel Electrophoresis, Labeling, Marker, Isolation, Plasmid Preparation, In Situ, Expressing, Confocal Microscopy, Quantitative RT-PCR, Fractionation

11) Product Images from "Differential localization of HPV16 E6 splice products with E6-associated protein"

Article Title: Differential localization of HPV16 E6 splice products with E6-associated protein

Journal: Virology Journal

doi: 10.1186/1743-422X-2-50

Cellular localization of HPV16 E6s in 293T (A) and HaCaT (B) . Cells were transiently transfected with plasmids expressing GFP, GFP-E6, GFP-E6*I and GFP-E6MT. Cells were grown and fixed with 4% paraformaldehyde in PBS on the coverslips at 48 h after transfection. The fluorescent images, phase contrast images and merge fluorescent-phase contrast images are shown. V indicates the pEGFP-C1 vector transfected cells. The scale bar represents 20 μm.
Figure Legend Snippet: Cellular localization of HPV16 E6s in 293T (A) and HaCaT (B) . Cells were transiently transfected with plasmids expressing GFP, GFP-E6, GFP-E6*I and GFP-E6MT. Cells were grown and fixed with 4% paraformaldehyde in PBS on the coverslips at 48 h after transfection. The fluorescent images, phase contrast images and merge fluorescent-phase contrast images are shown. V indicates the pEGFP-C1 vector transfected cells. The scale bar represents 20 μm.

Techniques Used: Transfection, Expressing, Plasmid Preparation

Co-localization of E6s and E6AP in 293T (A) and HaCaT (B) . Transiently transfected cells were analyzed for E6 or E6 variants fused to GFP, E6AP (Alexa 568 dye) and nuclear DNA (DAPI) by confocal microscopy. Slides were analyzed by microscopy with 3 lasers excitation lines. The images from the individual channels (DAPI, GFP, Alexa 568) as well as the merged image are shown. P and V represent non-transfected cells and pEGFP-C1 vector transfected cells, respectively. The scale bar represents 20 μm.
Figure Legend Snippet: Co-localization of E6s and E6AP in 293T (A) and HaCaT (B) . Transiently transfected cells were analyzed for E6 or E6 variants fused to GFP, E6AP (Alexa 568 dye) and nuclear DNA (DAPI) by confocal microscopy. Slides were analyzed by microscopy with 3 lasers excitation lines. The images from the individual channels (DAPI, GFP, Alexa 568) as well as the merged image are shown. P and V represent non-transfected cells and pEGFP-C1 vector transfected cells, respectively. The scale bar represents 20 μm.

Techniques Used: Transfection, Confocal Microscopy, Microscopy, Plasmid Preparation

12) Product Images from "Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice"

Article Title: Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice

Journal: BMC Infectious Diseases

doi: 10.1186/s12879-017-2507-5

Identification of TgSOD expression in vitro by fluorescence microscopic detection and Western blotting. Fluorescence microscopy images of TgSOD protein in ( a ) HEK 293 T cells that were transfected with pEGFP-SOD and ( b ) empty plasmid pEGFP-C1, and ( c ) non-transfected HEK 293 T cells; ( d ) Western blotting of pEGFP-SOD expressed in HEK 293 T cells (lane 1) probed with anti-STAg mouse sera as primary antibody and the protein of SOD is 23 KDa, whereas no band in the negative control cells with the empty plasmid pEGFP-C1 (lane 2) and GAPDH serves as a loading control
Figure Legend Snippet: Identification of TgSOD expression in vitro by fluorescence microscopic detection and Western blotting. Fluorescence microscopy images of TgSOD protein in ( a ) HEK 293 T cells that were transfected with pEGFP-SOD and ( b ) empty plasmid pEGFP-C1, and ( c ) non-transfected HEK 293 T cells; ( d ) Western blotting of pEGFP-SOD expressed in HEK 293 T cells (lane 1) probed with anti-STAg mouse sera as primary antibody and the protein of SOD is 23 KDa, whereas no band in the negative control cells with the empty plasmid pEGFP-C1 (lane 2) and GAPDH serves as a loading control

Techniques Used: Expressing, In Vitro, Fluorescence, Western Blot, Microscopy, Transfection, Plasmid Preparation, Negative Control

Toxoplasma -specific antibody levels in the sera of immunized BALB/c mice. The total IgG antibodies ( a ) in the collected serum samples of BALB/c mice immunized with pEGFP-SOD, pEGFP-C1, PBS and blank control on weeks 0, 2, 4, 8 were analyzed by ELISA. The levels of IgG1 and IgG2a ( b ) subtypes in the sera 28 days after the last immunization were determined by ELISA. The results are expressed as the means ± SD from three independent experiments . p
Figure Legend Snippet: Toxoplasma -specific antibody levels in the sera of immunized BALB/c mice. The total IgG antibodies ( a ) in the collected serum samples of BALB/c mice immunized with pEGFP-SOD, pEGFP-C1, PBS and blank control on weeks 0, 2, 4, 8 were analyzed by ELISA. The levels of IgG1 and IgG2a ( b ) subtypes in the sera 28 days after the last immunization were determined by ELISA. The results are expressed as the means ± SD from three independent experiments . p

Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay

13) Product Images from "Aquareovirus NS80 Recruits Viral Proteins to Its Inclusions, and Its C-Terminal Domain Is the Primary Driving Force for Viral Inclusion Formation"

Article Title: Aquareovirus NS80 Recruits Viral Proteins to Its Inclusions, and Its C-Terminal Domain Is the Primary Driving Force for Viral Inclusion Formation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0055334

Colocalization, Western Blot and co-IP of NS80 and NS38 in transfected cells. A . IF microscopy of single transfection with pCI-neo-NS38 (up row) and cotransfection with pCI-neo-NS80 and pCI-neo-NS38 at 6 h, 12 h, 18 h p.t. The subcellular localization of NS80 was visualized by immunostaining with rabbit anti-NS80 serum followed by FITC-conjugated goat anti-rabbit IgG (green), NS38 was detected by immunostaining with mouse anti-NS38 polyclonal antibody followed by Texas Red-conjugated goat anti-mouse IgG (red). Nuclei were counterstained with DAPI (blue). B . IF microscopy of Vero cells cotransfected with pEGFP-C1-NS80 and pCI-neo-NS38 (top row) or pEGFP-C1-NS38 and pCI-neo-NS80 (bottom row). Cells were immunostained with corresponding antibodies. C . IB analysis of NS80 or NS38 in Vero cells. Cells were singly transfected or cotransfected with plasmids pCI-neo-NS80 and pCI-neo-NS38. Transfected cells were collected at 20 h p.t., lysed and analyzed by immunoblotting. D . Co-IP assay of NS80 and NS38 in transfected Vero cells. The transfected cells were harvested at 20 h p.t., lysed and immunoprecipitated with NS38-specific rabbit antiserum (upper panel) or NS80-specific mouse antiserum (lower panel), immunoprecipitated proteins were analyzed using IB analysis as indicated in Fig. 4C .
Figure Legend Snippet: Colocalization, Western Blot and co-IP of NS80 and NS38 in transfected cells. A . IF microscopy of single transfection with pCI-neo-NS38 (up row) and cotransfection with pCI-neo-NS80 and pCI-neo-NS38 at 6 h, 12 h, 18 h p.t. The subcellular localization of NS80 was visualized by immunostaining with rabbit anti-NS80 serum followed by FITC-conjugated goat anti-rabbit IgG (green), NS38 was detected by immunostaining with mouse anti-NS38 polyclonal antibody followed by Texas Red-conjugated goat anti-mouse IgG (red). Nuclei were counterstained with DAPI (blue). B . IF microscopy of Vero cells cotransfected with pEGFP-C1-NS80 and pCI-neo-NS38 (top row) or pEGFP-C1-NS38 and pCI-neo-NS80 (bottom row). Cells were immunostained with corresponding antibodies. C . IB analysis of NS80 or NS38 in Vero cells. Cells were singly transfected or cotransfected with plasmids pCI-neo-NS80 and pCI-neo-NS38. Transfected cells were collected at 20 h p.t., lysed and analyzed by immunoblotting. D . Co-IP assay of NS80 and NS38 in transfected Vero cells. The transfected cells were harvested at 20 h p.t., lysed and immunoprecipitated with NS38-specific rabbit antiserum (upper panel) or NS80-specific mouse antiserum (lower panel), immunoprecipitated proteins were analyzed using IB analysis as indicated in Fig. 4C .

Techniques Used: Western Blot, Co-Immunoprecipitation Assay, Transfection, Microscopy, Cotransfection, Immunostaining, Immunoprecipitation

Colocalization of NS80 and GFP-VP4 in inclusion structures. A . Fluorescence microscope or IF analysis of Vero cells transfected with plasmid pEGFP-C1-VP4 (row1) or cotransfected with pEGFP-C1 and pCI-neo-NS80 (row2). B . IF analysis of Vero cells cotransfected with pEGFP-C1-VP4 and pCI-neo-NS80 (row 1) or pEGFP-C1-VP4 and pCI-neo-NS38 (row 2). Transfected cells were immunostained with corresponding antibodies. Nuclei were stained blue with DAPI.
Figure Legend Snippet: Colocalization of NS80 and GFP-VP4 in inclusion structures. A . Fluorescence microscope or IF analysis of Vero cells transfected with plasmid pEGFP-C1-VP4 (row1) or cotransfected with pEGFP-C1 and pCI-neo-NS80 (row2). B . IF analysis of Vero cells cotransfected with pEGFP-C1-VP4 and pCI-neo-NS80 (row 1) or pEGFP-C1-VP4 and pCI-neo-NS38 (row 2). Transfected cells were immunostained with corresponding antibodies. Nuclei were stained blue with DAPI.

Techniques Used: Fluorescence, Microscopy, Transfection, Plasmid Preparation, Staining

14) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

15) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

16) Product Images from "SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line"

Article Title: SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

Journal: PLoS ONE

doi: 10.1371/journal.pone.0184686

The effect of SOX14wt overexpression on p53 transcription and stability in HeLa cells. A -The TP53 promoter sequence (fragment −344 to +12 relative to the first transcription initiation site) with labeled consensus binding sites for SOX14 (white) and p53 (black); core sequences are underlined. B - Luciferase assay and schematic representation for TP53 luciferase promoter constructs. Position of SOX14 (white) and p53 (black) binding sites are indicated. Each of the represented TP53 promoter constructs was transfected in combination with either empty vector (mock), SOX14wt, SOX14DN1 or p53 expression vector. Normalized luciferase activities were calculated in relation to the adequate TP53 luciferase promoter vector activity in cells co-transfected with empty vector, which was set as 100%. Data are presented as the means ± SEM of at least three independent experiments. Mean values of relative luciferase activities were compared with Student’s t-test. P-values are *p≤ 0.05, **p≤0.01 and ***p≤0.001. C- qRT-PCR analysis of TP53 gene expression upon transient transfection with empty vector (mock) and vectors expressing SOX14wt or truncated SOX14 protein (SOX14DN1), as indicated. GAPDH was used as the loading control. The effect of SOX14 overexpression on TP53 gene level is presented in the graph. TP53 gene expression in transfected cells is calculated as a percentage of the amount in mock transfected cells, which was set as 100%. Data are presented as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test. D - Western blot analysis of p53 expression in HeLa cells transfected with either empty vector (mock) or the SOX14wt expression construct after 24 h, 48 h and 78 h. α- Tubulin was used the loading control. The effect of SOX14 overexpression on p53 protein level is shown in the graph. Quantities of p53 protein in transfected cells were calculated as a percentage of that in mock transfected cells, which was set as 100%. Data are shown as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test and P-values calculated, *p ≤ 0.05, **p ≤ 0.01. E - Western blot analysis of phospho-p53 (p-p53) expression in HeLa cells transfected with either empty vector (mock), SOX14wt or SOX14DN1. α-Tubulin was used as the loading control. The graph shows quantification of the effect of SOX14 overexpression on phospho-p53 protein level in transfected cells calculated as a percentage of the phospho-p53 in mock transfected cells, which was set as 100%. Data are presented as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test and P-values calculated, **p ≤ 0.01. F -The effect of SOX14 overexpression on phospho-p53 protein level detected immunocytochemically. Cells were co-transfected with pEGFP-C1 and empty vector (mock), SOX14wt or SOX14DN1. Cell nuclei were counterstained with DAPI. Arrows indicate phospho-p53 immunoreactivity in transfected cells. Scale bar: 20 μm.
Figure Legend Snippet: The effect of SOX14wt overexpression on p53 transcription and stability in HeLa cells. A -The TP53 promoter sequence (fragment −344 to +12 relative to the first transcription initiation site) with labeled consensus binding sites for SOX14 (white) and p53 (black); core sequences are underlined. B - Luciferase assay and schematic representation for TP53 luciferase promoter constructs. Position of SOX14 (white) and p53 (black) binding sites are indicated. Each of the represented TP53 promoter constructs was transfected in combination with either empty vector (mock), SOX14wt, SOX14DN1 or p53 expression vector. Normalized luciferase activities were calculated in relation to the adequate TP53 luciferase promoter vector activity in cells co-transfected with empty vector, which was set as 100%. Data are presented as the means ± SEM of at least three independent experiments. Mean values of relative luciferase activities were compared with Student’s t-test. P-values are *p≤ 0.05, **p≤0.01 and ***p≤0.001. C- qRT-PCR analysis of TP53 gene expression upon transient transfection with empty vector (mock) and vectors expressing SOX14wt or truncated SOX14 protein (SOX14DN1), as indicated. GAPDH was used as the loading control. The effect of SOX14 overexpression on TP53 gene level is presented in the graph. TP53 gene expression in transfected cells is calculated as a percentage of the amount in mock transfected cells, which was set as 100%. Data are presented as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test. D - Western blot analysis of p53 expression in HeLa cells transfected with either empty vector (mock) or the SOX14wt expression construct after 24 h, 48 h and 78 h. α- Tubulin was used the loading control. The effect of SOX14 overexpression on p53 protein level is shown in the graph. Quantities of p53 protein in transfected cells were calculated as a percentage of that in mock transfected cells, which was set as 100%. Data are shown as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test and P-values calculated, *p ≤ 0.05, **p ≤ 0.01. E - Western blot analysis of phospho-p53 (p-p53) expression in HeLa cells transfected with either empty vector (mock), SOX14wt or SOX14DN1. α-Tubulin was used as the loading control. The graph shows quantification of the effect of SOX14 overexpression on phospho-p53 protein level in transfected cells calculated as a percentage of the phospho-p53 in mock transfected cells, which was set as 100%. Data are presented as the means ± SEM of three independent transfection experiments. Mean values were compared with Student's t-test and P-values calculated, **p ≤ 0.01. F -The effect of SOX14 overexpression on phospho-p53 protein level detected immunocytochemically. Cells were co-transfected with pEGFP-C1 and empty vector (mock), SOX14wt or SOX14DN1. Cell nuclei were counterstained with DAPI. Arrows indicate phospho-p53 immunoreactivity in transfected cells. Scale bar: 20 μm.

Techniques Used: Over Expression, Sequencing, Labeling, Binding Assay, Luciferase, Construct, Transfection, Plasmid Preparation, Expressing, Activity Assay, Quantitative RT-PCR, Western Blot

17) Product Images from "G protein ? interacts with the glucocorticoid receptor and suppresses its transcriptional activity in the nucleus"

Article Title: G protein ? interacts with the glucocorticoid receptor and suppresses its transcriptional activity in the nucleus

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200409150

Forced cytoplasmic localization of Gβ2 attenuates the suppressive effect of the wild-type Gβ on GR-induced transactivation, whereas forced nuclear localization enhances it. (A and B) EGFP-fused NES-Gβ2 and NLS-Gβ2 are exclusively localized in the cytoplasm and the nucleus, respectively, in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-NES-Gβ2- or pEGFP-C1-NLS-Gβ2-expressing plasmid. The cells were fixed and their confocal images were obtained. Representative images are shown in A, whereas mean ± SEM values of signal intensities in the nucleus (black bars) and the cytoplasm (white bars) obtained from over 20 cells are shown in B. (C) NES-Gβ2 loses the suppressive effect on GR transactivation, whereas NLS-Gβ2 has a stronger inhibitory effect than the wild-type Gβ2 on GR transactivation in HCT116 cells. HCT116 cells were transfected with pCDNA4His/MaxB-NES-Gβ2- or -NLS-Gβ2 together with pRShGRα, pMMTV-Luc, and pSV40-β-Gal. Bars represent mean ± SEM values of the luciferase activity normalized for β-galactosidase activity in the absence or presence of 10 −6 M of dexamethasone. (*), P
Figure Legend Snippet: Forced cytoplasmic localization of Gβ2 attenuates the suppressive effect of the wild-type Gβ on GR-induced transactivation, whereas forced nuclear localization enhances it. (A and B) EGFP-fused NES-Gβ2 and NLS-Gβ2 are exclusively localized in the cytoplasm and the nucleus, respectively, in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-NES-Gβ2- or pEGFP-C1-NLS-Gβ2-expressing plasmid. The cells were fixed and their confocal images were obtained. Representative images are shown in A, whereas mean ± SEM values of signal intensities in the nucleus (black bars) and the cytoplasm (white bars) obtained from over 20 cells are shown in B. (C) NES-Gβ2 loses the suppressive effect on GR transactivation, whereas NLS-Gβ2 has a stronger inhibitory effect than the wild-type Gβ2 on GR transactivation in HCT116 cells. HCT116 cells were transfected with pCDNA4His/MaxB-NES-Gβ2- or -NLS-Gβ2 together with pRShGRα, pMMTV-Luc, and pSV40-β-Gal. Bars represent mean ± SEM values of the luciferase activity normalized for β-galactosidase activity in the absence or presence of 10 −6 M of dexamethasone. (*), P

Techniques Used: Transfection, Expressing, Plasmid Preparation, Luciferase, Activity Assay

Subcellular localization of Gβ2 and Gγ2 in HCT116 cells. (A) Endogenous Gβ and Gγ are visualized in the nucleus as well as in the cytoplasm/plasma membrane in HCT116 cells. Endogenous Gβ (left, top two panels) and Gγ (right, top two panels) were visualized by treatment with anti-Gβ or -Gγ2 antibodies, and FITC-labeled secondary antibody, and their confocal images were obtained. Nuclei were also stained with DAPI. Co-treatment of the samples with blocking peptides for anti-Gβ (left, bottom) or anti-Gγ2 (right, bottom) antibodies abolished their specific staining. Cells, expressing Gβ or Gγ exclusively in the cytoplasm, are indicated as “ℵ” and “a”, respectively, whereas cells retaining these molecules weakly or strongly in the nucleus are indicated as “ℑ” and “b”, and “ℜ” and “c”, respectively. (B) Endogenous Gβ and Gγ are detected in the nuclear fraction as well as in the cytoplasm and membrane fractions in HCT116 cells. HCT116 cells were lysed and their subcellular fractions were separated by centrifugation. 0.1 μg of protein of indicated subcellular fractions was run on SDS-PAGE gels, blotted to the nitrocellulose membranes, and Gβ and Gγ were visualized with their specific antibodies by reprobing the same membrane. Intracellular adhesion molecule 1 (ICAM1), α-tubulin, and Oct1, detected also by reprobing the same membrane with their specific antibodies, were respectively shown as positive controls for the membrane, cytoplasmic and nuclear fractions to indicate that the subcellular fractionation did not produce cross-contamination. (C and D) EGFP-Gβ2 was localized in the nucleus in addition to the cytoplasm, whereas EGFP-Gγ2 was detected in the nucleus and the cytoplasm, and at the plasma membrane in HCT116 cells. HCT116 cells were transfected with pEGFP-C-1-Gβ2 or -Gγ2, and the cells were fixed and their confocal images were obtained. Nuclei were also stained with DAPI. Representative images of EGFP-Gβ2 and -Gγ2 are respectively shown in C, whereas mean ± SEM values of their signal intensities in the nucleus and the cytoplasm obtained from over 20 cells are shown in D. (E and F) EGFP-Gβ2 translocated into the nucleus with DsRed2-GR in response to 10 −6 M of dexamethasone in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-Gβ2 and pDsRed2-GRα. Confocal images of EGFP-Gβ2 and DsRed2-GR were obtained before and 30 min after the treatment with 10 −6 M of dexamethasone. Representative images are shown in D, whereas mean ± SEM values of signal intensities in the nucleus (black bars) and the cytoplasm (white bars) obtained from over 20 cells is shown in E. (G) EGFP-Gβ2 and DsRed2-GR are colocalized at the plasma membrane in response to somatostatin in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-Gβ2, pDSRed2-GRα, and Gγ2- and SSTR2-expressing plasmids. Confocal images of EGFP-Gβ2 and DsRed2-GR were obtained before and 30 min after the treatment with 100 nM of somatostatin. Blue and orange arrows indicate signals of EGFP-Gβ2, DsRed2-GR, which are localized at the plasma membrane, whereas yellow arrows indicate their colocalization.
Figure Legend Snippet: Subcellular localization of Gβ2 and Gγ2 in HCT116 cells. (A) Endogenous Gβ and Gγ are visualized in the nucleus as well as in the cytoplasm/plasma membrane in HCT116 cells. Endogenous Gβ (left, top two panels) and Gγ (right, top two panels) were visualized by treatment with anti-Gβ or -Gγ2 antibodies, and FITC-labeled secondary antibody, and their confocal images were obtained. Nuclei were also stained with DAPI. Co-treatment of the samples with blocking peptides for anti-Gβ (left, bottom) or anti-Gγ2 (right, bottom) antibodies abolished their specific staining. Cells, expressing Gβ or Gγ exclusively in the cytoplasm, are indicated as “ℵ” and “a”, respectively, whereas cells retaining these molecules weakly or strongly in the nucleus are indicated as “ℑ” and “b”, and “ℜ” and “c”, respectively. (B) Endogenous Gβ and Gγ are detected in the nuclear fraction as well as in the cytoplasm and membrane fractions in HCT116 cells. HCT116 cells were lysed and their subcellular fractions were separated by centrifugation. 0.1 μg of protein of indicated subcellular fractions was run on SDS-PAGE gels, blotted to the nitrocellulose membranes, and Gβ and Gγ were visualized with their specific antibodies by reprobing the same membrane. Intracellular adhesion molecule 1 (ICAM1), α-tubulin, and Oct1, detected also by reprobing the same membrane with their specific antibodies, were respectively shown as positive controls for the membrane, cytoplasmic and nuclear fractions to indicate that the subcellular fractionation did not produce cross-contamination. (C and D) EGFP-Gβ2 was localized in the nucleus in addition to the cytoplasm, whereas EGFP-Gγ2 was detected in the nucleus and the cytoplasm, and at the plasma membrane in HCT116 cells. HCT116 cells were transfected with pEGFP-C-1-Gβ2 or -Gγ2, and the cells were fixed and their confocal images were obtained. Nuclei were also stained with DAPI. Representative images of EGFP-Gβ2 and -Gγ2 are respectively shown in C, whereas mean ± SEM values of their signal intensities in the nucleus and the cytoplasm obtained from over 20 cells are shown in D. (E and F) EGFP-Gβ2 translocated into the nucleus with DsRed2-GR in response to 10 −6 M of dexamethasone in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-Gβ2 and pDsRed2-GRα. Confocal images of EGFP-Gβ2 and DsRed2-GR were obtained before and 30 min after the treatment with 10 −6 M of dexamethasone. Representative images are shown in D, whereas mean ± SEM values of signal intensities in the nucleus (black bars) and the cytoplasm (white bars) obtained from over 20 cells is shown in E. (G) EGFP-Gβ2 and DsRed2-GR are colocalized at the plasma membrane in response to somatostatin in HCT116 cells. HCT116 cells were transfected with pEGFP-C1-Gβ2, pDSRed2-GRα, and Gγ2- and SSTR2-expressing plasmids. Confocal images of EGFP-Gβ2 and DsRed2-GR were obtained before and 30 min after the treatment with 100 nM of somatostatin. Blue and orange arrows indicate signals of EGFP-Gβ2, DsRed2-GR, which are localized at the plasma membrane, whereas yellow arrows indicate their colocalization.

Techniques Used: Labeling, Staining, Blocking Assay, Expressing, Centrifugation, SDS Page, Fractionation, Transfection

18) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

19) Product Images from "Role of TAF4 in Transcriptional Activation by Rta of Epstein-Barr Virus"

Article Title: Role of TAF4 in Transcriptional Activation by Rta of Epstein-Barr Virus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0054075

Mapping the interaction domains in TAF4 and Rta. (A) Plasmids that expressed deleted GFP-TAF4 were used to delineate the region in TAF4 that interacts with Rta. Numbers represent the positions of amino acids in TAF4. Q denotes the glutamine-rich regions. (B) 293T cells were cotransfected with pCMV-R and plasmids that expressed GFP fusion proteins including pEGFP-TAF4 (lanes 2, 7), pEGFP-TAF4-NM (lanes 3, 8), pEGFP-TAF4-C (lanes 4 and 9) or pEGFP-C1 (lanes 1, 6). Input lanes were loaded with 5% of the lysate (lanes 1–5). Proteins in the lysates were coimmunoprecipitated (IP) with anti-GFP antibody and analyzed by immunoblotting (IB) using anti-Rta antibody (lanes 6–9). (C) Deletion mutants of Rta were used to identify the region in Rta that interacts with TAF4. Numbers represent the positions of amino acids in Rta (D). Plasmids that expressed GFP-Rta (lanes 2, 7), GFP-N190 (lanes 3, 8), GFP-N191-415 (lanes 4, 9), GFP-Rev (lanes 5, 10) or GFP (lanes 1, 6) were transfected into 293T cells. The input lanes were loaded with 5% of the cell lysates and GFP-fusion proteins were detected using anti-GFP antibody (lanes 1–5). Proteins in the lysates were coimmunoprecipitated with anti-TAF4 antibody and analyzed by immunoblotting using anti-GFP antibody (lanes 6–10).
Figure Legend Snippet: Mapping the interaction domains in TAF4 and Rta. (A) Plasmids that expressed deleted GFP-TAF4 were used to delineate the region in TAF4 that interacts with Rta. Numbers represent the positions of amino acids in TAF4. Q denotes the glutamine-rich regions. (B) 293T cells were cotransfected with pCMV-R and plasmids that expressed GFP fusion proteins including pEGFP-TAF4 (lanes 2, 7), pEGFP-TAF4-NM (lanes 3, 8), pEGFP-TAF4-C (lanes 4 and 9) or pEGFP-C1 (lanes 1, 6). Input lanes were loaded with 5% of the lysate (lanes 1–5). Proteins in the lysates were coimmunoprecipitated (IP) with anti-GFP antibody and analyzed by immunoblotting (IB) using anti-Rta antibody (lanes 6–9). (C) Deletion mutants of Rta were used to identify the region in Rta that interacts with TAF4. Numbers represent the positions of amino acids in Rta (D). Plasmids that expressed GFP-Rta (lanes 2, 7), GFP-N190 (lanes 3, 8), GFP-N191-415 (lanes 4, 9), GFP-Rev (lanes 5, 10) or GFP (lanes 1, 6) were transfected into 293T cells. The input lanes were loaded with 5% of the cell lysates and GFP-fusion proteins were detected using anti-GFP antibody (lanes 1–5). Proteins in the lysates were coimmunoprecipitated with anti-TAF4 antibody and analyzed by immunoblotting using anti-GFP antibody (lanes 6–10).

Techniques Used: Transfection

Indirect immunofluorescence analysis. P3HR1 cells were transfected with pEGFP-C1 (A–D) or pEGFP-TAF4 (E–H) and then treated with sodium butyrate for 24 hr. Cells were incubated with monoclonal anti-Rta antibody and observed under a confocal laser-scanning microscope. DAPI staining revealed the positions of nuclei (A and E). D and H are merged images.
Figure Legend Snippet: Indirect immunofluorescence analysis. P3HR1 cells were transfected with pEGFP-C1 (A–D) or pEGFP-TAF4 (E–H) and then treated with sodium butyrate for 24 hr. Cells were incubated with monoclonal anti-Rta antibody and observed under a confocal laser-scanning microscope. DAPI staining revealed the positions of nuclei (A and E). D and H are merged images.

Techniques Used: Immunofluorescence, Transfection, Incubation, Laser-Scanning Microscopy, Staining

20) Product Images from "Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids"

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043283

Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
Figure Legend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

Techniques Used: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.
Figure Legend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

Techniques Used: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

Related Articles

Clone Assay:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: It should also be noted that as the RNA FISH probe also detected the abundant nuclear retained pre-egfp-HOTAIR (Figure , upper bands), the percentage (62%) of the actual fraction of processed egfp-HOTAIR localized in the nucleus (Supplementary Figure S6C) might actually be even lower. .. To exclude the possibility that the egfp mRNA-related processing may facilitate the cytoplasmic export of expressed RNAs when pEGFP-C1 was used, we also cloned the same intron2 from gene ANKRD52 ( ) and the lncRNAs HOTAIR and mNEAT1 , into pcDNA3.0, which does not express any tag sequences. .. By nuclear and cytoplasmic RNA fractionation from transfected HeLa cells followed by Northern blotting, we confirmed that in all cases, significant levels of the intronic sequence and the lncRNAs HOTAIR and mNEAT1 were found in the cytoplasm (Figure ).

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. A stop codon (indicated in bold in the 5′ end of the forward primer), and a restriction site for EcoRI and SalI (underlined) at the 5′ end of the forward and reverse primers respectively, were incorporated during amplification.

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The bleedthrough signal in collected uncompensated FACS data was eliminated by appropriate compensation using controls transfected with only one fluorescent reporter. .. phRL-SV40, pGL4-SV40, pEGFP-C1, and pBS plasmids were selected for deep sequencing. phRL-SV40 and pGL4-SV40 represent common Renilla and firefly luciferase reporter plasmids. pGL4-SV40 represents a newer generation of firefly luciferase reporters where putative mammalian transcription factor-binding sites in the plasmid backbone have been extensively mutated to minimize spurious expression . pEGFP-C1 belongs to a family of plasmids for expressing protein fusions with the enhanced green fluorescent protein (EGFP). pBS is a common small cloning plasmid without any annotated eukaryotic transcription unit. .. All four plasmids utilize pUC prokaryotic origin of replication. phRL-SV40, pGL4-SV40, and pBS carry β-lactamase gene providing ampicillin resistance (Ampr ) while pEGFP-C1 encodes kanamycin/neomycin (Kan/Neo) resistance for selection in bacteria as well as in mammalian cells.

Amplification:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate His-VAP-A, human VAP-A was amplified by PCR from HEK293 cDNA and inserted into pET28a (EMD Biosciences) via NdeI and BamHI restriction sites. .. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites. .. To obtain mCherry-VAP-A, tubulin in pcDNA3.1-mCherry-Tubulin (kind gift from B. Giepmans, ( ) was replaced by a VAP-A PCR fragment via BspEI and XhoI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GFP-VPS13A constructs 2003–2606 and 2615–3174, the corresponding fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to the BamHI/KpnI site pEGFP-C1 with the Gibson assembly kit (NEB) according to the manufactures instructions.

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. Briefly, the 3′ UTRs of the three DENV serotypes were amplified by polymerase chain reaction (PCR) from viral RNA obtained from infected cell culture supernatants using specific primers (forward: 5′ GAATTC G TAG GTGCGGCTCATTGATTGGGCTAAC 3′ and reverse: 5′ GTCGAC GAACCTGTTGATTCAACAGCACC 3′).

Synthesized:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: As an additional control, a randomized oligonucleotide pool (H36A), that is, a preparation synthesized as a library of all possible 18-mers[A GA2][A GA3], was used. .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To obtain GST-FFAT, oligonucleotides encoding the FFAT domain in human VPS13A (AA 842–848), flanked with SalI and 3’ NotI sites, were synthesized, annealed and inserted into pGex5×2 via SalI and NotI restriction sites. .. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GST-VPS13A (2–854/D845A) and VPS13A-GFPΔFFAT , a mutagenesis was performed on GST-VPS13A (2-854) or VPS13-GFP respectively, with the QuickChange Site Directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.

Cytometry:

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The cells were analysed with a FACScan flow cytometer using the FACSdiva software. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ).

Construct:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. The obtained amplicon was then cloned into pGEM-T Easy vector (Promega) and subcloned by ligation into peGFP-SIIN to generate the peGFP-aLANA-SIIN plasmid.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: Paragraph title: Plasmids and constructs ... To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GFP-VPS13A constructs 2003–2606 and 2615–3174, the corresponding fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to the BamHI/KpnI site pEGFP-C1 with the Gibson assembly kit (NEB) according to the manufactures instructions.

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: When expressed from the snoVector, all mNEAT1 sequences localized to punctate locations within the nucleus. .. When expressed from pEGFP-C1, only the full-length mNEAT1 transcripts showed similar nuclear punctate staining, with about 10% transfected cells also showing cytoplasmic signals (Figure , bottom left); more strikingly, the cytoplasmic staining was prominent in most transfected cells for all truncated constructs and was especially prominent for some of the constructs (Figure and ). .. The same observations were further confirmed by RT-qPCR as shown in Figure .

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The percentage of infected cells in each sample and the total number of cells seeded per well were used to calculate the final virus titre. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. Briefly, the 3′ UTRs of the three DENV serotypes were amplified by polymerase chain reaction (PCR) from viral RNA obtained from infected cell culture supernatants using specific primers (forward: 5′ GAATTC G TAG GTGCGGCTCATTGATTGGGCTAAC 3′ and reverse: 5′ GTCGAC GAACCTGTTGATTCAACAGCACC 3′).

Luciferase:

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The bleedthrough signal in collected uncompensated FACS data was eliminated by appropriate compensation using controls transfected with only one fluorescent reporter. .. phRL-SV40, pGL4-SV40, pEGFP-C1, and pBS plasmids were selected for deep sequencing. phRL-SV40 and pGL4-SV40 represent common Renilla and firefly luciferase reporter plasmids. pGL4-SV40 represents a newer generation of firefly luciferase reporters where putative mammalian transcription factor-binding sites in the plasmid backbone have been extensively mutated to minimize spurious expression . pEGFP-C1 belongs to a family of plasmids for expressing protein fusions with the enhanced green fluorescent protein (EGFP). pBS is a common small cloning plasmid without any annotated eukaryotic transcription unit. .. All four plasmids utilize pUC prokaryotic origin of replication. phRL-SV40, pGL4-SV40, and pBS carry β-lactamase gene providing ampicillin resistance (Ampr ) while pEGFP-C1 encodes kanamycin/neomycin (Kan/Neo) resistance for selection in bacteria as well as in mammalian cells.

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The strongest repression of luciferase reporters was observed in co-transfection with pEGFP-C1 and pRFP-T plasmids carrying the Kan/Neo resistance gene. .. The inhibitory effect of pEGFP-C1 and pRFP-T was dose-dependent ( ) and was not restricted to luciferase reporters because pCI-RFPT-dependent red fluorescence was also inhibited by co-transfected pEGFP-C1 ( 1). .. Reduction of luciferase activities was apparently not due to cellular toxicity (no reduced growth or increased cell mortality were observed (Fig. S2)).

Infection:

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The percentage of infected cells in each sample and the total number of cells seeded per well were used to calculate the final virus titre. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ).

Expressing:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: Samples were thawed, clarified (100×g, 20 min, 4°C) and supernatants titrated by plaque assay as described previously [ ]. .. The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites.

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: As a first test using a biologically relevant RNA, we introduced into the snoVector the full-length sequence of mouse NEAT1 lncRNA (mNEAT1 or Menϵ , 3.2 kb) (Figure ), along with four fragments of mNEAT1 RNA ( ). .. As control, we inserted the same sequences into the 3’-UTR of a commonly used expression vector, pEGFP-C1 (Clontech). .. NEAT1 is a well characterized nuclear lncRNA that is involved in paraspeckle assembly and function ( , – ).

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: When expressed from the snoVector, full-length mNEAT1 is not only almost exclusively nuclear, but most of the transfected nuclear RNA (66%) co-localizes with the epitope-tagged p54nrb (Figure and Supplementary Figure S4A), and with the endogenous p54nrb with a similar ratio (61%) (Supplementary Figure S3B). .. This is largely true also for the full-length mNEAT1 expression from pEGFP-C1, although lower co-localization was seen with p54nrb in the nucleus (49%), compared to the snoVector expressed mNEAT1 (Figure and Supplementary Figure S4A). .. However, expression of mNEAT1 fragments showed much more dramatic differences when the two different expression vectors were used.

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The bleedthrough signal in collected uncompensated FACS data was eliminated by appropriate compensation using controls transfected with only one fluorescent reporter. .. phRL-SV40, pGL4-SV40, pEGFP-C1, and pBS plasmids were selected for deep sequencing. phRL-SV40 and pGL4-SV40 represent common Renilla and firefly luciferase reporter plasmids. pGL4-SV40 represents a newer generation of firefly luciferase reporters where putative mammalian transcription factor-binding sites in the plasmid backbone have been extensively mutated to minimize spurious expression . pEGFP-C1 belongs to a family of plasmids for expressing protein fusions with the enhanced green fluorescent protein (EGFP). pBS is a common small cloning plasmid without any annotated eukaryotic transcription unit. .. All four plasmids utilize pUC prokaryotic origin of replication. phRL-SV40, pGL4-SV40, and pBS carry β-lactamase gene providing ampicillin resistance (Ampr ) while pEGFP-C1 encodes kanamycin/neomycin (Kan/Neo) resistance for selection in bacteria as well as in mammalian cells.

Modification:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: The 2’-O-methyl modification renders the AO RNase H resistance and the phosphorothioate backbone greatly improves transmembrane uptake in cultured cells and increases serum half-life in vivo ( ). .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

Hybridization:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: The major advantages of 2’-O-methyl modifications in addition to the resistancy to RNase H cleavage is displaying lower toxicity and slightly increased hybridization affinities ( - ). .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

Transfection:

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: When expressed from the snoVector, all mNEAT1 sequences localized to punctate locations within the nucleus. .. When expressed from pEGFP-C1, only the full-length mNEAT1 transcripts showed similar nuclear punctate staining, with about 10% transfected cells also showing cytoplasmic signals (Figure , bottom left); more strikingly, the cytoplasmic staining was prominent in most transfected cells for all truncated constructs and was especially prominent for some of the constructs (Figure and ). .. The same observations were further confirmed by RT-qPCR as shown in Figure .

Ligation:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Northern Blot:

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: As control, we inserted the same sequences into the 3’-UTR of a commonly used expression vector, pEGFP-C1 (Clontech). .. These unique characteristics of mNEAT1 allowed us to (i) design probes to discriminate the vector-expressed mNEAT1 from the endogenous human NEAT1 (hNEAT1 ) after introduction into human cells; (ii) test whether introducing mNEAT1 into cells using snoVectors would constrain it to the nucleus and whether the overexpressed mNEAT1 would assemble into paraspeckle-like structures; and (iii) compare the expression pattern of mNEAT1 and the truncated mNEAT1 RNA fragments when expressed from our snoVector or from a commonly used vector.

Cell Culture:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: The 2’-O-methyl modification renders the AO RNase H resistance and the phosphorothioate backbone greatly improves transmembrane uptake in cultured cells and increases serum half-life in vivo ( ). .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

Generated:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector.

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. The PCR products were purified and cloned into the pEGFP-C1 construct, using the EcoRI and SalI enzymes (Thermo Scientific, NH, USA).

other:

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: When the same sequences were inserted into pEGFP-C1, in each case there was significant cytoplasmic localization (Figure and ).

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: For example, fragment v1 of mNEAT1 was nuclear and mostly associated with p54nrb when expressed from the snoVector, but almost half of the v1 expressed from pEGFP-C1 was cytoplasmic and almost none of such v1 fragment was associated with p54nrb (Figure and Supplementary Figure S4B).

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: To test if the presence of the Kan/Neo cassette is necessary for the inhibitory effect of pEGFP-C1 and pRFP-T on co-transfected plasmids, we replaced the Kan/Neo resistance in pEGFP-C1 and pRFP-T with ampicillin resistance (placed in the same orientation as Kan/Neo).

Sequencing:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: Samples were thawed, clarified (100×g, 20 min, 4°C) and supernatants titrated by plaque assay as described previously [ ]. .. The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: As a first test using a biologically relevant RNA, we introduced into the snoVector the full-length sequence of mouse NEAT1 lncRNA (mNEAT1 or Menϵ , 3.2 kb) (Figure ), along with four fragments of mNEAT1 RNA ( ). .. As control, we inserted the same sequences into the 3’-UTR of a commonly used expression vector, pEGFP-C1 (Clontech).

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The bleedthrough signal in collected uncompensated FACS data was eliminated by appropriate compensation using controls transfected with only one fluorescent reporter. .. phRL-SV40, pGL4-SV40, pEGFP-C1, and pBS plasmids were selected for deep sequencing. phRL-SV40 and pGL4-SV40 represent common Renilla and firefly luciferase reporter plasmids. pGL4-SV40 represents a newer generation of firefly luciferase reporters where putative mammalian transcription factor-binding sites in the plasmid backbone have been extensively mutated to minimize spurious expression . pEGFP-C1 belongs to a family of plasmids for expressing protein fusions with the enhanced green fluorescent protein (EGFP). pBS is a common small cloning plasmid without any annotated eukaryotic transcription unit. .. All four plasmids utilize pUC prokaryotic origin of replication. phRL-SV40, pGL4-SV40, and pBS carry β-lactamase gene providing ampicillin resistance (Ampr ) while pEGFP-C1 encodes kanamycin/neomycin (Kan/Neo) resistance for selection in bacteria as well as in mammalian cells.

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: Since pRFP-T exerted the same inhibitory effect as pEGFP-C1, we hypothesized that the inhibition is mediated by the plasmid backbone, which is common for both plasmids, and not by EGFP sequence or its expression. .. To get further insights into possible causes of inhibitory effects of pEGFP-C1, we re-examined deep sequencing data searching for any transcriptome features unique to pEGFP-C1. .. The analysis included size distribution of RNA fragments and frequency of A/G conversion (which is a hallmark of edited dsRNA ).

In Vivo:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: The 2’-O-methyl modification renders the AO RNase H resistance and the phosphorothioate backbone greatly improves transmembrane uptake in cultured cells and increases serum half-life in vivo ( ). .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

Fluorescence:

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The strongest repression of luciferase reporters was observed in co-transfection with pEGFP-C1 and pRFP-T plasmids carrying the Kan/Neo resistance gene. .. The inhibitory effect of pEGFP-C1 and pRFP-T was dose-dependent ( ) and was not restricted to luciferase reporters because pCI-RFPT-dependent red fluorescence was also inhibited by co-transfected pEGFP-C1 ( 1). .. Reduction of luciferase activities was apparently not due to cellular toxicity (no reduced growth or increased cell mortality were observed (Fig. S2)).

Mutagenesis:

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate the GST-VPS13A (2–854/D845A) and VPS13A-GFPΔFFAT , a mutagenesis was performed on GST-VPS13A (2-854) or VPS13-GFP respectively, with the QuickChange Site Directed mutagenesis kit (Agilent) according to the manufacturer’s protocol. .. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GST-VPS13A constructs 2–835, 2–854 and 835–1700, the fragments were amplified by PCR from the full length VPS13A plasmid and inserted into pGEX5×2 (GE Healthcare) via SalI and NotI restriction sites.

Flow Cytometry:

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The cells were analysed with a FACScan flow cytometer using the FACSdiva software. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ).

Purification:

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. A stop codon (indicated in bold in the 5′ end of the forward primer), and a restriction site for EcoRI and SalI (underlined) at the 5′ end of the forward and reverse primers respectively, were incorporated during amplification.

Polymerase Chain Reaction:

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate His-VAP-A, human VAP-A was amplified by PCR from HEK293 cDNA and inserted into pET28a (EMD Biosciences) via NdeI and BamHI restriction sites. .. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites. .. To obtain mCherry-VAP-A, tubulin in pcDNA3.1-mCherry-Tubulin (kind gift from B. Giepmans, ( ) was replaced by a VAP-A PCR fragment via BspEI and XhoI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GFP-VPS13A constructs 2003–2606 and 2615–3174, the corresponding fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to the BamHI/KpnI site pEGFP-C1 with the Gibson assembly kit (NEB) according to the manufactures instructions.

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. A stop codon (indicated in bold in the 5′ end of the forward primer), and a restriction site for EcoRI and SalI (underlined) at the 5′ end of the forward and reverse primers respectively, were incorporated during amplification.

Plasmid Preparation:

Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development
Article Snippet: As an additional control, a randomized oligonucleotide pool (H36A), that is, a preparation synthesized as a library of all possible 18-mers[A GA2][A GA3], was used. .. K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA). .. The thalassemic β-globin intron IVSI-110 or its wild-type equivalent IVSI was inserted into the EGFP cDNA sequence of the pEGFP C1 plasmid, between nucleotides 274 and 275 of the EGFP cassette using “gene splicing by overlap extension PCR” method resulting in an 854 bp PCR product [EGFP/I1-110 or pEGFP/ Intron wild type (Iwt ]. (The PCR product was cloned in pEGFP resulting in plasmids pEGFP/I1-110 or pEGFP/Iwt , respectively ( ).

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: Samples were thawed, clarified (100×g, 20 min, 4°C) and supernatants titrated by plaque assay as described previously [ ]. .. The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. AlHV-1 ORF73 coding sequence was amplified by PCR using primers Hin dIII-73N-Fwd and Kpn I-73CΔstop-Rev ( ) and AlHV-1 BAC DNA as template [ ].

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: To generate His-VAP-A, human VAP-A was amplified by PCR from HEK293 cDNA and inserted into pET28a (EMD Biosciences) via NdeI and BamHI restriction sites. .. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites. .. To obtain mCherry-VAP-A, tubulin in pcDNA3.1-mCherry-Tubulin (kind gift from B. Giepmans, ( ) was replaced by a VAP-A PCR fragment via BspEI and XhoI restriction sites.

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. .. To generate the GFP-VPS13A constructs 2003–2606 and 2615–3174, the corresponding fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to the BamHI/KpnI site pEGFP-C1 with the Gibson assembly kit (NEB) according to the manufactures instructions.

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: As a first test using a biologically relevant RNA, we introduced into the snoVector the full-length sequence of mouse NEAT1 lncRNA (mNEAT1 or Menϵ , 3.2 kb) (Figure ), along with four fragments of mNEAT1 RNA ( ). .. As control, we inserted the same sequences into the 3’-UTR of a commonly used expression vector, pEGFP-C1 (Clontech). .. NEAT1 is a well characterized nuclear lncRNA that is involved in paraspeckle assembly and function ( , – ).

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The percentage of infected cells in each sample and the total number of cells seeded per well were used to calculate the final virus titre. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ). .. Briefly, the 3′ UTRs of the three DENV serotypes were amplified by polymerase chain reaction (PCR) from viral RNA obtained from infected cell culture supernatants using specific primers (forward: 5′ GAATTC G TAG GTGCGGCTCATTGATTGGGCTAAC 3′ and reverse: 5′ GTCGAC GAACCTGTTGATTCAACAGCACC 3′).

Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids
Article Snippet: The bleedthrough signal in collected uncompensated FACS data was eliminated by appropriate compensation using controls transfected with only one fluorescent reporter. .. phRL-SV40, pGL4-SV40, pEGFP-C1, and pBS plasmids were selected for deep sequencing. phRL-SV40 and pGL4-SV40 represent common Renilla and firefly luciferase reporter plasmids. pGL4-SV40 represents a newer generation of firefly luciferase reporters where putative mammalian transcription factor-binding sites in the plasmid backbone have been extensively mutated to minimize spurious expression . pEGFP-C1 belongs to a family of plasmids for expressing protein fusions with the enhanced green fluorescent protein (EGFP). pBS is a common small cloning plasmid without any annotated eukaryotic transcription unit. .. All four plasmids utilize pUC prokaryotic origin of replication. phRL-SV40, pGL4-SV40, and pBS carry β-lactamase gene providing ampicillin resistance (Ampr ) while pEGFP-C1 encodes kanamycin/neomycin (Kan/Neo) resistance for selection in bacteria as well as in mammalian cells.

Software:

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: The cells were analysed with a FACScan flow cytometer using the FACSdiva software. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ).

Selection:

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites.

Produced:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. Subsequent plasmid constructs, including those containing the ORF73 coding sequence deleted of different subregions were generated either by ligation (T4 DNA ligase, Promega) or by homologous recombination using the In-Fusion HD cloning kit (Clontech) and primers listed in .

Marker:

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: A Xho I-Pci I fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a Xho I-Eco O109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites.

Staining:

Article Title: SnoVectors for nuclear expression of RNA
Article Snippet: When expressed from the snoVector, all mNEAT1 sequences localized to punctate locations within the nucleus. .. When expressed from pEGFP-C1, only the full-length mNEAT1 transcripts showed similar nuclear punctate staining, with about 10% transfected cells also showing cytoplasmic signals (Figure , bottom left); more strikingly, the cytoplasmic staining was prominent in most transfected cells for all truncated constructs and was especially prominent for some of the constructs (Figure and ). .. The same observations were further confirmed by RT-qPCR as shown in Figure .

Article Title: Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication
Article Snippet: For flow cytometry analyses, the cells were fixed using a Fixation/Permeabilisation buffer (eBioscience, San Diego, CA, USA), centrifuged and washed twice with PBS, and stained with the monoclonal antibody 4G2 (kindly provided by Dr P Desprès, Institut Pasteur, Paris) in a final volume of 100 mL. .. Generation of pGUD plasmid constructs - pGUD plasmids containing the 3′ UTRs of DENV-1, -2, or -4 downstream of green fluorescent protein (GFP) in the pEGFP-C1 (Clontech, CA, USA) construct were previously described ( ).

Variant Assay:

Article Title: Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility
Article Snippet: The full-length cDNA of the human VPS13A gene, variant 1A, was obtained as previously described ( ; ) and sub-cloned into pcDNA4-TO-mycHis (Invitrogen) to generate pcD13A-1A-mH, for expression in mammalian cells of VPS13A with a C-terminal myc +His tag (here referred to as VPS13A-Myc). .. To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites.

Homologous Recombination:

Article Title: Macavirus latency-associated protein evades immune detection through regulation of protein synthesis in cis depending upon its glycin/glutamate-rich domain
Article Snippet: The peGFP-C1 (Clontech) expression vector was used to clone the chicken ovalbumin epitope SIINFEKL coding sequence into Kpn I/Bam HI sites using annealed oligonucleotides Kpn I/Bam HI-SIIN-Fwd and Kpn I/Bam HI-SIIN-Rev ( ) and T4 DNA ligase (Roche) to generate the peGFP-SIIN vector. .. The obtained amplicon was then cloned into pGEM-T Easy vector (Promega) and subcloned by ligation into peGFP-SIIN to generate the peGFP-aLANA-SIIN plasmid.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa pegfp c1
    Deletion of the N- or the C-terminal intracellular domain diminishes the amount of <t>Gpm6a</t> on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of <t>EGFP</t> in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects revealed no significant differences between Gpm6a wt-EGFP vs Gpm6a ΔN-EGFP and Gpm6a wt-EGFP vs Gpm6a ΔC-EGFP. (B) The mean fluorescence intensity of the surface-labeled Gpm6a measured by flow cytometry in the population of EGFP-positive N2a cells transfected with the indicated vectors. Surface Gpm6a was labeleld by immunostaining of non-permeabilized cells with the rat anti-Gpm6a antibody followed by goat anti-rat IgG conjugated to Alexa Fluor 647. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p
    Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/TaKaRa
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Deletion of the N- or the C-terminal intracellular domain diminishes the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects revealed no significant differences between Gpm6a wt-EGFP vs Gpm6a ΔN-EGFP and Gpm6a wt-EGFP vs Gpm6a ΔC-EGFP. (B) The mean fluorescence intensity of the surface-labeled Gpm6a measured by flow cytometry in the population of EGFP-positive N2a cells transfected with the indicated vectors. Surface Gpm6a was labeleld by immunostaining of non-permeabilized cells with the rat anti-Gpm6a antibody followed by goat anti-rat IgG conjugated to Alexa Fluor 647. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Deletion of the N- or the C-terminal intracellular domain diminishes the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects revealed no significant differences between Gpm6a wt-EGFP vs Gpm6a ΔN-EGFP and Gpm6a wt-EGFP vs Gpm6a ΔC-EGFP. (B) The mean fluorescence intensity of the surface-labeled Gpm6a measured by flow cytometry in the population of EGFP-positive N2a cells transfected with the indicated vectors. Surface Gpm6a was labeleld by immunostaining of non-permeabilized cells with the rat anti-Gpm6a antibody followed by goat anti-rat IgG conjugated to Alexa Fluor 647. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Flow Cytometry, Cytometry, Fluorescence, Transfection, Labeling, Immunostaining

    Deletion of the C-terminal cytosolic domain diminishes colocalization of Gpm6a with clathrin in hippocampal neurons. (A) Confocal images of hippocampal neurons (4 DIV) transfected with the indicated vectors (green) and immunostained with antibody against clathrin (red). A portion of Gpm6a-labeled spots colocalizes with clathrin upon overexpression of Gpm6a wt-EGFP and Gpm6a ΔN-EGFP (arrowheads; insets 1). Colocalization diminishes upon overexpression of Gpm6a ΔC-EGFP (arrowhead; inset 1). Fluorescence intensity profiles of the Gpm6a wt, or the ΔN-, or the ΔC- (green) and the anti-clathrin (red) along the white lines 2 indicated in the corresponding ROIs show the overlap of both signals. Scale bar, 20 μm. (B) Colocalization was evaluated in ROIs (25 × 25 pixels) as described in the Methods section. Mander’s colocalization coefficients using the calculated thresholds (tM) were determined for the red and the green channel. Ten to twenty neurons per group done in duplicates were analyzed. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparison test for post hoc effects. ∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Deletion of the C-terminal cytosolic domain diminishes colocalization of Gpm6a with clathrin in hippocampal neurons. (A) Confocal images of hippocampal neurons (4 DIV) transfected with the indicated vectors (green) and immunostained with antibody against clathrin (red). A portion of Gpm6a-labeled spots colocalizes with clathrin upon overexpression of Gpm6a wt-EGFP and Gpm6a ΔN-EGFP (arrowheads; insets 1). Colocalization diminishes upon overexpression of Gpm6a ΔC-EGFP (arrowhead; inset 1). Fluorescence intensity profiles of the Gpm6a wt, or the ΔN-, or the ΔC- (green) and the anti-clathrin (red) along the white lines 2 indicated in the corresponding ROIs show the overlap of both signals. Scale bar, 20 μm. (B) Colocalization was evaluated in ROIs (25 × 25 pixels) as described in the Methods section. Mander’s colocalization coefficients using the calculated thresholds (tM) were determined for the red and the green channel. Ten to twenty neurons per group done in duplicates were analyzed. Data are means ± SEM of two independent experiments. One-way ANOVA followed by Dunnett’s multiple comparison test for post hoc effects. ∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Transfection, Labeling, Over Expression, Fluorescence

    Substitution with alanine of K255 and E258 diminishes the amount of expressed protein and the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Substitution with alanine of K255 and E258 diminishes the amount of expressed protein and the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Flow Cytometry, Cytometry, Fluorescence, Transfection

    Deletion of the C-terminal intracellular domain of Gpm6a interferes with filopodium formation in hippocampal neurons but a function blocking anti-Gpm6a antibody recognizes surface exposed epitopes of both the ΔN and the ΔC Gpm6a. (A) Micrographs of primary hippocampal neurons (4 DIV) transfected with the indicated vectors and immunostained with rat anti-Gpm6a mAb in non-permeabilized cells. Goat anti-rat IgG labeled with rhodamine red was used as a secondary antibody. Maximized views of neurites show that the surface-exposed regions of Gpm6a wt-EGFP as well as both the Gpm6a ΔN-EGFP and the Gpm6a ΔC-EGFP are recognized by the anti-Gpm6a antibody. Scale bar, 20 μm. (B,C) Filopodium density (the number of protrusions per 45-μm of neurite length) as shown in the maximized views was quantified. Data are means ± SEM. Twenty to thirty three neurons per group done in duplicates were analyzed in multiple independent experiments. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects, (B) Gpm6a ΔN-EGFP: ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Deletion of the C-terminal intracellular domain of Gpm6a interferes with filopodium formation in hippocampal neurons but a function blocking anti-Gpm6a antibody recognizes surface exposed epitopes of both the ΔN and the ΔC Gpm6a. (A) Micrographs of primary hippocampal neurons (4 DIV) transfected with the indicated vectors and immunostained with rat anti-Gpm6a mAb in non-permeabilized cells. Goat anti-rat IgG labeled with rhodamine red was used as a secondary antibody. Maximized views of neurites show that the surface-exposed regions of Gpm6a wt-EGFP as well as both the Gpm6a ΔN-EGFP and the Gpm6a ΔC-EGFP are recognized by the anti-Gpm6a antibody. Scale bar, 20 μm. (B,C) Filopodium density (the number of protrusions per 45-μm of neurite length) as shown in the maximized views was quantified. Data are means ± SEM. Twenty to thirty three neurons per group done in duplicates were analyzed in multiple independent experiments. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects, (B) Gpm6a ΔN-EGFP: ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Blocking Assay, Transfection, Labeling

    Substitution with alanine of K250, D253/K255, and E258/E259 of Gpm6a interferes with filopodium formation in primary hippocampal neurons but does not prevent mutant recognition by the function blocking anti-Gpm6a antibody. (A) Micrographs of primary hippocampal neurons (4 DIV) transfected with the indicated vectors and immunostained with rat anti-Gpm6a mAb in non-permeabilized cells. Goat anti-rat IgG labeled with rhodamine red was used as a secondary antibody. Maximized views of neurites show that the surface-exposed epitopes of the wt Gpm6a and the mutant proteins K250A, D253A/K255A, and E258A/E259A are recognized by the anti-Gpm6a antibody. Scale bar, 20 μm. (B–D) Filopodium density (the number of protrusions per 45-μm of neurite length) as shown in the maximized views was quantified. Data are means ± SEM. Ten to twenty neurons per group done in duplicates were analyzed in two independent experiments. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. (B) K250A-EGFP: ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Substitution with alanine of K250, D253/K255, and E258/E259 of Gpm6a interferes with filopodium formation in primary hippocampal neurons but does not prevent mutant recognition by the function blocking anti-Gpm6a antibody. (A) Micrographs of primary hippocampal neurons (4 DIV) transfected with the indicated vectors and immunostained with rat anti-Gpm6a mAb in non-permeabilized cells. Goat anti-rat IgG labeled with rhodamine red was used as a secondary antibody. Maximized views of neurites show that the surface-exposed epitopes of the wt Gpm6a and the mutant proteins K250A, D253A/K255A, and E258A/E259A are recognized by the anti-Gpm6a antibody. Scale bar, 20 μm. (B–D) Filopodium density (the number of protrusions per 45-μm of neurite length) as shown in the maximized views was quantified. Data are means ± SEM. Ten to twenty neurons per group done in duplicates were analyzed in two independent experiments. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. (B) K250A-EGFP: ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Mutagenesis, Blocking Assay, Transfection, Labeling

    Substitution with alanine of K250, D253/K255, and E258/E259 diminishes the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects revealed no significant differences between Gpm6a wt-EGFP vs K250A-EGFP, Gpm6a wt-EGFP vs D253A/K255A-EGFP, and Gpm6a wt-EGFP vs E258A/E259A-EGFP. (B) The mean fluorescence intensity of the surface-labeled Gpm6a measured by flow cytometry in the population of EGFP-positive N2a cells transfected with the indicated vectors. Surface Gpm6a was labeleld by immunostaining of non-permeabilized cells with the rat anti-Gpm6a antibody followed by goat anti-rat IgG conjugated to Alexa Fluor 647. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Substitution with alanine of K250, D253/K255, and E258/E259 diminishes the amount of Gpm6a on cell surface. (A) Flow cytometry was used to measure and calculate the mean fluorescence intensity of EGFP in the population of EGFP-positive N2a cells transfected with the indicated vectors as a measure of the total amount of EGFP-tagged proteins. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects revealed no significant differences between Gpm6a wt-EGFP vs K250A-EGFP, Gpm6a wt-EGFP vs D253A/K255A-EGFP, and Gpm6a wt-EGFP vs E258A/E259A-EGFP. (B) The mean fluorescence intensity of the surface-labeled Gpm6a measured by flow cytometry in the population of EGFP-positive N2a cells transfected with the indicated vectors. Surface Gpm6a was labeleld by immunostaining of non-permeabilized cells with the rat anti-Gpm6a antibody followed by goat anti-rat IgG conjugated to Alexa Fluor 647. Data are means ± SEM of three independent experiments. One-way ANOVA followed by Dunnett’s multiple comparisons test for post hoc effects, ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Flow Cytometry, Cytometry, Fluorescence, Transfection, Labeling, Immunostaining

    Deletion of the C-terminal but not the N-terminal intracellular domain of Gpm6a interferes with filopodium formation in neuroblastoma cell line N2a. (A) Schematic structure of the EGFP-tagged wild type (wt) Gpm6a and Gpm6a deletion constructs: Gpm6a wt-EGFP (full length wt Gpm6a, 1–278 aa), Gpm6a ΔN-EGFP (Δ1–16), Gpm6a ΔC-EGFP (Δ243–278). The domain organization is indicated by colored boxes: the N-terminal and the C-terminal intracellular domains (red); the four transmembrane domains (TM1-4; gray); the intracellular (IC), the small extracellular (EC1), and the large extracellular (EC2) loops (white). (B) Western blot of lysates from N2a cells overexpressing the indicated constructs. Immunnoblot (IB) was analyzed using the rabbit anti-GFP antibody detected by the goat anti-rabbit secondary IRDye800 CW. Bands representing Gpm6a proteins are indicated by asteriscs. As a loading control alpha-tubulin was detected using the mouse anti-alpha-tubulin monoclonal antibody followed by the goat anti-mouse secondary IRDye680 LT. Below, the control Western blot of lysates from non-transfected N2a cells or N2a overexpressing EGFP alone shows the specificty of detected signal. (C) Localization of ΔN and ΔC Gpm6a mutants in N2a cells. Confocal images of N2a cells transfected with the indicated vectors and labeled with rhodamine red-conjugated phalloidin to visualize F-actin cytoskeleton. Gpm6a wt-EGFP and EGFP alone were used as controls. Gpm6a wt-EGFP and Gpm6a ΔN-EGFP accumulate at plasma membrane and in filopodial protrusions (second and third row). Gpm6a ΔN-EGFP and Gpm6a ΔC-EGFP show higher cytoplasmic localization comparing to the wt Gpm6a. Overexpression of Gpm6a ΔC-EGFP does not induce filopodia formation (bottom row). Scale bar, 10 μm. (D,E) The percentage of transfected N2a cells showing filopodia was quantified in red channel visualizing rhodamine red-phalloidin. On average, 97–119 cells for each transfection condition done in duplicates were analyzed in multiple experiments. Data are means ± SEM. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. (D) Gpm6a ΔN-EGFP: ∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Deletion of the C-terminal but not the N-terminal intracellular domain of Gpm6a interferes with filopodium formation in neuroblastoma cell line N2a. (A) Schematic structure of the EGFP-tagged wild type (wt) Gpm6a and Gpm6a deletion constructs: Gpm6a wt-EGFP (full length wt Gpm6a, 1–278 aa), Gpm6a ΔN-EGFP (Δ1–16), Gpm6a ΔC-EGFP (Δ243–278). The domain organization is indicated by colored boxes: the N-terminal and the C-terminal intracellular domains (red); the four transmembrane domains (TM1-4; gray); the intracellular (IC), the small extracellular (EC1), and the large extracellular (EC2) loops (white). (B) Western blot of lysates from N2a cells overexpressing the indicated constructs. Immunnoblot (IB) was analyzed using the rabbit anti-GFP antibody detected by the goat anti-rabbit secondary IRDye800 CW. Bands representing Gpm6a proteins are indicated by asteriscs. As a loading control alpha-tubulin was detected using the mouse anti-alpha-tubulin monoclonal antibody followed by the goat anti-mouse secondary IRDye680 LT. Below, the control Western blot of lysates from non-transfected N2a cells or N2a overexpressing EGFP alone shows the specificty of detected signal. (C) Localization of ΔN and ΔC Gpm6a mutants in N2a cells. Confocal images of N2a cells transfected with the indicated vectors and labeled with rhodamine red-conjugated phalloidin to visualize F-actin cytoskeleton. Gpm6a wt-EGFP and EGFP alone were used as controls. Gpm6a wt-EGFP and Gpm6a ΔN-EGFP accumulate at plasma membrane and in filopodial protrusions (second and third row). Gpm6a ΔN-EGFP and Gpm6a ΔC-EGFP show higher cytoplasmic localization comparing to the wt Gpm6a. Overexpression of Gpm6a ΔC-EGFP does not induce filopodia formation (bottom row). Scale bar, 10 μm. (D,E) The percentage of transfected N2a cells showing filopodia was quantified in red channel visualizing rhodamine red-phalloidin. On average, 97–119 cells for each transfection condition done in duplicates were analyzed in multiple experiments. Data are means ± SEM. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. (D) Gpm6a ΔN-EGFP: ∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Construct, Western Blot, Transfection, Labeling, Over Expression

    Effect on filopodium formation of separate substitution with alanine of D253, K255, E258, and E259 in the C-terminal cytosolic end of Gpm6a in neuroblastoma cell line N2a. (A) Confocal images of N2a cells transfected with the indicated vectors and labeled with rhodamine red-conjugated phalloidin to visualize F-actin cytoskeleton. Gpm6a wt-EGFP and EGFP alone were used as controls. D253A, K255A, and E259A localize to the plasma membrane of N2a and induce formation of filopodia similarly to the wt Gpm6a. The formation of filopodia is reduced upon overexpression of E258A when compared to the wt Gpm6a. Scale bar, 10 μm. (B) The percentage of transfected N2a cells showing filopodia was quantified in red channel visualizing rhodamine red-phalloidin. On average, 137–181 cells for each transfection condition done in duplicates were analyzed in multiple experiments. Data are means ± SEM. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. ∗∗∗ p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Alanine Scanning Mutagenesis of the C-Terminal Cytosolic End of Gpm6a Identifies Key Residues Essential for the Formation of Filopodia

    doi: 10.3389/fnmol.2018.00314

    Figure Lengend Snippet: Effect on filopodium formation of separate substitution with alanine of D253, K255, E258, and E259 in the C-terminal cytosolic end of Gpm6a in neuroblastoma cell line N2a. (A) Confocal images of N2a cells transfected with the indicated vectors and labeled with rhodamine red-conjugated phalloidin to visualize F-actin cytoskeleton. Gpm6a wt-EGFP and EGFP alone were used as controls. D253A, K255A, and E259A localize to the plasma membrane of N2a and induce formation of filopodia similarly to the wt Gpm6a. The formation of filopodia is reduced upon overexpression of E258A when compared to the wt Gpm6a. Scale bar, 10 μm. (B) The percentage of transfected N2a cells showing filopodia was quantified in red channel visualizing rhodamine red-phalloidin. On average, 137–181 cells for each transfection condition done in duplicates were analyzed in multiple experiments. Data are means ± SEM. One-way ANOVA followed by Tukey’s multiple comparison test for post hoc effects. ∗∗∗ p

    Article Snippet: Mutations were introduced into the Gpm6a wt-EGFP, a mammalian expression plasmid that codes for the full length wt mouse Gpm6a (NCBI Accession: NP_705809.1) fused N-terminally with EGFP (vector pEGFP-C1; Clontech) that has been described previously ( ).

    Techniques: Transfection, Labeling, Over Expression

    Design of pol II promoter-driven knockdown construct. (A) Diagram of pol II-type promoter CMV driven-knockdown vector ( CMV promoter- actin-DsRed-BGH). DS: donor site; AS: acceptor site. The first 21-base pairs of exon 3 of zebrafish actin gene have been in-frame fused to the DsRed fluorescent protein gene followed by a bovine growth hormone (BGH) sequence as 3′UTR. (B) Red fluorescence was observed in 22 hpf embryos injected with the plasmid shown in panel A. (C) RT-PCR analysis with total RNAs derived from 22 hpf embryos shown in panel B. The primers used are indicated by horizontal arrows in panel A. (D) The sequence of RT-PCR product shown in pane C. Note that the entire intron 2 of the actin gene has been spliced out (arrow). (E) The mir-shRNA EGFP-SV40-1 was inserted into the intron 2 at the Bgl II site and co-injection with CMV-EGFP-SV40 reporter plasmid. (F) Knockdown of EGFP fluorescence in the 24 hpf embryos co-injected with EGFP-SV40 reporter plasmid plus CMV promoter-actin-DsRed-BGH plasmid carrying either mir-shRNA EGFP-ORF or mir-shRNA EGFP-SV40-1 . (G) RT-PCR analysis of total RNAs derived from 22 hpf embryos shown in panel F.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Design of pol II promoter-driven knockdown construct. (A) Diagram of pol II-type promoter CMV driven-knockdown vector ( CMV promoter- actin-DsRed-BGH). DS: donor site; AS: acceptor site. The first 21-base pairs of exon 3 of zebrafish actin gene have been in-frame fused to the DsRed fluorescent protein gene followed by a bovine growth hormone (BGH) sequence as 3′UTR. (B) Red fluorescence was observed in 22 hpf embryos injected with the plasmid shown in panel A. (C) RT-PCR analysis with total RNAs derived from 22 hpf embryos shown in panel B. The primers used are indicated by horizontal arrows in panel A. (D) The sequence of RT-PCR product shown in pane C. Note that the entire intron 2 of the actin gene has been spliced out (arrow). (E) The mir-shRNA EGFP-SV40-1 was inserted into the intron 2 at the Bgl II site and co-injection with CMV-EGFP-SV40 reporter plasmid. (F) Knockdown of EGFP fluorescence in the 24 hpf embryos co-injected with EGFP-SV40 reporter plasmid plus CMV promoter-actin-DsRed-BGH plasmid carrying either mir-shRNA EGFP-ORF or mir-shRNA EGFP-SV40-1 . (G) RT-PCR analysis of total RNAs derived from 22 hpf embryos shown in panel F.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: Construct, Plasmid Preparation, Sequencing, Fluorescence, Injection, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, shRNA

    Knockdown of EGFP sensors by mir-shRNA in vivo . (A) Diagram of miRNA-based shRNA EGFP-ORF (mir-shRNA EGFP-ORF ). The stem-loop region of miR-30e precursor was replaced with chemically synthesized shRNA EGFP-ORF oligonucleotides containing the same sequence as the miR-30e stem-loop, except that the miR-30e hairpin stem was changed to the sequence that was complementary to the open reading frame (ORF) of EGFP transcript. (B) Northern blot analysis of 12 and 24 hpf embryos injected with in vitro synthesized mir-shRNA EGFP-ORF mRNAs. The U6 promoter-driven expression of shRNA EGFP-ORF in 293T cells was used as a positive control (left lanes). (C) Diagram of various sensors containing one or two copies of binding sequence for mir-shRNA EGFP-ORF within the ORF or the 3′UTR. The 22-bp long binding sequence was inserted into the 3′UTR-SV40 of either EGFP or DsRed gene. (D) Individual capped sensor mRNAs was co-injected with either miR-30e precursor control or mir-shRNA EGFP-ORF . (E–H) Detection of EGFP and DsRed fluorescence in 24 hpf embryos injected with various sensor mRNAs. Red fluorescence was used as an injection control in E, F and G, and green fluorescence as injection control in H. (I) Western blot analysis of 24 hpf embryos shown in panels E–G. The β-actin was used as a loading control.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Knockdown of EGFP sensors by mir-shRNA in vivo . (A) Diagram of miRNA-based shRNA EGFP-ORF (mir-shRNA EGFP-ORF ). The stem-loop region of miR-30e precursor was replaced with chemically synthesized shRNA EGFP-ORF oligonucleotides containing the same sequence as the miR-30e stem-loop, except that the miR-30e hairpin stem was changed to the sequence that was complementary to the open reading frame (ORF) of EGFP transcript. (B) Northern blot analysis of 12 and 24 hpf embryos injected with in vitro synthesized mir-shRNA EGFP-ORF mRNAs. The U6 promoter-driven expression of shRNA EGFP-ORF in 293T cells was used as a positive control (left lanes). (C) Diagram of various sensors containing one or two copies of binding sequence for mir-shRNA EGFP-ORF within the ORF or the 3′UTR. The 22-bp long binding sequence was inserted into the 3′UTR-SV40 of either EGFP or DsRed gene. (D) Individual capped sensor mRNAs was co-injected with either miR-30e precursor control or mir-shRNA EGFP-ORF . (E–H) Detection of EGFP and DsRed fluorescence in 24 hpf embryos injected with various sensor mRNAs. Red fluorescence was used as an injection control in E, F and G, and green fluorescence as injection control in H. (I) Western blot analysis of 24 hpf embryos shown in panels E–G. The β-actin was used as a loading control.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: shRNA, In Vivo, Synthesized, Sequencing, Northern Blot, Injection, In Vitro, Expressing, Positive Control, Binding Assay, Fluorescence, Western Blot

    Efficient inhibition of EGFP expression by zebrafish mir-30e precursor in vivo . (A, B) Diagram of zebrafish miR-30e precursor sequence (A), and the EGFP sensor EGFP-2×PT mir30e containing two tandem perfectly complementary target sites for miR-30e binding (2×PT) in its 3′UTR (B, upper). The capped EGFP sensor mRNAs were co-injected with either miR-30e or miR-155 precursor mRNAs into one-cell stage embryos (B, bottom). (C) A dramatic decrease of EGFP fluorescence in 24 hpf embryos co-injected with EGFP-2×PT mir30e sensor (10 pg) and miR-30e precursor (50 pg). The DsRed mRNA was co-injected as an injection control (bottom panels). (D) Western blot analysis of 24 hpf embryos injected with EGFP-2×PT mir30e sensor and miR-155 precursor or miR-30e precursor. The upper non-specific bands were shown as a loading control.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Efficient inhibition of EGFP expression by zebrafish mir-30e precursor in vivo . (A, B) Diagram of zebrafish miR-30e precursor sequence (A), and the EGFP sensor EGFP-2×PT mir30e containing two tandem perfectly complementary target sites for miR-30e binding (2×PT) in its 3′UTR (B, upper). The capped EGFP sensor mRNAs were co-injected with either miR-30e or miR-155 precursor mRNAs into one-cell stage embryos (B, bottom). (C) A dramatic decrease of EGFP fluorescence in 24 hpf embryos co-injected with EGFP-2×PT mir30e sensor (10 pg) and miR-30e precursor (50 pg). The DsRed mRNA was co-injected as an injection control (bottom panels). (D) Western blot analysis of 24 hpf embryos injected with EGFP-2×PT mir30e sensor and miR-155 precursor or miR-30e precursor. The upper non-specific bands were shown as a loading control.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: Inhibition, Expressing, In Vivo, Sequencing, Binding Assay, Injection, Fluorescence, Western Blot

    Tissue-specific knockdown of chromosomally integrated EGFP expression. (A) Diagram of transgenic lines Tg( zgata-1:EGFP-SV40 ) and Tg( zgata-1:mir-shRNA EGFP-SV40-1 - actin-DsRed-BGH) line 1 under control of zebrafish gata-1 promoter. (B) Knockdown of EGFP fluorescence was observed in the mid- and hindbrain of the DsRed + , but not DsRed − F2 sibling at 48 hpf. Embryos are dorsal view with head to the left. (C) Knockdown of EGFP fluorescence was observed in the dorsal neurons and caudal hematopoietic tissue of the DsRed + , but not DsRed − F2 sibling at 72 hpf. MB: midbrain; HB: hindbrain; ys: yolk sac; DN: dorsal neurons; CHT: caudal hematopoietic tissue. Embryos are lateral view with head to the left. (D) Western blot analysis of EGFP expression in the DsRed − and DsRed + F2 embryos at 24, 48 and 72 hpf. The α-tubulin protein was used as a loading control.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Tissue-specific knockdown of chromosomally integrated EGFP expression. (A) Diagram of transgenic lines Tg( zgata-1:EGFP-SV40 ) and Tg( zgata-1:mir-shRNA EGFP-SV40-1 - actin-DsRed-BGH) line 1 under control of zebrafish gata-1 promoter. (B) Knockdown of EGFP fluorescence was observed in the mid- and hindbrain of the DsRed + , but not DsRed − F2 sibling at 48 hpf. Embryos are dorsal view with head to the left. (C) Knockdown of EGFP fluorescence was observed in the dorsal neurons and caudal hematopoietic tissue of the DsRed + , but not DsRed − F2 sibling at 72 hpf. MB: midbrain; HB: hindbrain; ys: yolk sac; DN: dorsal neurons; CHT: caudal hematopoietic tissue. Embryos are lateral view with head to the left. (D) Western blot analysis of EGFP expression in the DsRed − and DsRed + F2 embryos at 24, 48 and 72 hpf. The α-tubulin protein was used as a loading control.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: Expressing, Transgenic Assay, shRNA, Fluorescence, Dominant Negative Mutation, Western Blot

    Knockdown of endogenous cellular chordin expression. (A) Diagram of mir- shRNA chordin-3′UTR-1 and mir-shRNA chordin-3′UTR-2 against the 3′UTR of chordin gene, whose predicted secondary structure was shown at the bottom. Red brackets denoted the targeted regions. (B) Free-energy of the targeted regions and corresponding flanking sequence predicted with mFold software. (C) Phenotypes of chordin -deficient embryos. WISH analysis of chordin expression in the 6 hpf embryos injected with 200 pg of shRNA EGFP-ORF (control), shRNA chordin-3′UTR-1 or shRNA chordin-3′UTR-2 mRNAs using a dig-labeled full-length 3′UTR of chordin as probe (upper panels). A significantly enlarged ICM (black arrowhead) with a partial loss of neural tissues (white arrow, 61/99) were observed in 24 hpf embryos injected with only shRNA chordin-3′UTR-1 , but not with shRNA chordin-3′UTR-2 and control (middle panels). A higher level of gata-1 expression was also detected in the shRNA chordin-3′UTR-1 -injected embryos, compared to control or shRNA chordin-3′UTR-2 -injetced embryos (bottom panels). (D) Morphology of embryos injected with chordin morpholino oligonucleotides and its 4-base pair mismatch control. Embryos at 6 hpf are dorsal view, and embryos at 24 hpf are lateral views with head to the left.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Knockdown of endogenous cellular chordin expression. (A) Diagram of mir- shRNA chordin-3′UTR-1 and mir-shRNA chordin-3′UTR-2 against the 3′UTR of chordin gene, whose predicted secondary structure was shown at the bottom. Red brackets denoted the targeted regions. (B) Free-energy of the targeted regions and corresponding flanking sequence predicted with mFold software. (C) Phenotypes of chordin -deficient embryos. WISH analysis of chordin expression in the 6 hpf embryos injected with 200 pg of shRNA EGFP-ORF (control), shRNA chordin-3′UTR-1 or shRNA chordin-3′UTR-2 mRNAs using a dig-labeled full-length 3′UTR of chordin as probe (upper panels). A significantly enlarged ICM (black arrowhead) with a partial loss of neural tissues (white arrow, 61/99) were observed in 24 hpf embryos injected with only shRNA chordin-3′UTR-1 , but not with shRNA chordin-3′UTR-2 and control (middle panels). A higher level of gata-1 expression was also detected in the shRNA chordin-3′UTR-1 -injected embryos, compared to control or shRNA chordin-3′UTR-2 -injetced embryos (bottom panels). (D) Morphology of embryos injected with chordin morpholino oligonucleotides and its 4-base pair mismatch control. Embryos at 6 hpf are dorsal view, and embryos at 24 hpf are lateral views with head to the left.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: Expressing, shRNA, Sequencing, Software, Injection, Labeling

    Knockdown of endogenous α-catenin expression. (A) Diagram of mir-shRNA α-catenin-3′UTR-1 and mir-shRNA α-catenin-3′UTR-2 against the 3′UTR of α-catenin gene, whose predicted secondary structure was shown at the bottom. Red brackets denoted the targeted regions. (B) WISH analysis of α-catenin expression in the 8 hpf embryos injected with 160 pg of either shRNA EGFP-ORF , shRNA α-catenin-3′UTR-1 or shRNA α-catenin-3′UTR-2 mRNAs. (C) Quantitative Western blot analysis of α-catenin protein in 22 hpf embryos injected with shRNAs shown in panels B (5 embryos for each lane). (D) Diagram of mir-shRNA duplexes carrying two copies of shRNA EGFP-ORF (duplex 0×), one copy for each shRNA EGFP-ORF and shRNA α-catenin-3′UTR-1 (duplex 1×), and two copies of shRNA α-catenin-3′UTR-1 (duplex 2×). Northern and Western blot analyses of 22 hpf embryos injected with shRNAs 0×, 1× or 2× as shown at the bottom (100 embryos for each line). The ribosomal 5S RNA and β-actin was used as a loading control, respectively. (E) Diagram of mir-shRNA fourplexes carrying four copies of shRNA EGFP-ORF (0×), two copies for each shRNA EGFP-ORF and shRNA α-catenin-3′UTR-1 (2×), and four copies of shRNA α-catenin-3′UTR-1 (4×). Northern blot analysis of 22 hpf embryos injected with shRNAs 0×, 2× or 4× (100 embryos for each line). The ribosomal RNA was used as a loading control.

    Journal: PLoS ONE

    Article Title: Heritable and Lineage-Specific Gene Knockdown in Zebrafish Embryo

    doi: 10.1371/journal.pone.0006125

    Figure Lengend Snippet: Knockdown of endogenous α-catenin expression. (A) Diagram of mir-shRNA α-catenin-3′UTR-1 and mir-shRNA α-catenin-3′UTR-2 against the 3′UTR of α-catenin gene, whose predicted secondary structure was shown at the bottom. Red brackets denoted the targeted regions. (B) WISH analysis of α-catenin expression in the 8 hpf embryos injected with 160 pg of either shRNA EGFP-ORF , shRNA α-catenin-3′UTR-1 or shRNA α-catenin-3′UTR-2 mRNAs. (C) Quantitative Western blot analysis of α-catenin protein in 22 hpf embryos injected with shRNAs shown in panels B (5 embryos for each lane). (D) Diagram of mir-shRNA duplexes carrying two copies of shRNA EGFP-ORF (duplex 0×), one copy for each shRNA EGFP-ORF and shRNA α-catenin-3′UTR-1 (duplex 1×), and two copies of shRNA α-catenin-3′UTR-1 (duplex 2×). Northern and Western blot analyses of 22 hpf embryos injected with shRNAs 0×, 1× or 2× as shown at the bottom (100 embryos for each line). The ribosomal 5S RNA and β-actin was used as a loading control, respectively. (E) Diagram of mir-shRNA fourplexes carrying four copies of shRNA EGFP-ORF (0×), two copies for each shRNA EGFP-ORF and shRNA α-catenin-3′UTR-1 (2×), and four copies of shRNA α-catenin-3′UTR-1 (4×). Northern blot analysis of 22 hpf embryos injected with shRNAs 0×, 2× or 4× (100 embryos for each line). The ribosomal RNA was used as a loading control.

    Article Snippet: H 1 pol III promoter-driven shRNA and EGFP reporter (pEGFP-C1, Clontech) and DsRed plasmid were cotransfected with a ratio (20∶1∶2) into the HEK293T cells using the calcium phosphate method.

    Techniques: Expressing, shRNA, Injection, Western Blot, Northern Blot

    Analysis of RT-PCR products by capillary electro-phoresis following transient transfection of EGFP plasmids into K562 cells. A) pEGFP C1. B) pEGFP C1 + I wt , C) pEGFP C1+ I 1-110 . Peaks “a” and “f” correspond to lower (15 bp) and upper (1500 bp) internal markers in capillary electrophoresis. Peak “b” corresponds to β-actin. Peak “c” corresponds the correctly spliced product (140 bp). Peak “d” in panel C corresponds to the aberrantly spliced product (159 bp). Percentages (19.6% and 80.4%) in panel C correspond to correctly and aberrantly product, respectively. Peak “e” in panel B and C indicate to pre mRNA in pEGFP C1 + I wt and pEGFP C1+ I 1-110 (270 bp)

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Analysis of RT-PCR products by capillary electro-phoresis following transient transfection of EGFP plasmids into K562 cells. A) pEGFP C1. B) pEGFP C1 + I wt , C) pEGFP C1+ I 1-110 . Peaks “a” and “f” correspond to lower (15 bp) and upper (1500 bp) internal markers in capillary electrophoresis. Peak “b” corresponds to β-actin. Peak “c” corresponds the correctly spliced product (140 bp). Peak “d” in panel C corresponds to the aberrantly spliced product (159 bp). Percentages (19.6% and 80.4%) in panel C correspond to correctly and aberrantly product, respectively. Peak “e” in panel B and C indicate to pre mRNA in pEGFP C1 + I wt and pEGFP C1+ I 1-110 (270 bp)

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Transfection, Electrophoresis

    Dose-dependent effects of antisense oligonucleotide (AO) treatment on pEGFP C1 +I 1-110 transfected cells. (A) RT-PCR analysis on K562 cells co-transiently transfected with AOs and pEGFP C1 + I IVSI-110 plasmid. Lane 1-3 correspond to untreated and pEGFP C1 and pEGFP C1 + I wt , pEGFP C1 + I IVSI-110 , respectively. Lanes 4-5 correspond to cells co-transfected with pEGFP C1 + I IVSI-110 and Mt2-AOs at 0.1, 1 and 10 μM, respectively. Lanes 6-9 correspond to cells pEGFP C1 + I IVSI-110 co-transfected with CR1-AOs at 0.1, 1 and 10 μM, respectively. Lane 10 and 11 correspond to pEGFP C1 + I wt co-transfected with Mt2-AO and CR1-AO at 10 μM concentration, respectively. (B) Relative amounts between normal (blue) and aberrant (red) splice RT-PCR products following AO therapy. Using Mt2-AO and CR2-AO at 1 μM resulted in 10% and 6% increase in normal splicing, respectively

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Dose-dependent effects of antisense oligonucleotide (AO) treatment on pEGFP C1 +I 1-110 transfected cells. (A) RT-PCR analysis on K562 cells co-transiently transfected with AOs and pEGFP C1 + I IVSI-110 plasmid. Lane 1-3 correspond to untreated and pEGFP C1 and pEGFP C1 + I wt , pEGFP C1 + I IVSI-110 , respectively. Lanes 4-5 correspond to cells co-transfected with pEGFP C1 + I IVSI-110 and Mt2-AOs at 0.1, 1 and 10 μM, respectively. Lanes 6-9 correspond to cells pEGFP C1 + I IVSI-110 co-transfected with CR1-AOs at 0.1, 1 and 10 μM, respectively. Lane 10 and 11 correspond to pEGFP C1 + I wt co-transfected with Mt2-AO and CR1-AO at 10 μM concentration, respectively. (B) Relative amounts between normal (blue) and aberrant (red) splice RT-PCR products following AO therapy. Using Mt2-AO and CR2-AO at 1 μM resulted in 10% and 6% increase in normal splicing, respectively

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Transfection, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Concentration Assay

    Time dependent effect of antisense oligonucleotide (AO) treatment on fluorescent index (FI) in pEGFP C1 +I wt transfected cells. EGFP activity in K562 cells co-transiently transfected with AOs and pEGFP + I wt plasmid. The activity of EGFP was normalized to total cellular EGFP fluorescence and is presented as FI. This figure shows that CR1-AO and Mt2-AO did not influence EGFP expression in cells co-transfected with pEGFP C1 + I wt plasmid

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Time dependent effect of antisense oligonucleotide (AO) treatment on fluorescent index (FI) in pEGFP C1 +I wt transfected cells. EGFP activity in K562 cells co-transiently transfected with AOs and pEGFP + I wt plasmid. The activity of EGFP was normalized to total cellular EGFP fluorescence and is presented as FI. This figure shows that CR1-AO and Mt2-AO did not influence EGFP expression in cells co-transfected with pEGFP C1 + I wt plasmid

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Transfection, Activity Assay, Plasmid Preparation, Fluorescence, Expressing

    Representative flowcytometric analysis of EGFP expression in splicing assays system. Panel A corresponds to K562 cells transfected with pEGFP C1, panel B corresponds to K562 cells transfected with pEGFP C1+ I wt and panel C corresponds to K562 cells transfected with pEGFP C1+ I 1-110

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Representative flowcytometric analysis of EGFP expression in splicing assays system. Panel A corresponds to K562 cells transfected with pEGFP C1, panel B corresponds to K562 cells transfected with pEGFP C1+ I wt and panel C corresponds to K562 cells transfected with pEGFP C1+ I 1-110

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Expressing, Transfection

    Comparison of FI values following transient transfection of EGFP plasmids. pEGFP C1, pEGFP C1+ I wt and pEGFP C1+ I 1-110 in K562 cells. Multiplying the percentage of EGFP positive cells with median peak fluorescence was used to derive FI. The FI values following transfection were calculated at 24 hrs, 48 hrs and 72 hr (Results represent the average of three independent experiments ± SD)

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Comparison of FI values following transient transfection of EGFP plasmids. pEGFP C1, pEGFP C1+ I wt and pEGFP C1+ I 1-110 in K562 cells. Multiplying the percentage of EGFP positive cells with median peak fluorescence was used to derive FI. The FI values following transfection were calculated at 24 hrs, 48 hrs and 72 hr (Results represent the average of three independent experiments ± SD)

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Transfection, Fluorescence

    RT-PCR analysis of the EGFP assay constructs. Lane 1, 2 and 3 correspond to RT-PCR analysis on pEGFP C1, pEGFP C1+ I wt and pEGFP C1+ I 1-110 , respectively. Lane M corresponds to molecular marker VIII (Roche). Lower panel illustrates the capillary electrophoresis of the corresponding lanes

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: RT-PCR analysis of the EGFP assay constructs. Lane 1, 2 and 3 correspond to RT-PCR analysis on pEGFP C1, pEGFP C1+ I wt and pEGFP C1+ I 1-110 , respectively. Lane M corresponds to molecular marker VIII (Roche). Lower panel illustrates the capillary electrophoresis of the corresponding lanes

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Construct, Marker, Electrophoresis

    Time and dose-dependent effect of antisense oligonucleotide (AO) treatment on fluorescent index (FI) with pEGFP C1 +I 1-110 transfected cells. EGFP activity in K562 cells co-transiently transfected with AOs and pEGFP C1 + I IVSI-110 plasmid (n=2). The activity of EGFP was normalized to total cellular EGFP fluorescence and is presented as FI

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    doi: 10.22038/IJBMS.2017.8840

    Figure Lengend Snippet: Time and dose-dependent effect of antisense oligonucleotide (AO) treatment on fluorescent index (FI) with pEGFP C1 +I 1-110 transfected cells. EGFP activity in K562 cells co-transiently transfected with AOs and pEGFP C1 + I IVSI-110 plasmid (n=2). The activity of EGFP was normalized to total cellular EGFP fluorescence and is presented as FI

    Article Snippet: K562 cell line, EGFP C1 plasmid, and pEGFP C1 were purchased from Clontech Laboratories, Inc. (Palo Alto, CA).

    Techniques: Transfection, Activity Assay, Plasmid Preparation, Fluorescence

    The GFP-tagged PCV2 ORF5 up-regulates IL-6, IL-8 and COX-2 expression in PAMs. PAMs were transfected with pEGFP-C1 or pEGFP-ORF5 plasmids and harvested at 48 h post-transfection. (A to C) The effect of PCV2 ORF5 expression on porcine IL-6, IL-8 and COX-2 transcription in cultured PAMs. Total RNA was extracted from cells expressing either GFP alone, GFP-ORF5 fusion, or untransfected cells. Realtime RT-PCR analysis of IL-6, IL-8 and COX-2 mRNA levels were normalized to the corresponding CT value for porcine β-actin mRNA. The results are mean ± SD and representative of three independent experiments. (D to F) The concentrations of IL-6, IL-8 and COX-2 in GFP-ORF5 expressing PAMs or control cells culture supernatants were measured by ELISA. Data are mean ± SD and representative of three independent experiments. * p

    Journal: PLoS ONE

    Article Title: Identification of Putative ORF5 Protein of Porcine Circovirus Type 2 and Functional Analysis of GFP-Fused ORF5 Protein

    doi: 10.1371/journal.pone.0127859

    Figure Lengend Snippet: The GFP-tagged PCV2 ORF5 up-regulates IL-6, IL-8 and COX-2 expression in PAMs. PAMs were transfected with pEGFP-C1 or pEGFP-ORF5 plasmids and harvested at 48 h post-transfection. (A to C) The effect of PCV2 ORF5 expression on porcine IL-6, IL-8 and COX-2 transcription in cultured PAMs. Total RNA was extracted from cells expressing either GFP alone, GFP-ORF5 fusion, or untransfected cells. Realtime RT-PCR analysis of IL-6, IL-8 and COX-2 mRNA levels were normalized to the corresponding CT value for porcine β-actin mRNA. The results are mean ± SD and representative of three independent experiments. (D to F) The concentrations of IL-6, IL-8 and COX-2 in GFP-ORF5 expressing PAMs or control cells culture supernatants were measured by ELISA. Data are mean ± SD and representative of three independent experiments. * p

    Article Snippet: After purification, the Eco RI/Bam HI fragment of ORF5 was directionally cloned into the mammalian expression vector pEGFP-C1 (Clontech).

    Techniques: Expressing, Transfection, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

    Proteasome inhibitors block the degradation of GFP-ORF5 protein. PAMs transfected with pEGFP-C1 or pEGFP-ORF5 were treated with 10 μM MG132, or with 30 μM BAPTA-AM, 50 μM E64, or 20 mM NH 4 Cl starting at 24 h after transfection. The cells were collected 12 h later and GFP-ORF5 proteins were detected by immunoblotting using anti-GFP antibody. EGFP was used as a control.

    Journal: PLoS ONE

    Article Title: Identification of Putative ORF5 Protein of Porcine Circovirus Type 2 and Functional Analysis of GFP-Fused ORF5 Protein

    doi: 10.1371/journal.pone.0127859

    Figure Lengend Snippet: Proteasome inhibitors block the degradation of GFP-ORF5 protein. PAMs transfected with pEGFP-C1 or pEGFP-ORF5 were treated with 10 μM MG132, or with 30 μM BAPTA-AM, 50 μM E64, or 20 mM NH 4 Cl starting at 24 h after transfection. The cells were collected 12 h later and GFP-ORF5 proteins were detected by immunoblotting using anti-GFP antibody. EGFP was used as a control.

    Article Snippet: After purification, the Eco RI/Bam HI fragment of ORF5 was directionally cloned into the mammalian expression vector pEGFP-C1 (Clontech).

    Techniques: Blocking Assay, Transfection

    Confirmation of the expression of the PCV2 ORF5 protein within PCV2-infected cells. (A)Western blot analysis of ORF5 protein expressed in bacterial cells or PAMs. Lysed samples were electrophoresed on15% SDS-PAGE gels, transferred onto nitrocellulose membranes and probed with specific antibodies. Lane a, protein molecular weight marker. Lane b, the GST-ORF5 protein purified from E. coli was detected by the pAb against PCV2 ORF5 protein. Lane c to e, the lysates of GST-ORF5-expressing, GST-expressing and blank E.coli were detected by rabbit anti-GST pAb respectively. Lane f, pEGFP-C1-transfected PAMs were probed with the pAb against PCV2 ORF5 protein. Lane g, pEGFP-ORF5-transfected PAMs were probed with the pAb against PCV2 ORF5 protein. (B) IFA analysis of PAMs infected with wide-type PCV2. At 48 h after infection, the cells were fixed and labeled with the rabbit anti-Cap pAbs (panel b) or mouse anti-ORF5 pAbs (panel d) for confocal microscopic analysis. As negative controls, mock-infected cells were also probed with the rabbit anti-Cap pAbs (panel a) or mouse anti-ORF5 pAbs (panel c). Nuclei were stained with Hoechst 33342 (bars, 10 μm).

    Journal: PLoS ONE

    Article Title: Identification of Putative ORF5 Protein of Porcine Circovirus Type 2 and Functional Analysis of GFP-Fused ORF5 Protein

    doi: 10.1371/journal.pone.0127859

    Figure Lengend Snippet: Confirmation of the expression of the PCV2 ORF5 protein within PCV2-infected cells. (A)Western blot analysis of ORF5 protein expressed in bacterial cells or PAMs. Lysed samples were electrophoresed on15% SDS-PAGE gels, transferred onto nitrocellulose membranes and probed with specific antibodies. Lane a, protein molecular weight marker. Lane b, the GST-ORF5 protein purified from E. coli was detected by the pAb against PCV2 ORF5 protein. Lane c to e, the lysates of GST-ORF5-expressing, GST-expressing and blank E.coli were detected by rabbit anti-GST pAb respectively. Lane f, pEGFP-C1-transfected PAMs were probed with the pAb against PCV2 ORF5 protein. Lane g, pEGFP-ORF5-transfected PAMs were probed with the pAb against PCV2 ORF5 protein. (B) IFA analysis of PAMs infected with wide-type PCV2. At 48 h after infection, the cells were fixed and labeled with the rabbit anti-Cap pAbs (panel b) or mouse anti-ORF5 pAbs (panel d) for confocal microscopic analysis. As negative controls, mock-infected cells were also probed with the rabbit anti-Cap pAbs (panel a) or mouse anti-ORF5 pAbs (panel c). Nuclei were stained with Hoechst 33342 (bars, 10 μm).

    Article Snippet: After purification, the Eco RI/Bam HI fragment of ORF5 was directionally cloned into the mammalian expression vector pEGFP-C1 (Clontech).

    Techniques: Expressing, Infection, SDS Page, Molecular Weight, Marker, Purification, Transfection, Immunofluorescence, Labeling, Staining

    Fluorescence detection and Western blot analyses of expression products of GFP-ORF5 fusion protein in PAMs. (A) The cells were observed under an inverted fluorescence microscope (100×). Panel a, mock-transfected PAMs. Panel b, pEGFP-C1- transfected PAMs. Panel c, pEGFP-ORF5- transfected PAMs. (B) Proteins were isolated from whole extracts of the cells expressing GFP-ORF5 protein and control cells, and then subjected to Western blot using anti-GFP antibody.

    Journal: PLoS ONE

    Article Title: Identification of Putative ORF5 Protein of Porcine Circovirus Type 2 and Functional Analysis of GFP-Fused ORF5 Protein

    doi: 10.1371/journal.pone.0127859

    Figure Lengend Snippet: Fluorescence detection and Western blot analyses of expression products of GFP-ORF5 fusion protein in PAMs. (A) The cells were observed under an inverted fluorescence microscope (100×). Panel a, mock-transfected PAMs. Panel b, pEGFP-C1- transfected PAMs. Panel c, pEGFP-ORF5- transfected PAMs. (B) Proteins were isolated from whole extracts of the cells expressing GFP-ORF5 protein and control cells, and then subjected to Western blot using anti-GFP antibody.

    Article Snippet: After purification, the Eco RI/Bam HI fragment of ORF5 was directionally cloned into the mammalian expression vector pEGFP-C1 (Clontech).

    Techniques: Fluorescence, Western Blot, Expressing, Microscopy, Transfection, Isolation